ID: 954442699

View in Genome Browser
Species Human (GRCh38)
Location 3:50530485-50530507
Sequence ACATGCGCGGAGCAGCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954442699_954442706 11 Left 954442699 3:50530485-50530507 CCGGGCGGCTGCTCCGCGCATGT No data
Right 954442706 3:50530519-50530541 GGTGGCCCTGCCCTACTCTGCGG No data
954442699_954442712 22 Left 954442699 3:50530485-50530507 CCGGGCGGCTGCTCCGCGCATGT No data
Right 954442712 3:50530530-50530552 CCTACTCTGCGGCGCCGGCACGG No data
954442699_954442702 -7 Left 954442699 3:50530485-50530507 CCGGGCGGCTGCTCCGCGCATGT No data
Right 954442702 3:50530501-50530523 CGCATGTGCACCCGTCCAGGTGG No data
954442699_954442701 -10 Left 954442699 3:50530485-50530507 CCGGGCGGCTGCTCCGCGCATGT No data
Right 954442701 3:50530498-50530520 CCGCGCATGTGCACCCGTCCAGG No data
954442699_954442709 17 Left 954442699 3:50530485-50530507 CCGGGCGGCTGCTCCGCGCATGT No data
Right 954442709 3:50530525-50530547 CCTGCCCTACTCTGCGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954442699 Original CRISPR ACATGCGCGGAGCAGCCGCC CGG (reversed) Intergenic