ID: 954442946

View in Genome Browser
Species Human (GRCh38)
Location 3:50531612-50531634
Sequence GGGATGGGCAGCACCAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954442946_954442949 -5 Left 954442946 3:50531612-50531634 CCAAGGCTGGTGCTGCCCATCCC No data
Right 954442949 3:50531630-50531652 ATCCCAACCCCCAGAGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954442946 Original CRISPR GGGATGGGCAGCACCAGCCT TGG (reversed) Intergenic
No off target data available for this crispr