ID: 954444810

View in Genome Browser
Species Human (GRCh38)
Location 3:50540908-50540930
Sequence CTGCGTCAGGGAGGGTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954444810_954444822 3 Left 954444810 3:50540908-50540930 CCACCCCACCCTCCCTGACGCAG No data
Right 954444822 3:50540934-50540956 CTGAGAGTATCAGCAGAGGTCGG No data
954444810_954444823 7 Left 954444810 3:50540908-50540930 CCACCCCACCCTCCCTGACGCAG No data
Right 954444823 3:50540938-50540960 GAGTATCAGCAGAGGTCGGCTGG No data
954444810_954444824 24 Left 954444810 3:50540908-50540930 CCACCCCACCCTCCCTGACGCAG No data
Right 954444824 3:50540955-50540977 GGCTGGCTCTGCCCTGTCTCAGG No data
954444810_954444821 -1 Left 954444810 3:50540908-50540930 CCACCCCACCCTCCCTGACGCAG No data
Right 954444821 3:50540930-50540952 GGGGCTGAGAGTATCAGCAGAGG No data
954444810_954444825 28 Left 954444810 3:50540908-50540930 CCACCCCACCCTCCCTGACGCAG No data
Right 954444825 3:50540959-50540981 GGCTCTGCCCTGTCTCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954444810 Original CRISPR CTGCGTCAGGGAGGGTGGGG TGG (reversed) Intergenic
No off target data available for this crispr