ID: 954452745

View in Genome Browser
Species Human (GRCh38)
Location 3:50580452-50580474
Sequence CAGCCTGACCAGAGGGGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 405}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954452735_954452745 17 Left 954452735 3:50580412-50580434 CCATAGCATGGCTGCCCTGTGGA 0: 1
1: 0
2: 0
3: 13
4: 159
Right 954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG 0: 1
1: 0
2: 4
3: 48
4: 405
954452732_954452745 30 Left 954452732 3:50580399-50580421 CCGGAGGTCTGGGCCATAGCATG 0: 1
1: 0
2: 2
3: 7
4: 124
Right 954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG 0: 1
1: 0
2: 4
3: 48
4: 405
954452738_954452745 -8 Left 954452738 3:50580437-50580459 CCTTGTCAGTGCCGCCAGCCTGA 0: 1
1: 0
2: 1
3: 22
4: 167
Right 954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG 0: 1
1: 0
2: 4
3: 48
4: 405
954452737_954452745 2 Left 954452737 3:50580427-50580449 CCTGTGGATGCCTTGTCAGTGCC 0: 1
1: 0
2: 2
3: 12
4: 114
Right 954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG 0: 1
1: 0
2: 4
3: 48
4: 405
954452736_954452745 3 Left 954452736 3:50580426-50580448 CCCTGTGGATGCCTTGTCAGTGC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG 0: 1
1: 0
2: 4
3: 48
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954452745 Original CRISPR CAGCCTGACCAGAGGGGAGG TGG Exonic
900018698 1:171917-171939 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900048956 1:530512-530534 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900071187 1:772336-772358 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900226263 1:1534924-1534946 CAGCTTGGGCGGAGGGGAGGGGG - Intergenic
900406683 1:2495919-2495941 CAGCCTGACTGGACGGGAAGAGG - Intronic
900587592 1:3440552-3440574 CTGCCAGACCACATGGGAGGGGG + Intergenic
900613556 1:3554367-3554389 CAGCCGGGCCAGGCGGGAGGGGG + Intronic
900685964 1:3947783-3947805 CAGCCGGCGCAGATGGGAGGGGG - Intergenic
900847395 1:5114877-5114899 AAGCCGGACCAGGGGTGAGGAGG - Intergenic
900945407 1:5828549-5828571 CTTCCTGACCTGCGGGGAGGAGG + Intergenic
901070274 1:6513474-6513496 CAGCCTGAGGTGAGGGGAAGAGG + Intronic
901674116 1:10872960-10872982 CAGCCTGAGGGGAGGGGACGGGG - Intergenic
902137225 1:14319634-14319656 CAGGCTGTCGAGAAGGGAGGAGG - Intergenic
902367083 1:15983037-15983059 CAGCCTGGTCAGATGGAAGGAGG - Intergenic
902504551 1:16930619-16930641 CAGCCTGACCCAAGAGGAAGGGG + Intronic
902834223 1:19036319-19036341 GAGCCTGAGCAGGGAGGAGGAGG + Intergenic
902840649 1:19071892-19071914 CCGCCTTACCAATGGGGAGGCGG - Intergenic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
905184700 1:36188012-36188034 GAGCCTGAAGAGAGCGGAGGTGG + Intergenic
905227245 1:36487251-36487273 CAGCCTGAGCAAAGGCCAGGAGG - Intergenic
905552579 1:38855191-38855213 CAGTCAGTCCAGGGGGGAGGTGG + Intronic
905916572 1:41688740-41688762 CAGAATGATCAGAGGAGAGGTGG - Intronic
906118147 1:43368862-43368884 CAGCCTGACCAAAGAAGATGTGG + Intergenic
906237636 1:44221474-44221496 CTCCCTCACCAGAGGGGAAGAGG - Exonic
907029615 1:51157874-51157896 CTGCCAGACCAGAGGGGCTGGGG - Intergenic
907406985 1:54259671-54259693 CCGCCTGCCCACTGGGGAGGAGG + Intronic
908229597 1:62090687-62090709 CAACAAGACCAGAGGGGTGGAGG - Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
911040922 1:93590033-93590055 AGGCCTGGCCAGTGGGGAGGAGG + Intronic
911642448 1:100303556-100303578 CAGGTTGACCACAGTGGAGGAGG + Intergenic
913380882 1:118208890-118208912 CAGCCTGCCCAGAGCGCATGTGG - Intergenic
914330716 1:146668090-146668112 CAGCCTGTCCAGATGGGAGTTGG + Intergenic
915493905 1:156267566-156267588 CAGCCTGGCCAGTGAGGATGAGG - Exonic
915953646 1:160205975-160205997 AAGCTTGTCCAGAGGGAAGGAGG + Intronic
917978701 1:180256226-180256248 CAACGTGACCAGATGGGCGGAGG - Intronic
919225880 1:194700692-194700714 CTGCCTGACCAGAGAAGATGAGG - Intergenic
919976525 1:202616373-202616395 CAGCCTCAGCTGAGGGAAGGGGG - Intronic
920398219 1:205661483-205661505 CAGCCTCAGCAGACGGGAGTGGG - Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921298009 1:213722738-213722760 CTGCCTGCCCAGAGGAGAGTGGG + Intergenic
922102610 1:222488146-222488168 CACCCTGTCCAGGAGGGAGGTGG + Intergenic
922106548 1:222517785-222517807 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
922616732 1:226965223-226965245 GGCCCTGCCCAGAGGGGAGGAGG - Exonic
924348732 1:243095351-243095373 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1062863501 10:829150-829172 CTGCATGACAAGAGGGGAGACGG + Intronic
1062955880 10:1540349-1540371 CAGCCAGACCAGGAGGGCGGGGG - Intronic
1063003516 10:1946531-1946553 CAGCCTAACCCGAAGGGAGCTGG + Intergenic
1063969801 10:11373727-11373749 CACCCTGGCAGGAGGGGAGGCGG - Intergenic
1066727628 10:38409552-38409574 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1068360714 10:55972948-55972970 CAGCCAGACCAGGTGTGAGGAGG - Intergenic
1069900448 10:71703802-71703824 CCCCCAGACCGGAGGGGAGGCGG + Intronic
1069983856 10:72270783-72270805 CACCTTGGCCTGAGGGGAGGAGG + Intergenic
1070966495 10:80534244-80534266 CGCCCTGTCCAGAAGGGAGGTGG + Intergenic
1071671625 10:87614349-87614371 CTGCCTGGCCAGAGCAGAGGTGG - Intergenic
1072570629 10:96654793-96654815 CAGCCTGACCAGAGGGGCATGGG + Intronic
1072615416 10:97046365-97046387 CAGCCTGACCAGAGGGCAATGGG + Intronic
1073773531 10:106761440-106761462 CATCCTGCCCTGAGGGGATGTGG + Intronic
1074377359 10:112951188-112951210 CCGCCTTCCCAGAGGGGTGGAGG - Exonic
1076484101 10:130804824-130804846 CCACCTACCCAGAGGGGAGGAGG - Intergenic
1076636728 10:131885950-131885972 CAGCCTGGCCAGGAGGGTGGTGG + Intergenic
1076888192 10:133272084-133272106 AAACCTGGCCTGAGGGGAGGTGG + Intronic
1076975300 11:167113-167135 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1077366242 11:2162446-2162468 CAGCCTGACCCATGGTGAGGGGG + Intergenic
1077757356 11:5047023-5047045 GAGCCTGACAAAAGGGTAGGCGG - Exonic
1077897620 11:6465487-6465509 CACCCTCCCCACAGGGGAGGAGG + Intronic
1078552057 11:12287921-12287943 CAGCCTCACCCTAGGAGAGGAGG + Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1083341664 11:61962252-61962274 CAGCCTGAACAAAGAGGAGATGG + Exonic
1083431117 11:62613900-62613922 GAGCCTGTCCAGGGAGGAGGAGG - Intronic
1083624872 11:64067298-64067320 GAGGCTGAGCAGTGGGGAGGAGG - Intronic
1083700872 11:64476985-64477007 CAGCCTCAGCAGAGGGGGGTAGG - Intergenic
1084047070 11:66575241-66575263 CAGCCTGGGGAGCGGGGAGGAGG - Intergenic
1084415767 11:69032192-69032214 TTTCCTGACCATAGGGGAGGGGG + Intergenic
1084435121 11:69135031-69135053 CAGGCTGGACAGAGAGGAGGAGG - Intergenic
1084770145 11:71337420-71337442 CAGCCTGCACAGAGGGGAAAAGG + Intergenic
1086855485 11:91860520-91860542 CAACCTGAGGAGAGGGGAGGGGG - Intergenic
1087635090 11:100693256-100693278 CAGCCTAATCAGAGGTGTGGAGG + Intronic
1088890765 11:114042419-114042441 CAGTCTGTCCAGAGCTGAGGAGG + Intergenic
1089269048 11:117288795-117288817 CAGCCTGACCAAAAGTGAGATGG - Exonic
1089678722 11:120107753-120107775 ATGCCTGTCCAGAGGGGCGGGGG - Intergenic
1090772763 11:129936020-129936042 CAGCCTGACCTCATGGAAGGAGG + Intronic
1090886490 11:130881444-130881466 CAGCCTTGCCAGAGGAGAGTTGG - Intronic
1091792344 12:3279069-3279091 AAGCCTTACCAGATGGGAGGGGG + Intronic
1092111285 12:5966594-5966616 CACAGTGGCCAGAGGGGAGGGGG - Intronic
1092285676 12:7128131-7128153 CAGCCAGAGCAGCGGGGAGGAGG - Intronic
1093027224 12:14255953-14255975 AAGCTTGACCAGAGGGTAGGAGG + Intergenic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1096186655 12:49586010-49586032 CAGCCTGACACGCAGGGAGGTGG + Intronic
1096785790 12:54016609-54016631 CAGCCTGGCCCGTGGGGAGTGGG + Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1097173269 12:57128918-57128940 TAGCAGGACCAGAGGGGAAGGGG + Exonic
1099303608 12:80927863-80927885 CAGCCAGGCCTGTGGGGAGGTGG - Intronic
1100995123 12:100294580-100294602 CACCCTGTCCAGGAGGGAGGTGG - Intronic
1101230494 12:102736477-102736499 CAGCCTCACCAATGGGGAGGGGG - Intergenic
1101777128 12:107805758-107805780 CAGCCTGGCCAGAGCTGGGGAGG + Intergenic
1101995899 12:109524642-109524664 CCTCCTGGCAAGAGGGGAGGAGG - Intronic
1102042617 12:109810382-109810404 CAGCAGGGCCAGAGGGGAAGGGG + Intronic
1102589482 12:113946583-113946605 AACCCTGACCAGAGGGTGGGAGG + Intronic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1104391897 12:128397851-128397873 GAGGCTGAGCAGAGGGGAGGTGG - Intronic
1105945720 13:25187840-25187862 CAGCCTGCCCTGCGGGGAAGTGG + Intergenic
1106096546 13:26650217-26650239 CTGCCTAACCTGAGGGGAAGCGG + Intronic
1106301351 13:28469069-28469091 CTGCCTGGGAAGAGGGGAGGAGG - Intronic
1107040821 13:35945410-35945432 CAGCCTGGCCAGCAGGGAGAAGG + Intronic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1108306989 13:49147264-49147286 CAGCCTGACCAGGGAGCACGAGG + Intronic
1108803944 13:54131670-54131692 AAGCCTGACCAGGTGTGAGGAGG + Intergenic
1110433254 13:75450735-75450757 CAGCCTGACCTTTGGGGAGGTGG - Intronic
1112290781 13:98143009-98143031 CAGCCCGAGCAGCGGGGACGCGG - Intronic
1112466196 13:99646974-99646996 CAGCCTCTCCAGAGGGGAAGGGG - Intronic
1112565347 13:100547291-100547313 CACCCAGACCAGAGGGGGTGGGG + Intronic
1113124125 13:106957709-106957731 GAGACTGAACAGAGTGGAGGAGG + Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114455066 14:22848794-22848816 CACCCTTACCGGAGGGGATGGGG + Intronic
1114664312 14:24369065-24369087 AACCGTGGCCAGAGGGGAGGGGG - Intronic
1114715016 14:24815879-24815901 CAGGCTCACCAGAGTGGAGGTGG + Intronic
1115447281 14:33505816-33505838 CAGCCTGGGAAGAGGGGAGATGG - Intronic
1115679894 14:35726076-35726098 CAAAATAACCAGAGGGGAGGAGG - Intronic
1116152100 14:41154375-41154397 GAGCCTGTCCCGCGGGGAGGCGG + Intergenic
1117735045 14:58760371-58760393 CAGCCTGAATAGAATGGAGGAGG - Intergenic
1118617059 14:67581116-67581138 CAGCCTATCCAGACGGGGGGAGG + Intronic
1119228158 14:72959919-72959941 CAGCCCAACCAGAAGGGAGCCGG - Intergenic
1121180480 14:91925290-91925312 GAGCCGGGCCAGAGGGGAGATGG - Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1122503099 14:102214174-102214196 CACCCAGACCAGACCGGAGGAGG - Intronic
1122744080 14:103887783-103887805 CAGCCCGAGCTGAGGGGAGAGGG - Intergenic
1123705707 15:22949441-22949463 CAGGCTGACAGGAAGGGAGGTGG + Intronic
1123781680 15:23634443-23634465 CACCCTGTTCAGAGGGGAAGAGG - Intergenic
1124492171 15:30164723-30164745 CAGCCTCAGCCGAGGGAAGGGGG - Intergenic
1124751365 15:32373594-32373616 CAGCCTCAGCCGAGGGAAGGGGG + Intergenic
1126134301 15:45376234-45376256 GATCCGGACCAGAGAGGAGGTGG + Intronic
1126698074 15:51342123-51342145 CAGCCTGGCCAGGGGAGAAGAGG - Intronic
1126777350 15:52111750-52111772 CAGCCTGGCCAGAGAGGTTGTGG - Intronic
1127568300 15:60215094-60215116 CAAGCTGACCACATGGGAGGGGG - Intergenic
1128156391 15:65394447-65394469 CAGCCTGAGCAATGGGCAGGTGG - Exonic
1128354918 15:66919354-66919376 CAGCCTGAGCAGGGGCAAGGAGG + Intergenic
1128457996 15:67843716-67843738 CAGCCCCACCGGAGGGAAGGAGG + Intergenic
1128679546 15:69638039-69638061 CAGCATGACAAGAGGAGAGAGGG - Intergenic
1128776629 15:70325250-70325272 CAGCCTGACTGGAGAGGAGGTGG - Intergenic
1128799556 15:70489051-70489073 CAGCCAGGCCAGAGGGGTGCAGG + Intergenic
1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG + Intronic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1129361915 15:75029623-75029645 CAGCCAGGCCAGAGTGGGGGAGG + Intronic
1129637890 15:77341613-77341635 CAGCCTGACCTGGTGGGAGTAGG - Intronic
1129786722 15:78314590-78314612 CAGCAAGACCTGCGGGGAGGTGG + Intergenic
1130272839 15:82461290-82461312 AAGCCTGACCTGAGGAGAGACGG - Intergenic
1130465189 15:84188643-84188665 AAGCCTGACCTGAGGAGAGACGG - Intergenic
1130487499 15:84406159-84406181 AAGCCTGACCTGAGGAGAGACGG + Intergenic
1130499076 15:84484893-84484915 AAGCCTGACCTGAGGAGAGACGG + Intergenic
1130587480 15:85193256-85193278 AAGCCTGACCTGAGGAGAGACGG - Intergenic
1131008618 15:88999116-88999138 CAGCCTCACCACATGGGAGAGGG + Intergenic
1132107273 15:99072043-99072065 AACCCTGTCCAGAGGGGAGTTGG - Intergenic
1132389422 15:101427620-101427642 CAGCAGGACCAGAGGAGAGAGGG + Intronic
1132635045 16:940036-940058 GAGACAGACCAAAGGGGAGGAGG + Intronic
1132672728 16:1108317-1108339 CAGAGTGGCCAGTGGGGAGGTGG + Intergenic
1132743913 16:1428889-1428911 CAGCTGGATCAGAGGGGAGCTGG + Intergenic
1132846232 16:2002084-2002106 CAGCCTGGCCGGAGGGTGGGAGG + Intronic
1133060425 16:3171191-3171213 AAGCCCAACCAGAGGGGAGGAGG + Intergenic
1133220430 16:4317112-4317134 CAGCCTGGCCAGAGGGTGGCCGG + Intronic
1134690112 16:16185462-16185484 CAGCCTTCCCAGAGTGAAGGGGG + Intronic
1135421792 16:22309713-22309735 CTGCCTGACCAGATGGGGTGGGG + Intronic
1136064011 16:27746746-27746768 CAGCCTGTCCAGGGAGCAGGAGG + Intronic
1136068930 16:27776608-27776630 GGGCCTGACCTGAGGGGACGTGG + Intronic
1136297900 16:29314094-29314116 CAGCCTGGACAGAGAGGAGCGGG + Intergenic
1137223695 16:46481802-46481824 CAGCCTGACCAGGAGAGAGCAGG + Intergenic
1137632961 16:49960356-49960378 CAGCCTTTCCAGAGCGGAGTGGG + Intergenic
1137935369 16:52630153-52630175 GAGAGTGAACAGAGGGGAGGAGG + Intergenic
1138351264 16:56347480-56347502 CACCCTGCCCAGAGAGGAGCTGG + Exonic
1138573409 16:57890831-57890853 CAGCTTGACCAGAGAGGCAGGGG - Intronic
1138804882 16:60080592-60080614 AAGCCTGACCAGGTGTGAGGAGG - Intergenic
1139410002 16:66751501-66751523 CGACCTGACCAGTGAGGAGGAGG - Exonic
1139574327 16:67831697-67831719 CAGCCTCTCCAGAGGACAGGAGG + Intronic
1139678922 16:68544759-68544781 CAGCCTGAGCTGACAGGAGGTGG + Intronic
1140002836 16:71042813-71042835 CAGCCTGTCCAGATGGGAGTTGG - Intronic
1140125061 16:72111861-72111883 CAGCCTCACCTCTGGGGAGGAGG - Intronic
1140408277 16:74725343-74725365 CAGACAGACCACAGGGCAGGTGG + Intronic
1141685792 16:85569185-85569207 CAGCCTGGCCAAAGGTGTGGAGG - Intergenic
1141691034 16:85596233-85596255 CCGCCTAACGTGAGGGGAGGGGG + Intergenic
1142059544 16:88020599-88020621 CAGCCTGGACAGAGAGGAGTGGG + Intronic
1142444960 16:90130546-90130568 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1142462550 17:104920-104942 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1142480505 17:215713-215735 CAGCCTGGCCAGTGGTGAGACGG - Exonic
1142756184 17:2017854-2017876 GAGCCTCACCACAGCGGAGGAGG + Intronic
1142995445 17:3757346-3757368 CAGCATGTGCAGAGGTGAGGAGG - Intronic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143039746 17:4025085-4025107 CAGCTGGTCCAGAAGGGAGGAGG - Exonic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1145208004 17:20994882-20994904 CAGCCTCAGCCCAGGGGAGGAGG - Intergenic
1145263818 17:21369882-21369904 CAGCCTGACCACAAGGGTAGGGG + Intergenic
1146728631 17:35175400-35175422 CAGCCAGACTGGAGGGGAGGTGG + Intronic
1147757721 17:42779918-42779940 CACCCAGACCAGATGGGTGGAGG - Intergenic
1147923221 17:43931406-43931428 AAGCCTCACCAGAGGGTATGCGG - Intergenic
1148340501 17:46870654-46870676 AAGCCTCACCAGAGGGTATGCGG - Intronic
1148663928 17:49361340-49361362 GAGCCTGATTGGAGGGGAGGAGG + Intronic
1148669771 17:49402037-49402059 CAGCCCGACCAAAGGGGAGAGGG + Intronic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1149467033 17:56888169-56888191 CAGCCTGACCTATGGGGCGGGGG - Exonic
1150477546 17:65486457-65486479 ATGCCTGGCCAGTGGGGAGGAGG - Intergenic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151886144 17:76924336-76924358 CAGCTTGGCCAGAGGAGGGGTGG - Intronic
1152260927 17:79266697-79266719 CAACCTCAGGAGAGGGGAGGGGG + Intronic
1155054025 18:22169806-22169828 CAGCCCGCCCGGAGGGAAGGAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155650996 18:28141640-28141662 CAGAATGACAAGAGGGGAAGGGG - Intronic
1156451608 18:37269591-37269613 CTGCCTGGCAAGAGTGGAGGTGG - Intronic
1157586728 18:48805817-48805839 CAACCTGTCCAAAGGGTAGGGGG - Intronic
1157824072 18:50796645-50796667 CAGACTGAGCAAAGGTGAGGGGG + Intronic
1159001622 18:62980100-62980122 CAGGCTCCTCAGAGGGGAGGGGG - Exonic
1160038450 18:75322104-75322126 CAGCTGAGCCAGAGGGGAGGAGG + Intergenic
1160396425 18:78575694-78575716 CAGCTGGGCTAGAGGGGAGGGGG - Intergenic
1160652257 19:237296-237318 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1160872736 19:1284543-1284565 CAGCCTGAACAAAGGTCAGGTGG + Intergenic
1160967209 19:1752028-1752050 CAGCCTGCCCAGCTGGGAGCCGG - Intergenic
1161012616 19:1967854-1967876 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161012637 19:1967915-1967937 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161324990 19:3659243-3659265 CAGCCTGGACAGAGGCTAGGGGG + Intronic
1161634389 19:5378028-5378050 CAGCTGAGCCAGAGGGGAGGTGG - Intergenic
1162372072 19:10285560-10285582 TAGCCTGATGAGAGGGGAAGTGG + Exonic
1162921677 19:13906620-13906642 GAGCCTCACCTGGGGGGAGGCGG - Intronic
1163613996 19:18315959-18315981 CAGCCTCAGCACAGGGGCGGTGG - Intronic
1163753747 19:19094189-19094211 CAGCCACACCTGAGGGCAGGAGG + Intronic
1163848625 19:19651234-19651256 CAGCCTGACCAGACCCCAGGCGG - Intronic
1163909979 19:20180718-20180740 CAGCCTGACCACAGTGGCTGGGG - Intronic
1164513607 19:28916315-28916337 TAGCCTGATCAGAGGCAAGGGGG - Intergenic
1164536348 19:29088838-29088860 CAGCCTGAGCTGGGGTGAGGGGG - Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165829082 19:38721732-38721754 CAGCCTGCCCAGACTGGTGGCGG + Intronic
1165993397 19:39828289-39828311 CAGCTTGGCCAGAGGGTAGGGGG - Exonic
1166130498 19:40742981-40743003 TGGCCTGAGCACAGGGGAGGTGG + Intronic
1166130963 19:40745245-40745267 CAGCCAGACCTCAGGGTAGGGGG - Intronic
1166364384 19:42271053-42271075 CAGGCTGCCCAGAGGGGCAGAGG + Intronic
1166748954 19:45155679-45155701 CAGGCTGGCCACAGGGGTGGGGG + Intronic
1166759969 19:45218168-45218190 CTGCCTGAGGGGAGGGGAGGTGG - Intronic
925448605 2:3950114-3950136 CAGCGGCACCAGAGGTGAGGGGG + Intergenic
926055887 2:9773728-9773750 AAGTCTGAAGAGAGGGGAGGCGG - Intergenic
926162950 2:10501258-10501280 CATCCGGGCCAGTGGGGAGGTGG + Intergenic
926619982 2:15038809-15038831 CTGCCTGGCCAGAGAGGAAGTGG + Intergenic
926681657 2:15668699-15668721 CAGCCTCCCCAGAGGAGGGGAGG - Intergenic
926826096 2:16906303-16906325 CAGAATCACCAAAGGGGAGGTGG - Intergenic
926865962 2:17358460-17358482 CAGCCTCACCAGAGGAAATGCGG - Intergenic
927096507 2:19751327-19751349 CAGCATGAGCAAAGGCGAGGTGG + Intergenic
927674121 2:25091876-25091898 CAGCCTGACAGGTGGAGAGGCGG - Intronic
927805995 2:26147260-26147282 CAACCTACCCAGAGGGGAGCAGG + Intergenic
928063265 2:28136403-28136425 CAGCCTGGCCAGAGGGGCTGTGG - Intronic
929684602 2:44023018-44023040 AAGCCAGACCAGATGTGAGGAGG + Intergenic
929949421 2:46395045-46395067 CAGGATGACCAGAGGGGAACTGG + Intergenic
930055267 2:47247090-47247112 CGGCCTGACCACTGGTGAGGGGG + Intergenic
931236874 2:60419383-60419405 AAGCCTGACCAGGTGTGAGGAGG - Intergenic
932038842 2:68277129-68277151 CTGCCTGTTCAAAGGGGAGGAGG - Intergenic
932982289 2:76684411-76684433 CAGTCTGTCCAGACAGGAGGAGG + Intergenic
933299991 2:80530646-80530668 GAGCCTGACCACGTGGGAGGAGG + Intronic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
933979464 2:87538555-87538577 AATCCTGAGCAGAGGGCAGGGGG - Intergenic
934477422 2:94602719-94602741 CAGCCTGGCCACCGGGCAGGAGG + Intronic
935504132 2:103878690-103878712 CAGCGAGACCAGAGCTGAGGTGG + Intergenic
936084353 2:109456293-109456315 CAGCCTGACAATAGGGGAACAGG - Intronic
936314359 2:111412236-111412258 AATCCTGAGCAGAGGGCAGGGGG + Intergenic
936548198 2:113411213-113411235 CAGCCTGCCCAGGGCAGAGGAGG - Intergenic
937263025 2:120598429-120598451 CTGCCTGTCCAGATGGGAGTGGG - Intergenic
937854997 2:126665945-126665967 CAGCCTGCCCTGCTGGGAGGGGG + Intronic
938259633 2:129885985-129886007 CAGCCAGGCCAGAGGGTATGAGG - Intergenic
939167445 2:138654530-138654552 CATCCAGGCCAGAGGGGATGTGG + Intergenic
941696118 2:168552667-168552689 CAGGCTGGCAAGAGTGGAGGAGG + Intronic
942528262 2:176879669-176879691 CAGCCTGAAGCGAGGGGAGAAGG - Intergenic
942610629 2:177738693-177738715 CAGCCTCACCAGAGAGAGGGAGG + Intronic
942617488 2:177809097-177809119 CAGGCTGAAGAGAGGGGAGTGGG + Intronic
943180560 2:184535431-184535453 AAGCCTCACCAGATGGGGGGTGG + Intergenic
945825117 2:214712152-214712174 CAGCCAGTCCAGATGGGAGTGGG + Intergenic
946236484 2:218327425-218327447 CAGCCTGGCAGGAGGGGAGCAGG + Intronic
946386748 2:219388191-219388213 CAGCCTGGCGAGAGGCGGGGCGG - Intronic
946438112 2:219672589-219672611 CAACATGACCCCAGGGGAGGAGG + Intergenic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947746198 2:232508487-232508509 CAGCCTGGCAGGTGGGGAGGAGG + Intergenic
947771747 2:232675749-232675771 CAACCAGACTAGAGAGGAGGAGG + Intronic
948677844 2:239609558-239609580 CTGCCTAAGAAGAGGGGAGGTGG - Intergenic
948734644 2:239993878-239993900 AAGCCTGAACAGACGGCAGGAGG + Intronic
1168932598 20:1636119-1636141 CAGCCTGGGGAGAGGGGAGTGGG + Intronic
1169143253 20:3237826-3237848 CAGGCGGGCCAGAGGCGAGGAGG + Intronic
1170763901 20:19274257-19274279 CAGCCTGTCCAGTGGGCAAGGGG - Intronic
1171986597 20:31665360-31665382 TAGCCAGTCCAGAGGTGAGGAGG + Exonic
1172307279 20:33889545-33889567 CAGCCTGAGGAGAAGGCAGGTGG - Intergenic
1172589265 20:36105941-36105963 CAGCCTGCCCCCTGGGGAGGAGG - Intronic
1172934163 20:38607659-38607681 ACGCCTGACAGGAGGGGAGGTGG - Intronic
1173335907 20:42112354-42112376 CAGCCACACCCCAGGGGAGGGGG - Intronic
1173349876 20:42234860-42234882 CACACTGAGCAGAGGGGATGGGG + Intronic
1173649918 20:44656655-44656677 AAGCATTGCCAGAGGGGAGGGGG - Intergenic
1175552192 20:59824766-59824788 CAGCCCCACCAGTGGGGGGGCGG + Intronic
1176040120 20:63060806-63060828 CAGCCCCACCAGATGGGTGGGGG + Intergenic
1178363649 21:31970308-31970330 CACCGTGCCCAGAGAGGAGGTGG + Intronic
1178479870 21:32970716-32970738 CACCCTGACCAAACGGGAGTGGG + Intergenic
1178782988 21:35623870-35623892 CAGGATGACCACAGTGGAGGGGG - Intronic
1179455715 21:41498473-41498495 CAGCCTGACCAGAAAGAAGAAGG + Intronic
1179646095 21:42777254-42777276 CAGGCTGACCAGGGTGGACGTGG - Intergenic
1179654192 21:42834966-42834988 CATCCTGATCAGAGGCGAGAGGG - Intergenic
1179877782 21:44279947-44279969 CAGCATGACCAGACTGGAGAGGG + Intergenic
1180158491 21:45988937-45988959 CAGGCTGACCAGATGTGATGGGG + Intronic
1180202695 21:46235244-46235266 CAGCCTGACCTGTGGGGAGGGGG - Exonic
1180230187 21:46422334-46422356 CTCCCTGCCCAGATGGGAGGCGG - Intronic
1180635968 22:17263258-17263280 CAGACAGAGCAGTGGGGAGGTGG + Intergenic
1181061607 22:20284560-20284582 GGGGCTGCCCAGAGGGGAGGTGG - Intergenic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1182091018 22:27594954-27594976 CAGCTTGACCAGTGGGGCCGTGG - Intergenic
1183315058 22:37132465-37132487 CAGCCTGGACAGAGGAGAGGAGG + Exonic
1183327605 22:37202937-37202959 CAGCATTATCAGAGGGGAGCTGG - Intergenic
1184837153 22:47030862-47030884 CACCGTGCCCAGACGGGAGGAGG + Intronic
1184859467 22:47165045-47165067 CAGCCTCTCCACAGGGCAGGGGG + Intronic
1185245309 22:49770075-49770097 CTGCCTGACTTCAGGGGAGGAGG - Intergenic
949765057 3:7516965-7516987 CTGACTGTCCAGAGGGCAGGTGG - Intronic
949841587 3:8325973-8325995 CAGCCTGTCCGGGAGGGAGGTGG + Intergenic
949852342 3:8431796-8431818 CAGACTGACCAGAGGAGATTAGG + Intergenic
950253105 3:11483228-11483250 AAGACTGACCAGAGAGGATGGGG - Intronic
950691965 3:14666218-14666240 TGGGCTGACCAGATGGGAGGTGG - Intronic
950867000 3:16197253-16197275 CAGCCCCACCAGAGGGGATCTGG + Intronic
951303257 3:21024706-21024728 CATTCTGACCAGAGGAGAGATGG - Intergenic
952673030 3:35993990-35994012 CAGCTTGACCACAGTGGAGTAGG + Intergenic
953749174 3:45596144-45596166 CAGCCTTACCCTAGGGGAGCTGG - Exonic
953891749 3:46756260-46756282 CAGGCTGCCCAGGGCGGAGGCGG + Exonic
954199432 3:49015373-49015395 CAGCATGCCTTGAGGGGAGGAGG + Exonic
954303576 3:49714000-49714022 AAGCCTGACTCGAGGGGAAGTGG + Intronic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
954610918 3:51944069-51944091 CACCTGGGCCAGAGGGGAGGTGG - Exonic
954713331 3:52515530-52515552 AAGCCTGTCCAGAGAGAAGGAGG + Intronic
955814903 3:62831976-62831998 CATCTTGACCAGAGGGAAGCTGG - Intronic
959337120 3:105080088-105080110 CAGCCTGACCACATGGTAGAAGG - Intergenic
961222440 3:125211821-125211843 CGCCCTGAGCAGAGGGGAGAGGG + Intronic
961374806 3:126457077-126457099 CAACCAGACCAGAGGAGACGGGG + Intronic
961439330 3:126943411-126943433 CAACCTGACCCCAGGTGAGGAGG - Intronic
961509262 3:127391113-127391135 CCCCCTGGCCAGTGGGGAGGAGG + Intergenic
966417691 3:179706334-179706356 CCAACTGACCACAGGGGAGGAGG - Intronic
966966677 3:185001668-185001690 CAACCTGTGCAGAGGGGAGAGGG - Intronic
968365576 3:198182676-198182698 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
969325472 4:6441520-6441542 CAGCCTGAACAGAGGCGAGGTGG - Intronic
969343646 4:6557967-6557989 CTTCCTGTCCACAGGGGAGGAGG - Intronic
969367963 4:6710482-6710504 CAGGCTGACAGGAGGGGCGGAGG - Intergenic
969528828 4:7718308-7718330 CAGCCTGTCCAGACTGAAGGAGG + Intronic
971425359 4:26510110-26510132 CAGTCCAGCCAGAGGGGAGGAGG - Intergenic
972945451 4:44248850-44248872 CAGGTTCTCCAGAGGGGAGGAGG - Intronic
974103601 4:57443420-57443442 CAGGCTGACAAGAGGGCAGGGGG - Intergenic
974351905 4:60759331-60759353 CAGCTTGGGCACAGGGGAGGTGG + Intergenic
975395696 4:73870529-73870551 CCAACTGACCAGAAGGGAGGAGG + Exonic
977941990 4:102869031-102869053 CAGCTTGGCCAGAGCGGAGGGGG + Exonic
978010466 4:103675843-103675865 TAGCCTGAGTGGAGGGGAGGGGG + Intronic
978065134 4:104388732-104388754 TAGCCTGACCAGAAAGGAGGAGG - Intergenic
979254610 4:118597843-118597865 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
979334351 4:119448188-119448210 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
982353558 4:154443026-154443048 TAGGCTGGACAGAGGGGAGGAGG - Intronic
985938104 5:3112011-3112033 CAGGCTGGCCAGAGCAGAGGTGG - Intergenic
986066588 5:4240389-4240411 CAGCCCAACCCGAGGGGAGAAGG + Intergenic
990213392 5:53504726-53504748 AAGTCTGAACAGAGGGGTGGTGG - Intergenic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
993851456 5:93015349-93015371 CAGCCTCCCCAGTGGGGTGGGGG + Intergenic
995859106 5:116623188-116623210 CAGCCAAACTACAGGGGAGGGGG - Intergenic
997459688 5:134043477-134043499 CAGAATAACCAGAGAGGAGGAGG - Intergenic
997532719 5:134592144-134592166 CTGACTGACCAGAGGCAAGGAGG + Intergenic
998526888 5:142850715-142850737 CAGCCTAATGAGAAGGGAGGAGG - Intronic
998952240 5:147404015-147404037 CAGCCTCAGCAGAGGGCATGAGG + Intronic
999660387 5:153856519-153856541 CAGCCAGAGAAGAAGGGAGGAGG - Intergenic
1000082158 5:157858756-157858778 CAGCCTCGCCAGCGGGGATGAGG + Intronic
1000275791 5:159733623-159733645 CAGACAGACCAAAGGGGAGTAGG + Intergenic
1001518943 5:172377110-172377132 CAGCCAGAGCAGAGGAGTGGGGG + Intronic
1001612593 5:173015486-173015508 CAGCCCAACCATAGGGGAAGGGG + Intronic
1001794246 5:174488928-174488950 CAGCCTGCCGAGAGGCGAGACGG - Intergenic
1002447173 5:179296655-179296677 CGGCCTGGGCAGAGGGCAGGAGG + Intronic
1002601712 5:180357361-180357383 CAGCCTCTCAAGAGGGGCGGGGG - Intergenic
1002820128 6:717126-717148 AAGGCTGACCGGAGGGCAGGGGG + Intergenic
1002875389 6:1205052-1205074 CAGCCTGGCGAGGGGAGAGGGGG - Intergenic
1002925111 6:1601536-1601558 CTTCCTGAGCAGATGGGAGGAGG - Intergenic
1003019176 6:2495493-2495515 CAGTCTCACCAGAGGAGAAGGGG + Intergenic
1003125438 6:3351990-3352012 CAGCCTTACCAGTCGGGTGGTGG - Intronic
1004265408 6:14144829-14144851 CAGCCTGAGCAGGAGGGATGGGG - Intergenic
1004485044 6:16058585-16058607 GATCCTGAGCAGAGGGCAGGAGG - Intergenic
1005075782 6:21905592-21905614 GAACCTGACCAGCTGGGAGGAGG - Intergenic
1005496603 6:26393053-26393075 TTACGTGACCAGAGGGGAGGAGG - Exonic
1005501336 6:26431428-26431450 TTGTGTGACCAGAGGGGAGGAGG - Intergenic
1005505904 6:26468635-26468657 TTGTGTGACCAGAGGGGAGGAGG - Exonic
1005909049 6:30292172-30292194 CTGCCTGAAAAGAGGTGAGGAGG + Intergenic
1006014638 6:31070618-31070640 CAGTCTGTCCACTGGGGAGGGGG - Intergenic
1006131858 6:31874457-31874479 CACCTGGAGCAGAGGGGAGGAGG + Exonic
1006546675 6:34786673-34786695 CACCCTGTCCAGGAGGGAGGTGG + Intergenic
1007312643 6:40958795-40958817 CTGCCTGAGCATAGAGGAGGAGG - Intergenic
1007312927 6:40961061-40961083 CAGCCTGGTCAGTGGGCAGGAGG + Intergenic
1007478962 6:42137549-42137571 CAGCCACACCAGAGGGCACGAGG + Intronic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1008282190 6:49610054-49610076 CAGCCGGACCTGATGGGGGGTGG + Intronic
1008547477 6:52595993-52596015 CAGCCTGAACAGAGAGTTGGGGG - Intergenic
1011379763 6:86730505-86730527 ATACCTGACCTGAGGGGAGGTGG + Intergenic
1013389265 6:109666776-109666798 CAGCCTGGCCAGAGGTCAGATGG - Intronic
1015626364 6:135183158-135183180 CAGGTAGCCCAGAGGGGAGGCGG + Intronic
1016938469 6:149465882-149465904 CAGCCCAACCATAGGGGAGGGGG + Intronic
1018867864 6:167759564-167759586 CAGCCTGACCAGGCGGGAGATGG + Intergenic
1019170580 6:170131191-170131213 CAGCCAGACCTCAGGGGAAGGGG - Intergenic
1019539320 7:1544685-1544707 CAGCCTCACCCGTGGGGCGGAGG + Exonic
1022427430 7:30282788-30282810 AAGGCTCACCAGAGAGGAGGTGG + Intergenic
1024055954 7:45659960-45659982 GGGCCTTACCAGAGGGGAAGGGG - Intronic
1024069705 7:45775509-45775531 GAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1025020704 7:55477063-55477085 TAGCCAGACCAGAGGCTAGGAGG - Intronic
1026375513 7:69746650-69746672 CAGCCTGACTAGAGCAGAGAGGG + Intronic
1027226587 7:76247582-76247604 CAGCCTCACCTGAGGGGCGAGGG + Intronic
1029692364 7:102190818-102190840 CAGCCTGCAGAGATGGGAGGTGG - Intronic
1030751573 7:113237533-113237555 AAGCCTGACCAGGTGTGAGGAGG + Intergenic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1032047091 7:128619794-128619816 AAGGCTGGCCAAAGGGGAGGTGG - Intergenic
1033167390 7:139052282-139052304 CAAACAAACCAGAGGGGAGGGGG - Intronic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1034102181 7:148459315-148459337 CATCCTGACCAGAGGAGGGCAGG + Intergenic
1034202263 7:149289998-149290020 CAGCCTGCCCAGTGCGGAGAGGG + Intronic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034305527 7:150042428-150042450 CACCCTCATCACAGGGGAGGAGG - Intergenic
1034531593 7:151699279-151699301 CAGCCTGACCGCAGGGAGGGAGG - Intronic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1035567406 8:650583-650605 CAGCCTGACCAGGGAGGAACCGG + Intronic
1035587157 8:785533-785555 CAGAGAGACCTGAGGGGAGGAGG - Intergenic
1037110449 8:15159079-15159101 CAGCCTTCTGAGAGGGGAGGGGG + Intronic
1037309802 8:17543299-17543321 CGACCTGAGCAGAAGGGAGGAGG - Exonic
1037843559 8:22262912-22262934 CAGACTGAACAGACGGGCGGTGG - Intergenic
1037870025 8:22485427-22485449 CAGCCAGATCAGACGGGAAGGGG + Intronic
1038258217 8:25970517-25970539 GAGCCTGAAGAGTGGGGAGGGGG - Intronic
1039363137 8:36901853-36901875 AAGCCTGACCAAGGTGGAGGGGG - Intronic
1041734571 8:61096077-61096099 CTGCCTGACAAAAGGGGAAGTGG - Intronic
1045065319 8:98438934-98438956 CAGCCTCACCCGTGGGGAGAAGG + Intronic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1046386411 8:113513468-113513490 AAGCCTGACCAGGTGTGAGGAGG + Intergenic
1047387881 8:124426382-124426404 CCGCCTGACCAGGGGCCAGGAGG - Intergenic
1047421222 8:124709910-124709932 CAGCTAAACCAGAGGGTAGGTGG - Intronic
1048764307 8:137828801-137828823 AAGCCTGACCAGGTGTGAGGAGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049569702 8:143363531-143363553 CAGGCTGCCAAGAGTGGAGGAGG - Intergenic
1052844397 9:33322338-33322360 CAAGCTGAGCTGAGGGGAGGAGG - Intronic
1053410826 9:37915050-37915072 CAGCCTGCCCTGGTGGGAGGTGG - Intronic
1053727361 9:41017574-41017596 CAGCCTGCCCAGGGCAGAGGAGG + Intergenic
1054701154 9:68414538-68414560 CAGCCTGCCCAGGGCAGAGGAGG - Intronic
1055941008 9:81649752-81649774 CTGTCTCCCCAGAGGGGAGGAGG - Intronic
1056896774 9:90558888-90558910 CATCCTGACCAGGCGGGAAGAGG + Intergenic
1056978299 9:91282103-91282125 CAACCAGAGCAGAGAGGAGGAGG - Intronic
1058892856 9:109375553-109375575 GCTCCTGACCAGAGGGAAGGTGG + Intronic
1059329118 9:113524059-113524081 CAGCCTGACCACAGGGCGGTGGG + Intronic
1060583259 9:124770721-124770743 AAGCCTGTGCAGAGGGGACGGGG + Intronic
1061013909 9:127971150-127971172 AACCCTGCCCAGAGAGGAGGTGG - Intronic
1061578249 9:131521296-131521318 CTCCCTGAGCAGAGGGCAGGTGG + Intronic
1061618955 9:131798489-131798511 CAGCCTGCCCAGGGTGGAGAAGG + Intergenic
1062502154 9:136856238-136856260 AAGCCTGGCCAGCGGGGCGGGGG - Intronic
1062607827 9:137355921-137355943 CAGCCTGTCCAGAGGGGCCTGGG + Intronic
1062710637 9:137973343-137973365 CAGGCTTGCCAGAGGCGAGGGGG + Intronic
1062749945 9:138245543-138245565 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1185570856 X:1133827-1133849 CAGCCTCACCAGAGTGGGGAGGG - Intergenic
1185755660 X:2651137-2651159 GAGCGTGCCCAGTGGGGAGGCGG - Intergenic
1187452783 X:19413515-19413537 CACCCTGCCCAGCGAGGAGGCGG + Intronic
1192549322 X:72041568-72041590 CAGCCTCAGGAGAGTGGAGGGGG + Intergenic
1195394616 X:104397595-104397617 CACCCTGACCATAGGGCAGAAGG - Intergenic
1197785298 X:130191989-130192011 CTGCCTGACCAGAGTGTTGGGGG - Intergenic
1199996179 X:153028193-153028215 GAGCCTGAGGAGAGGGGAGGAGG + Intergenic
1200206660 X:154321291-154321313 CAGCCTGCTCAGGTGGGAGGGGG + Intronic
1200239711 X:154487059-154487081 CAGCCAGACCAGAAAGGAGGAGG - Intergenic