ID: 954442696

View in Genome Browser
Species Human (GRCh38)
Location 3:50530467-50530489
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954442696_954442702 11 Left 954442696 3:50530467-50530489 CCGGCTGCTGCGGCGGGGCCGGG No data
Right 954442702 3:50530501-50530523 CGCATGTGCACCCGTCCAGGTGG No data
954442696_954442701 8 Left 954442696 3:50530467-50530489 CCGGCTGCTGCGGCGGGGCCGGG No data
Right 954442701 3:50530498-50530520 CCGCGCATGTGCACCCGTCCAGG No data
954442696_954442706 29 Left 954442696 3:50530467-50530489 CCGGCTGCTGCGGCGGGGCCGGG No data
Right 954442706 3:50530519-50530541 GGTGGCCCTGCCCTACTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954442696 Original CRISPR CCCGGCCCCGCCGCAGCAGC CGG (reversed) Intergenic