ID: 954442701

View in Genome Browser
Species Human (GRCh38)
Location 3:50530498-50530520
Sequence CCGCGCATGTGCACCCGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954442696_954442701 8 Left 954442696 3:50530467-50530489 CCGGCTGCTGCGGCGGGGCCGGG No data
Right 954442701 3:50530498-50530520 CCGCGCATGTGCACCCGTCCAGG No data
954442699_954442701 -10 Left 954442699 3:50530485-50530507 CCGGGCGGCTGCTCCGCGCATGT No data
Right 954442701 3:50530498-50530520 CCGCGCATGTGCACCCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954442701 Original CRISPR CCGCGCATGTGCACCCGTCC AGG Intergenic
No off target data available for this crispr