ID: 954445097

View in Genome Browser
Species Human (GRCh38)
Location 3:50542174-50542196
Sequence CCCTGGTGCTGAGCCCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954445082_954445097 27 Left 954445082 3:50542124-50542146 CCCAGCTCAGCTCAGCCCATGGG No data
Right 954445097 3:50542174-50542196 CCCTGGTGCTGAGCCCTGGGTGG No data
954445088_954445097 1 Left 954445088 3:50542150-50542172 CCAGTGCCAGAGCCTTTACCACC No data
Right 954445097 3:50542174-50542196 CCCTGGTGCTGAGCCCTGGGTGG No data
954445089_954445097 -5 Left 954445089 3:50542156-50542178 CCAGAGCCTTTACCACCACCCTG No data
Right 954445097 3:50542174-50542196 CCCTGGTGCTGAGCCCTGGGTGG No data
954445086_954445097 12 Left 954445086 3:50542139-50542161 CCCATGGGAGGCCAGTGCCAGAG No data
Right 954445097 3:50542174-50542196 CCCTGGTGCTGAGCCCTGGGTGG No data
954445087_954445097 11 Left 954445087 3:50542140-50542162 CCATGGGAGGCCAGTGCCAGAGC No data
Right 954445097 3:50542174-50542196 CCCTGGTGCTGAGCCCTGGGTGG No data
954445084_954445097 26 Left 954445084 3:50542125-50542147 CCAGCTCAGCTCAGCCCATGGGA No data
Right 954445097 3:50542174-50542196 CCCTGGTGCTGAGCCCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954445097 Original CRISPR CCCTGGTGCTGAGCCCTGGG TGG Intergenic
No off target data available for this crispr