ID: 954444719

View in Genome Browser
Species Human (GRCh38)
Location 3:50540527-50540549
Sequence AACCCTGATGTGTTAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954444710_954444719 29 Left 954444710 3:50540475-50540497 CCCAACACATGGTAGGCCTGCAG No data
Right 954444719 3:50540527-50540549 AACCCTGATGTGTTAGAAGCTGG No data
954444714_954444719 13 Left 954444714 3:50540491-50540513 CCTGCAGTGGGCAGTCGCAGATG No data
Right 954444719 3:50540527-50540549 AACCCTGATGTGTTAGAAGCTGG No data
954444711_954444719 28 Left 954444711 3:50540476-50540498 CCAACACATGGTAGGCCTGCAGT No data
Right 954444719 3:50540527-50540549 AACCCTGATGTGTTAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954444719 Original CRISPR AACCCTGATGTGTTAGAAGC TGG Intergenic
No off target data available for this crispr