ID: 954444124

View in Genome Browser
Species Human (GRCh38)
Location 3:50537479-50537501
Sequence TGAGTTCTGCCTCCTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954444124_954444129 15 Left 954444124 3:50537479-50537501 CCTCCTGGAGGAGGCAGAACTCA No data
Right 954444129 3:50537517-50537539 GCTGAGTACCTATTATGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954444124 Original CRISPR TGAGTTCTGCCTCCTCCAGG AGG (reversed) Intergenic
No off target data available for this crispr