ID: 954450958

View in Genome Browser
Species Human (GRCh38)
Location 3:50571524-50571546
Sequence GGGATAGACACCTGGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954450958 Original CRISPR GGGATAGACACCTGGAAGCC TGG Intronic
900677230 1:3895257-3895279 GGAATAGAGATTTGGAAGCCAGG - Intronic
901069904 1:6511881-6511903 GGGAGAGGCCCTTGGAAGCCGGG + Intronic
902260493 1:15221441-15221463 GGGACAGACACCCAGAGGCCTGG + Intergenic
902288477 1:15421736-15421758 GGGAGAGACACGTGGGACCCAGG + Intronic
904255402 1:29251483-29251505 GGGACAGTCAGCTGGGAGCCAGG + Intronic
904603790 1:31687996-31688018 GGGATTGAGCCCAGGAAGCCTGG - Intronic
904676864 1:32204136-32204158 GGGAAAGAGTCCTGGAACCCTGG - Intronic
905326086 1:37152903-37152925 GGGCTAGACACCTGGGTCCCTGG + Intergenic
905903098 1:41595196-41595218 AGGCTAGAAACCTGGAAGCAAGG - Intronic
907509102 1:54945366-54945388 GGGACAGAAACTAGGAAGCCTGG + Intergenic
908888389 1:68816099-68816121 GGGAGAAACACCAGGAAGCGTGG + Intergenic
909073050 1:71019405-71019427 GGGAGAGTCACGTGGAACCCAGG - Intronic
910427447 1:87131409-87131431 AGGATAAAGACCTGGGAGCCAGG - Intronic
913683251 1:121206945-121206967 GAAATAGACATATGGAAGCCAGG + Intronic
913718814 1:121569634-121569656 GTCATAGATACCAGGAAGCCAGG - Intergenic
914035093 1:143994570-143994592 GAAATAGACATATGGAAGCCAGG + Intergenic
914154360 1:145073401-145073423 GAAATAGACATATGGAAGCCAGG - Intronic
915004916 1:152626945-152626967 GGGACAGACACATGGATACCTGG - Intergenic
918037497 1:180889455-180889477 GGGATAGTGAGATGGAAGCCTGG - Exonic
920057418 1:203202616-203202638 GGGGTGGAGACCTGGAGGCCTGG - Intergenic
920470561 1:206225455-206225477 GAAATAGACATATGGAAGCCAGG + Intronic
921175298 1:212588113-212588135 GGGATAGACACCTGGCTGCAGGG - Intronic
921697816 1:218232191-218232213 AGAAGAGACACCTGGAAGCCTGG + Intergenic
1067790442 10:49283639-49283661 GGGAGACACAGCTGGAACCCAGG - Intergenic
1069855717 10:71439905-71439927 GGGATAGACACGGGGAGGACTGG - Intronic
1077161707 11:1116280-1116302 GGGATAGGCAAGTGGATGCCTGG + Intergenic
1079244736 11:18743911-18743933 AGGATGGCCACCTGGAAGGCAGG - Intronic
1081718478 11:45268292-45268314 GGGGTAGACAGCAAGAAGCCAGG + Intronic
1083737770 11:64691424-64691446 GGGCTGGGTACCTGGAAGCCAGG - Intronic
1084576001 11:69988319-69988341 GGGATTGAGACCTGGGAGGCTGG - Intergenic
1085152689 11:74264803-74264825 AGGATAGAGCCCTGGAAGCTGGG - Intronic
1087375130 11:97330122-97330144 GGGGCAAACACCTGTAAGCCAGG - Intergenic
1091221549 11:133932575-133932597 GAGACAGACACAGGGAAGCCAGG + Intronic
1091221585 11:133932803-133932825 GAGACAGACACAGGGAAGCCAGG + Intronic
1091513190 12:1151364-1151386 TGGAGAGAGATCTGGAAGCCAGG - Intronic
1091976500 12:4830203-4830225 GGGATGGACAGCTTGGAGCCTGG + Intronic
1094508600 12:31082437-31082459 GGGGGAGACAGCTGGAACCCTGG + Intronic
1095943835 12:47742525-47742547 GGGCTTGACAGCTGGAACCCAGG - Intronic
1096120831 12:49088627-49088649 GCAGTAGACACCTGGAATCCAGG - Intergenic
1097782385 12:63723173-63723195 AGGATGGTCACCTGGAAGCGAGG - Intergenic
1097852580 12:64427251-64427273 GCGATGGACACCTGTAATCCTGG - Intronic
1098030281 12:66246577-66246599 GGGACAGAGAATTGGAAGCCCGG + Intronic
1098202390 12:68069418-68069440 GGGAAAGACCCCTGGATGCAGGG - Intergenic
1098467341 12:70802700-70802722 GGCATAGACATCTGAAAACCTGG - Intronic
1099751102 12:86773323-86773345 AAGATAGCCACCTGTAAGCCAGG + Intronic
1100537632 12:95525930-95525952 GGGTTAGACACCTGGAAGAAAGG - Intronic
1101538376 12:105641517-105641539 GGGTTGGAAACCTGGAAGCAGGG + Intergenic
1103716602 12:122948908-122948930 GAGACAGACACTGGGAAGCCGGG + Intronic
1104003211 12:124873665-124873687 GGGAGTGTCACCTGGAACCCGGG - Intronic
1106110611 13:26773296-26773318 AAGACAGACACCTGCAAGCCAGG - Intergenic
1109601163 13:64630272-64630294 TGAAGAGACACCTGGAACCCAGG + Intergenic
1109825603 13:67716879-67716901 GAGACAGATACCTGGAGGCCAGG - Intergenic
1117620729 14:57583648-57583670 GGAATGAACACCTGGAAGACAGG - Intronic
1119037769 14:71245316-71245338 GGGATAGACGCGAGGAATCCGGG - Intergenic
1121252612 14:92511211-92511233 GGGCTAGGCCCATGGAAGCCAGG + Intergenic
1121833177 14:97069266-97069288 GGAATAGATTCCTGGGAGCCTGG + Intergenic
1124239146 15:28015588-28015610 GGGATGGTCACCTGTAAGCCAGG + Intronic
1126140155 15:45430644-45430666 GGGAGACTCACCTGGACGCCGGG - Exonic
1127854527 15:62943539-62943561 CAGACAGGCACCTGGAAGCCAGG - Intergenic
1128647519 15:69388195-69388217 GGGAGGAACCCCTGGAAGCCTGG - Intronic
1130333851 15:82942254-82942276 GGGCTAGACACCAGGAAGACAGG - Intronic
1135919268 16:26633917-26633939 GGGTTAGACACATGGCAGGCTGG + Intergenic
1137590554 16:49690819-49690841 GGGATGGAGACCTGGAAACAAGG + Intronic
1138297227 16:55897277-55897299 GGGAGAGCCAGCAGGAAGCCAGG + Intronic
1139510543 16:67425970-67425992 GGGCTGGGCACCTGGAAACCAGG - Intergenic
1141443119 16:84042130-84042152 GGGACAGACCCCAGGAAGCAGGG - Exonic
1142270704 16:89088050-89088072 GGGACAGACACCAGGAGGCAGGG + Intergenic
1143350734 17:6286283-6286305 GAGACAGACAGCAGGAAGCCAGG + Intergenic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1147269946 17:39262029-39262051 GGAAGAGACTCCTGGCAGCCAGG + Intronic
1148240353 17:45996274-45996296 GGGTTAGGCAGGTGGAAGCCAGG - Intronic
1151025752 17:70674410-70674432 GGGATAGGCAGCTGGAAGAGAGG + Intergenic
1151305990 17:73262958-73262980 GAGATAGACACCTGGAGCCGAGG + Intergenic
1152735856 17:81996447-81996469 GGGCAAGACCCCAGGAAGCCTGG + Exonic
1152781872 17:82230356-82230378 GGGGTGGGCACCTGGAGGCCTGG + Intronic
1153677826 18:7471091-7471113 GGGATAGACAAAGGGCAGCCAGG + Intergenic
1155497881 18:26460483-26460505 GGGATGGGCACCTGGAGGGCAGG + Intronic
1156401237 18:36742271-36742293 CGGCTAGCCACCTGGCAGCCTGG - Intronic
1156950847 18:42895908-42895930 GGGATAGAAACCAGGAAGATGGG + Intronic
1158166724 18:54548577-54548599 AGGATAGACAACTTGAAGCAGGG + Intergenic
1160434703 18:78838377-78838399 GGGATGGCCACCTGAAAGGCAGG + Intergenic
1160616492 18:80133923-80133945 TGGAAAGACACCTCGAACCCAGG - Intronic
1161099376 19:2413791-2413813 GGCATAGACCCCTGGACGCCGGG - Exonic
1162659273 19:12156561-12156583 GGCCAGGACACCTGGAAGCCGGG - Exonic
1163000547 19:14363923-14363945 GAGAGAGACACCAGGGAGCCTGG - Intergenic
1165730042 19:38139410-38139432 GGGAGAGACACCAGGCAGGCAGG + Intronic
1165988087 19:39787983-39788005 AAGAAAGCCACCTGGAAGCCTGG + Intergenic
1166919683 19:46220856-46220878 GGGAGAGACTCCTTGAGGCCAGG + Intergenic
1167076962 19:47256221-47256243 GGCACTGACGCCTGGAAGCCTGG - Intronic
1167414477 19:49362784-49362806 GGGCTAGGCGCCTGGAATCCCGG + Intronic
1167531205 19:50018062-50018084 GGGATTGAAATCTGGCAGCCTGG - Intronic
925284691 2:2708241-2708263 GGCAGGTACACCTGGAAGCCTGG + Intergenic
925494367 2:4429613-4429635 AGGATACACACCTGGAAGACCGG + Intergenic
925829997 2:7884453-7884475 GGAAGTGACATCTGGAAGCCAGG + Intergenic
925899864 2:8501142-8501164 GGTATAGACCCCTGGCAGCCAGG - Intergenic
932438024 2:71714433-71714455 GGGCTTGACACCTGGAGGCCAGG + Intergenic
932527862 2:72491351-72491373 GGTAAAGACAGCTGGAAGCCAGG - Intronic
933637558 2:84724285-84724307 GGCTCACACACCTGGAAGCCAGG + Intronic
934870666 2:97861874-97861896 AAGAAACACACCTGGAAGCCAGG + Intronic
936266767 2:111016874-111016896 AGGATGGACCCCTGGAAGCAGGG + Intronic
941013714 2:160330998-160331020 GGGAGAGATTCCTGCAAGCCAGG + Intronic
945820027 2:214652387-214652409 TTGATAGACACATGGGAGCCTGG - Intergenic
946504304 2:220282537-220282559 AGGAAAGGCACCTGGAAACCTGG - Intergenic
946818896 2:223610091-223610113 GTGATAGACACTTGAAAGGCTGG - Intergenic
1169093450 20:2875221-2875243 GGGATGGACATGGGGAAGCCGGG - Intronic
1169209527 20:3758464-3758486 GGGATAGGCACCCAGAAGCCAGG + Intronic
1171011161 20:21510210-21510232 CGGAGAGAGGCCTGGAAGCCCGG + Intergenic
1172303934 20:33868415-33868437 GGGAGACACAACTAGAAGCCTGG - Intergenic
1173476489 20:43363577-43363599 GGGCTGTACACCTGGGAGCCGGG - Intergenic
1179666136 21:42913803-42913825 GGGAGAGATAGCTTGAAGCCAGG - Intergenic
1180719870 22:17899931-17899953 AGGATAGACAACTTGACGCCTGG + Intronic
1181997451 22:26893943-26893965 GGGATAGCGTCCTGGAAGGCAGG - Intergenic
1183014149 22:34972199-34972221 GGGATAGAGAGATGGCAGCCTGG + Intergenic
1184121118 22:42451206-42451228 GGGTAAGACGCCTGGAACCCTGG - Intergenic
1184220519 22:43096977-43096999 GGGTTGGACCCCTGCAAGCCAGG + Intergenic
1184412602 22:44333511-44333533 GGGATGGACACCTGTGAGACAGG - Intergenic
949339199 3:3010187-3010209 GGGTTAGTCACCTGGATGCATGG + Intronic
949874638 3:8618284-8618306 GGGAGAAACACCTGGAGGCTTGG - Intergenic
950565663 3:13768278-13768300 GGGTTGGAAGCCTGGAAGCCTGG - Intergenic
950784638 3:15423909-15423931 ATAAAAGACACCTGGAAGCCAGG + Intronic
953030367 3:39175958-39175980 GGGAGAGACAGCTGGCACCCTGG - Intergenic
953815927 3:46156089-46156111 GGGATAGACACCTGGACCAATGG - Intergenic
954450958 3:50571524-50571546 GGGATAGACACCTGGAAGCCTGG + Intronic
957238690 3:77628988-77629010 GAGAGAGTCACATGGAAGCCAGG - Intronic
958664892 3:97124664-97124686 GGGATAGACACAAGGAAGAGTGG - Intronic
961653450 3:128428902-128428924 TGGAGAGACACCTGGCAACCTGG - Intergenic
962254081 3:133858507-133858529 GGGACAGCCATCTGTAAGCCAGG - Intronic
962307153 3:134299102-134299124 GGGGAAGACAGCTGGGAGCCTGG + Intergenic
965137652 3:164793191-164793213 GAGATAGACACCAAGAAGCAAGG - Intergenic
965876686 3:173331657-173331679 AAGATAGACACCTGCAAACCAGG - Intergenic
967188267 3:186963895-186963917 GGGATGGACACCTGGCACCAGGG - Exonic
975067431 4:70085525-70085547 GGGATAGATAGATGGAAGCAGGG - Intergenic
975532363 4:75413625-75413647 AGCATAGACACCAGGAGGCCAGG - Intergenic
975875025 4:78826333-78826355 GTGATGGACACCTGTAATCCTGG - Intronic
986299895 5:6470153-6470175 AGGATGGACCCCTGGAAGCCTGG + Intronic
986741847 5:10711634-10711656 GGGATAGACAGTTGGAGGGCAGG - Intronic
987537340 5:19206334-19206356 AGGATACACTCCTGGATGCCTGG - Intergenic
989959781 5:50398411-50398433 GCCATAGATACCAGGAAGCCAGG + Exonic
995050446 5:107697240-107697262 GGTATAGTCTCCTGGAAGCCTGG + Intergenic
1001077066 5:168637899-168637921 GTGATGGACAGCAGGAAGCCTGG - Intergenic
1001675295 5:173507287-173507309 GGGATGGCCAGGTGGAAGCCGGG + Intergenic
1001984531 5:176061850-176061872 GGAGCAGAGACCTGGAAGCCGGG + Exonic
1002232983 5:177782347-177782369 GGAGCAGAGACCTGGAAGCCGGG - Exonic
1002422176 5:179154451-179154473 GGGTTAGAAACCTGGAGGCAGGG - Intronic
1002587330 5:180257653-180257675 GCCATAGAATCCTGGAAGCCAGG + Intronic
1005764011 6:28992871-28992893 GGGCTAGACACATGGAGGACAGG - Intergenic
1006590135 6:35148886-35148908 AGGATAGTCACCTTGAAGGCAGG + Intergenic
1006748590 6:36362636-36362658 GGGATGGACCCCTGGGTGCCTGG - Intronic
1007595309 6:43047454-43047476 GGCACAGACACCTGGATGGCTGG + Intronic
1008176407 6:48272851-48272873 TGGATAGACTCAGGGAAGCCAGG - Intergenic
1009616861 6:66020356-66020378 GTGATAGTCACTTGCAAGCCTGG - Intergenic
1017822807 6:158061254-158061276 GGGTGAGAGGCCTGGAAGCCGGG + Intronic
1019492677 7:1322544-1322566 GGGAGGGACACCTGGACACCAGG - Intergenic
1021456953 7:20839903-20839925 AGGATAGACACATGTAAGCTAGG - Intergenic
1025263608 7:57438704-57438726 TGGATAGGCAGCTGGCAGCCTGG - Intergenic
1025611171 7:63076866-63076888 GGGGAAGCCACATGGAAGCCAGG - Intergenic
1026894831 7:74003926-74003948 GGGATAGACAGCTGGACACTTGG - Intergenic
1028506880 7:91580550-91580572 GGACTTGAAACCTGGAAGCCTGG + Intergenic
1030460312 7:109826546-109826568 CAGAGAGACACCTGGAAGCCAGG + Intergenic
1030699516 7:112622608-112622630 GGGATGGCCACCTGGGAGCTGGG - Intergenic
1034752972 7:153588052-153588074 TGGATAGACACCTGAATGACAGG + Intergenic
1036492675 8:9242463-9242485 GGGAGAAACACCTGGAAGTCTGG - Intergenic
1037413060 8:18618218-18618240 GGGCAGGACACCTGGAAGCAGGG - Intronic
1039136762 8:34333448-34333470 GTGATGGACACCTGTAATCCTGG - Intergenic
1039525704 8:38214203-38214225 GAGAGAGAAACCTGGAAACCTGG - Intergenic
1041219717 8:55637111-55637133 GGGATGGACACATGGAAGATGGG + Intergenic
1043745556 8:83869624-83869646 GGGCTTGAAGCCTGGAAGCCTGG + Intergenic
1046822716 8:118651619-118651641 GGGATAGACACCTTCAAAGCTGG + Intergenic
1048034669 8:130666160-130666182 AGGACAGACACCTGGAGGCGGGG - Intergenic
1048403453 8:134094697-134094719 GGGGCAGACACCTGGCTGCCTGG - Intergenic
1048489446 8:134879201-134879223 GGGAGAGACAACTGTAAGCGAGG - Intergenic
1048507454 8:135034091-135034113 GGGATGGTCCCCTGGAAGCCAGG + Intergenic
1051333092 9:16043022-16043044 GGGCAAGCCACCTGGAAGCCTGG - Intronic
1051710607 9:19927132-19927154 GGCAGAGAGTCCTGGAAGCCTGG + Intergenic
1057985036 9:99704493-99704515 GTGATAGAATCCTAGAAGCCAGG + Intergenic
1058138436 9:101333644-101333666 GTGATACACACCTGTAATCCCGG + Intergenic
1058594913 9:106605237-106605259 GTGACAGACACCTGGAAAACTGG + Intergenic
1060396750 9:123321645-123321667 GGGCTAGACATCCGGAAGTCAGG + Intergenic
1062409331 9:136414636-136414658 GGGATCCACACCTGTTAGCCGGG - Exonic
1062439430 9:136563151-136563173 GGGAAGGAGACCTGGAGGCCGGG - Intergenic
1186795948 X:13046127-13046149 GGGATAGAAAGCTGTAAGACTGG - Intergenic
1194813074 X:98410087-98410109 GGGAGAAACACATGAAAGCCTGG + Intergenic
1195262307 X:103144566-103144588 ATGGTAGACACCTGTAAGCCAGG + Intergenic
1197828044 X:130611954-130611976 GAGAAAAACAGCTGGAAGCCAGG - Intergenic
1200252319 X:154560130-154560152 GGCAAGGAGACCTGGAAGCCAGG - Intronic
1200265449 X:154644286-154644308 GGCAAGGAGACCTGGAAGCCAGG + Intergenic