ID: 954453807

View in Genome Browser
Species Human (GRCh38)
Location 3:50586169-50586191
Sequence CACCTCAGGAGGGCCCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954453807_954453819 3 Left 954453807 3:50586169-50586191 CCCCCCAGGGCCCTCCTGAGGTG 0: 1
1: 0
2: 3
3: 41
4: 329
Right 954453819 3:50586195-50586217 GGAAGGACCTTTGGGATCTTTGG 0: 1
1: 0
2: 1
3: 8
4: 153
954453807_954453818 -5 Left 954453807 3:50586169-50586191 CCCCCCAGGGCCCTCCTGAGGTG 0: 1
1: 0
2: 3
3: 41
4: 329
Right 954453818 3:50586187-50586209 AGGTGTCTGGAAGGACCTTTGGG 0: 1
1: 0
2: 0
3: 15
4: 204
954453807_954453817 -6 Left 954453807 3:50586169-50586191 CCCCCCAGGGCCCTCCTGAGGTG 0: 1
1: 0
2: 3
3: 41
4: 329
Right 954453817 3:50586186-50586208 GAGGTGTCTGGAAGGACCTTTGG 0: 1
1: 0
2: 0
3: 15
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954453807 Original CRISPR CACCTCAGGAGGGCCCTGGG GGG (reversed) Intergenic
900121917 1:1051881-1051903 CACACCAGGAGGGCCCAGGAGGG + Intronic
900146409 1:1160753-1160775 CTCCTGAGGGTGGCCCTGGGAGG - Intergenic
900589825 1:3454624-3454646 CCCCGCAGGTGGGCGCTGGGCGG - Exonic
900800051 1:4731849-4731871 CAGCTCAGGTGGGTCCTGGGAGG + Intronic
901319378 1:8330262-8330284 GGCTTCGGGAGGGCCCTGGGGGG + Exonic
901451772 1:9340266-9340288 CAGCAGAGGAGGGGCCTGGGGGG + Intronic
902359699 1:15935692-15935714 CTCCTCGGGAGGGTGCTGGGAGG - Exonic
903278040 1:22233927-22233949 TGCCTCAGCAGAGCCCTGGGAGG + Intergenic
905317155 1:37090025-37090047 CACTTCTGGATAGCCCTGGGAGG + Intergenic
906748714 1:48239903-48239925 CACCTCCTGGGGGCCCAGGGAGG + Intronic
915007842 1:152656408-152656430 CACCTTAGGAGGGCTCTTAGGGG - Intergenic
915562310 1:156694369-156694391 CATCTCAGGCTGGCCCTGGCGGG + Intergenic
915925991 1:160020102-160020124 CAGCTCAGGTGGGTCCAGGGCGG + Intergenic
916069278 1:161160612-161160634 CACCACAGGCTGGACCTGGGAGG - Exonic
916424572 1:164668492-164668514 CAGCCCAGCAGGGCCCTGGCTGG - Intronic
918339041 1:183552136-183552158 TCCCTCCGGAGGGCCCCGGGGGG - Intronic
918343772 1:183588999-183589021 CCCCTCAGCAGGCCCCTGAGAGG + Intronic
920499303 1:206476421-206476443 CCCCTCATGGGGGCTCTGGGGGG - Intronic
921259684 1:213374830-213374852 CACCTCCAGAGGCCTCTGGGAGG + Intergenic
921289781 1:213646728-213646750 GACCTCAGGAGAGCTCAGGGAGG - Intergenic
922159988 1:223072505-223072527 CACCTCAGTAGGGCCATGGAAGG - Intergenic
923475547 1:234327930-234327952 CAGCTCCTGAGGGCCCTGCGGGG + Intergenic
924403614 1:243718131-243718153 CACCTCAGCTGAGCCTTGGGTGG - Intronic
924567679 1:245211944-245211966 CTCCTCAGCGGGGGCCTGGGAGG + Intronic
1062876053 10:943760-943782 CAGGTCAGGAGGGCCCGGGTCGG + Intergenic
1063447450 10:6128285-6128307 CATCCAAGCAGGGCCCTGGGCGG - Intergenic
1063980429 10:11447639-11447661 GACCTCAGGTGGGCCTTCGGAGG - Intergenic
1067054797 10:43044290-43044312 CTCCTCAGAAGTGCCCTGTGAGG + Intergenic
1067161164 10:43826110-43826132 AGCCTCAGGAGGGCCGCGGGTGG - Intergenic
1067251146 10:44587945-44587967 ATCCTGAGGAGGGCCCAGGGAGG - Intergenic
1067419372 10:46133493-46133515 CCACTCTTGAGGGCCCTGGGGGG - Intergenic
1067504723 10:46840090-46840112 CCACTCTTGAGGGCCCTGGGGGG - Intergenic
1069602495 10:69716983-69717005 CAACTCAGGAGGGACCAGGAGGG + Intergenic
1070374198 10:75813240-75813262 GGCATCAGGAGAGCCCTGGGAGG + Intronic
1070381295 10:75882803-75882825 ACCATCAGGAGGGCCCTGGAAGG - Intronic
1070804786 10:79264676-79264698 CACCTCCGGAGGGGCTTGTGAGG + Intronic
1070888942 10:79927908-79927930 CACCTCATGAGGGGCCTGTAAGG - Intergenic
1071224502 10:83512616-83512638 CACCTCAGGCAGGGCCAGGGGGG + Intergenic
1071563613 10:86660577-86660599 CCCCACAGTAGGGCCCTGGGGGG - Intronic
1073180427 10:101579875-101579897 GACATCAGGAGAGACCTGGGAGG - Intronic
1073181015 10:101583236-101583258 CTCCTCAGGAAGGCCCTTGCTGG + Intronic
1073472408 10:103731089-103731111 CACCTCAGCTGGGCCCTGTGTGG - Intronic
1073482435 10:103794971-103794993 CAACTCAGGAAGGGGCTGGGAGG + Intronic
1074819093 10:117165836-117165858 GGCGTCAGGAGCGCCCTGGGAGG + Intergenic
1075816039 10:125265475-125265497 CACCCCAGGTGGGTCCTGTGAGG + Intergenic
1075933208 10:126317170-126317192 CTCCTCAGAAGGGCTGTGGGTGG - Intronic
1075944188 10:126418293-126418315 ATTCTCAGGAGGGCCCTGGGAGG - Intergenic
1075991029 10:126839138-126839160 TGCCTCTGGAGGGCCCTGGTGGG + Intergenic
1076047044 10:127302358-127302380 GACTACAGGAGAGCCCTGGGGGG + Intronic
1076132349 10:128022201-128022223 CGACTCAGGAGGGGCCTGGGTGG - Intronic
1076538398 10:131197697-131197719 CACCTCAGGTCGGCTCTGGCTGG - Intronic
1076745276 10:132509808-132509830 AAGCTCAGGAGGGCCCTGTGTGG - Intergenic
1076782301 10:132731068-132731090 GCCCTGAGGTGGGCCCTGGGTGG + Intronic
1077404761 11:2377951-2377973 CAGCTAAGGAGGGGCCTGCGCGG + Intronic
1079622191 11:22567821-22567843 GACCTCAGGAGGGGCTGGGGTGG + Intergenic
1080666675 11:34342443-34342465 GTCCTCAGGAGTGGCCTGGGTGG - Intronic
1081620487 11:44616441-44616463 CACCTGACAAGGGACCTGGGAGG + Intronic
1083162941 11:60866984-60867006 ATCCTCAGGAGAGCCCTTGGAGG + Intergenic
1083300440 11:61737305-61737327 CACCTCAGCAGGCCCCCTGGCGG - Exonic
1083826236 11:65205536-65205558 CACCACAGCAGGGCCCCAGGAGG - Intronic
1084192940 11:67507051-67507073 CTCCTCTGGAGGGCAGTGGGTGG - Intronic
1084448860 11:69220796-69220818 CAGCCCACGAGGGCTCTGGGTGG - Intergenic
1084572601 11:69968618-69968640 CATCTCAGCAGGGCCATCGGGGG - Intergenic
1084672676 11:70616461-70616483 CGCCCGAGGAGGGCGCTGGGTGG + Intronic
1084945116 11:72634193-72634215 CACGACAGGAGGGCCCGGGGAGG + Intronic
1085154305 11:74279288-74279310 CACCTCTGGAGGTCCCTGAATGG + Intronic
1089119795 11:116125472-116125494 CACCTGAGGAGGACTCTGGGAGG + Intergenic
1089242873 11:117097630-117097652 CACGTCTGCAGGGCGCTGGGAGG - Intronic
1089361227 11:117888019-117888041 AACCTCAGGAGTGCTCTGAGAGG + Intergenic
1089536263 11:119162279-119162301 CACAAAAGGAGGGCCGTGGGTGG - Exonic
1089614538 11:119687801-119687823 CATCCCAGGAGGGGCCTGTGGGG + Intronic
1091086614 11:132727431-132727453 CTCCCCAGGAGAGCCCTGGCTGG - Intronic
1091582582 12:1798226-1798248 CACCTCAGGAGGCTCCGGGAGGG - Intronic
1091979517 12:4853899-4853921 CTCCTGAGGAGGGGCCAGGGTGG + Intergenic
1094016844 12:25874061-25874083 CACTTCAGGAGGGACCAGTGTGG - Intergenic
1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG + Intronic
1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG + Intronic
1096606488 12:52769975-52769997 CACCCCAGGAGGGCCCATTGTGG - Intronic
1097088838 12:56488877-56488899 CACCTCAGGGAGGCATTGGGCGG + Intergenic
1097176772 12:57147819-57147841 GGCCTCAGGGGGGCCCTCGGGGG - Intronic
1097178307 12:57156357-57156379 CCCCACAGGAGGGCCCAGAGAGG - Intronic
1097779028 12:63682233-63682255 TACCTCAGAAAGGCCCAGGGAGG + Intergenic
1097827266 12:64186946-64186968 GACATCAGGATGACCCTGGGGGG + Intronic
1100187105 12:92150507-92150529 CAACTGAGGCGGGCCCTGGAGGG + Intergenic
1100245466 12:92752605-92752627 CACCTGAGGATGGCCCTGAAGGG + Intronic
1101907690 12:108839933-108839955 GGCCTCAGGAGGGCCCTGAGAGG + Intronic
1102492789 12:113298957-113298979 TCCCTCAGCGGGGCCCTGGGCGG - Exonic
1103171915 12:118828131-118828153 CACCTTAGCAGCTCCCTGGGAGG + Intergenic
1103946823 12:124531716-124531738 CACCTCTCGGGGGCTCTGGGAGG - Intronic
1104810136 12:131615470-131615492 GACCTCAGGAGTGCACGGGGCGG - Intergenic
1104921785 12:132294414-132294436 CACTTCTGGAGGGCCCTGGTGGG - Intronic
1107503588 13:41007183-41007205 CACCTCAGAAACGCCCTGTGTGG + Intronic
1109778521 13:67076513-67076535 AACATAAGGAGGGCCGTGGGAGG + Intronic
1112483566 13:99799897-99799919 CACCGCTGCAGGCCCCTGGGTGG - Intronic
1113798013 13:113069942-113069964 GATCTCAGGAAGGCCCGGGGTGG + Intronic
1113940765 13:114017586-114017608 CAGCTCAGGAGGAGCCTGGCTGG + Intronic
1114266563 14:21075684-21075706 CTCCTCAGGAGGGCACGGTGGGG - Exonic
1117249523 14:53922608-53922630 CAACTAAGGAGGGCCCGGGATGG + Intergenic
1117315431 14:54567204-54567226 CACCCCAGGCGGGCCGTGAGGGG + Intronic
1117920146 14:60721133-60721155 CACCTCACCAGGGCACTGGATGG - Intronic
1118850627 14:69580531-69580553 CACCTCAGGAAGGCACTGGAAGG - Intergenic
1121004758 14:90483049-90483071 TACCTCAGGTGGGCCTAGGGAGG + Intergenic
1121585704 14:95061593-95061615 CACTTCTGGATGGCCCTGAGAGG - Intergenic
1122505862 14:102231342-102231364 CCCCTCAGAACGGCCCTGGAGGG - Intronic
1202843379 14_GL000009v2_random:144833-144855 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1202912775 14_GL000194v1_random:135071-135093 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1202879867 14_KI270722v1_random:47609-47631 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
1124139415 15:27064172-27064194 CTCCCCAGGAGGGCGCAGGGTGG + Intronic
1124154255 15:27211172-27211194 CACTCCTGGAGGGCCTTGGGTGG - Intronic
1124371824 15:29108421-29108443 CACCACTGCAGGGCCCAGGGAGG + Intronic
1124624666 15:31301069-31301091 CACGTCTGGAGGGCCCTGTGTGG + Intergenic
1125739470 15:41952108-41952130 CACCTGCGGAGGGGCCTGGGTGG + Intronic
1126386701 15:48100702-48100724 CTCCCCAGCAGTGCCCTGGGAGG - Intergenic
1127956739 15:63860322-63860344 CACCTCCGGAAGGCAGTGGGTGG - Intergenic
1128345544 15:66850428-66850450 CATTTCAGCAGGGCCCTGGAAGG - Intergenic
1128386639 15:67153922-67153944 CACCTCCCAAGGGCCATGGGTGG - Intronic
1128565523 15:68698350-68698372 GACCTGAGGAGGAACCTGGGTGG - Intronic
1130398901 15:83530589-83530611 GACCTGAGGAGGGGCCGGGGAGG - Intronic
1132018770 15:98341981-98342003 CAAATCAGGAGGGGTCTGGGGGG + Intergenic
1132464226 16:70377-70399 CACCTCTGGAGGGCTCTGACTGG - Intronic
1132537900 16:492411-492433 CTCCCGGGGAGGGCCCTGGGCGG - Intronic
1132680856 16:1141185-1141207 GGCCTCAGGAGGGGCCAGGGCGG - Intergenic
1132830985 16:1928211-1928233 CCCCACAGCAGGGGCCTGGGTGG - Intergenic
1132863196 16:2081514-2081536 CAGGCCAGGAGGCCCCTGGGGGG + Intronic
1132911805 16:2317577-2317599 CACCCCAGGAGGGCCCTCTTGGG - Intronic
1133236385 16:4389223-4389245 CACCTCGGGAGGGCCAGGAGAGG - Intronic
1135940914 16:26820966-26820988 ATCTTCAGGAGAGCCCTGGGAGG - Intergenic
1137403400 16:48171406-48171428 CTCCACATGAGGGCCCTGGGGGG - Intronic
1139478222 16:67213794-67213816 GACCTCAGGAGCCACCTGGGAGG - Intronic
1139516375 16:67454772-67454794 CACCACATGAGGGCTCTGGAAGG - Intronic
1141611807 16:85185840-85185862 AAACTCTGGAGGGCCCTGCGGGG + Intergenic
1141628068 16:85271914-85271936 CACCTCAGGAGTGCCTTCGGGGG + Intergenic
1141638622 16:85328815-85328837 CACCGCGGGAGGCCCCGGGGCGG - Intergenic
1141680063 16:85538638-85538660 CACCTTCGGAGGCCCCTGTGGGG + Intergenic
1141777493 16:86134151-86134173 CTACTCTGGAGGGACCTGGGTGG + Intergenic
1141851512 16:86649451-86649473 CCCCGCAGGAGACCCCTGGGTGG + Intergenic
1141886900 16:86898563-86898585 CCCCTCAGGAGGGACTTGTGAGG - Intergenic
1142358098 16:89613595-89613617 TTCCTGAGGAGGGGCCTGGGAGG + Intronic
1143784322 17:9245380-9245402 CACCACAGTCGGGCCCTGTGAGG + Intergenic
1144713659 17:17419789-17419811 CACTTGATGAGGGCCCTGGCTGG - Intergenic
1144797825 17:17904523-17904545 CTCCTCATGAGGGGCCTGGTTGG + Intronic
1146790763 17:35749285-35749307 AACCTCAGGGGTGACCTGGGGGG - Intronic
1147332703 17:39708254-39708276 AACCCCAGGGAGGCCCTGGGGGG + Intronic
1148238044 17:45982574-45982596 CACACCAGAAGGGCCCTCGGAGG + Intronic
1148747652 17:49927508-49927530 CACCTAAGGGAGGCCCTGGAGGG - Intergenic
1148769817 17:50060281-50060303 CACCTCAGGGAGGCACTTGGTGG - Intronic
1150125643 17:62632806-62632828 CACCTCAGGAGGGCACATGTAGG + Intronic
1150226970 17:63529572-63529594 GGCCTCAGGAGGTCCTTGGGGGG - Intronic
1151757359 17:76082455-76082477 CTCCTCTGGAGGGCTCTGTGGGG - Exonic
1151827116 17:76529753-76529775 CACCAGAGGAGGGCACTGGCAGG - Intronic
1151967104 17:77437184-77437206 CACCCCAGTGGGGCCCTGCGAGG + Intronic
1153904623 18:9650248-9650270 GACCTCTGTGGGGCCCTGGGAGG - Intergenic
1154198273 18:12281745-12281767 CATCTCAGGGGAGGCCTGGGTGG - Intergenic
1156566983 18:38202875-38202897 CATCTTAGGAGGGACCTGGCAGG - Intergenic
1157101017 18:44729842-44729864 AACCCCAGGAGGTCCCGGGGAGG + Intronic
1157810805 18:50694366-50694388 CACCTCAGAAGTCCCCTGGCTGG + Intronic
1160123538 18:76151006-76151028 CAACTCAGAGGGGCCCCGGGAGG - Intergenic
1160727091 19:622123-622145 CAGCTCAGGAGGGCACTGCCTGG + Intronic
1160840291 19:1143719-1143741 CCTCTCATGAGGGCCCTGTGAGG + Intronic
1161447983 19:4328643-4328665 CGCGTCTGGAGAGCCCTGGGTGG - Intronic
1161453759 19:4360312-4360334 CCCCTCAGGAAGGCGGTGGGTGG + Intergenic
1162112109 19:8404863-8404885 CACCGGAGGAGGGCCCAGTGGGG + Intronic
1162415850 19:10536763-10536785 CACCTCAGGAACCCCCTGGCTGG - Intergenic
1162783015 19:13016877-13016899 CACCACAGAAGGGCCATGGAGGG - Intronic
1162824831 19:13244991-13245013 CCCCTCAGGAGGGCATTGTGGGG - Intronic
1163033778 19:14560450-14560472 TAGCACAGCAGGGCCCTGGGCGG - Intronic
1163451438 19:17379556-17379578 CAGCTCTGGGGGGCTCTGGGTGG - Intergenic
1165369942 19:35398754-35398776 CAGCCCAGGAAGGCCCTCGGAGG - Intergenic
1165382375 19:35490353-35490375 CACCTCAGGACCACCCAGGGTGG + Exonic
1165443359 19:35843553-35843575 CACCTCAGTGGGGTCCTGGAGGG + Exonic
1165861434 19:38911486-38911508 CACCTGGGCAGGACCCTGGGTGG + Intronic
1165882536 19:39053864-39053886 CACCCCGGGAGGGTTCTGGGCGG - Intergenic
1166110917 19:40622491-40622513 CACCTAGGCAGGGCCCTGTGGGG + Exonic
1166260997 19:41640713-41640735 CACCTGGGAAGTGCCCTGGGAGG - Intronic
1166668741 19:44697466-44697488 CACCAGAGGAGGGGCCAGGGAGG + Intergenic
1166978637 19:46620020-46620042 CACCCCGGCAGGGCCCAGGGTGG + Intergenic
1167286467 19:48601288-48601310 CACTGGAGGAGGCCCCTGGGGGG - Exonic
1167424395 19:49422614-49422636 CCCCCCAGGACGGGCCTGGGCGG - Exonic
1167567075 19:50263304-50263326 CGCTTCTGGAAGGCCCTGGGTGG - Exonic
1168027797 19:53656043-53656065 CTCCTCATGAGTGCCCTGGGTGG + Intergenic
1168212965 19:54904980-54905002 CACCTCTGATGGGACCTGGGTGG + Intergenic
1168536423 19:57174101-57174123 CACCTGAGGTGGGCCCGGCGTGG - Intergenic
1168710521 19:58497525-58497547 CACCTGAGAATGGCCCTGTGTGG - Intronic
1202655485 1_KI270708v1_random:16629-16651 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
925346475 2:3175453-3175475 CACCTCAGGTCTTCCCTGGGCGG - Intergenic
925361854 2:3285340-3285362 CACCACAGCTGGGACCTGGGGGG - Intronic
926175828 2:10591359-10591381 CACCCCAGGAGGGGCCCTGGGGG + Intronic
927937229 2:27082818-27082840 CTCCTCCGAAGGGCCCAGGGTGG - Exonic
928485306 2:31725005-31725027 CACCTTAGGAGGGCCGAGGTGGG + Intergenic
928537062 2:32251232-32251254 CGTCTCAGCAGGGCCCAGGGTGG - Exonic
929376970 2:41299267-41299289 CCTCTCAGGAGGCCCCTGGTAGG + Intergenic
932414063 2:71563347-71563369 CAGCTCAGCAGGACCCTGGGTGG + Intronic
936104775 2:109614598-109614620 CACTTCAGGGGCGCCCTAGGCGG + Exonic
936462717 2:112724303-112724325 GACCTCAGCCAGGCCCTGGGAGG + Intronic
937023678 2:118680402-118680424 CATCTCAGGATGGCCCTGGAAGG - Intergenic
937325511 2:120987699-120987721 CAGCTCAGGAAGGCCCAGGTTGG - Intronic
937349866 2:121153926-121153948 CAGCTCTGGAGGGGCCTGGGCGG + Intergenic
937469306 2:122161633-122161655 TACCGCTGCAGGGCCCTGGGAGG + Intergenic
937976177 2:127583349-127583371 CACCCCCGGCTGGCCCTGGGAGG - Intronic
938143180 2:128812828-128812850 CACTGCAGGATGGCCCTGTGTGG - Intergenic
941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG + Intronic
946007336 2:216536718-216536740 CACATCAGCAGGGCCCAGGAGGG + Intronic
946254927 2:218435385-218435407 AACTTCTGGATGGCCCTGGGTGG + Exonic
947534075 2:230929946-230929968 AACCTCAGGAGGGCCTCAGGAGG - Intronic
947621289 2:231592902-231592924 GACCACAGGAGAGCCCTAGGGGG + Exonic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
947760286 2:232599148-232599170 CACCTTGGGTGGGCTCTGGGTGG + Intergenic
948259470 2:236592125-236592147 AACCTGAGAAGGGGCCTGGGAGG + Intergenic
1169293348 20:4371493-4371515 CCCCTCAGGAATGCCCTTGGAGG + Intergenic
1170630106 20:18058161-18058183 CACCGGAGGGGTGCCCTGGGAGG - Intronic
1171447898 20:25217641-25217663 GACCTCAAGAGGGCCATGCGAGG - Intronic
1171448207 20:25219318-25219340 CAGCACAGGAGGGCTGTGGGGGG + Intronic
1171466153 20:25329238-25329260 CCCCACAGGAGTGGCCTGGGCGG + Intronic
1172146909 20:32763332-32763354 CAGCTCAGGAGCACCCCGGGAGG - Intronic
1172221262 20:33276641-33276663 AAGCTCAGGAGGGAGCTGGGCGG - Intronic
1172768624 20:37364127-37364149 CCTCTCAGAAGGGCCCAGGGTGG - Intronic
1173857674 20:46261164-46261186 CACCTTATGTTGGCCCTGGGAGG - Intronic
1173947190 20:46960937-46960959 CATCCCAGGAGGTGCCTGGGAGG + Intronic
1175216819 20:57395644-57395666 CACCTCAGTAAGGCCCAGGCAGG - Intronic
1175726385 20:61321294-61321316 CACCTTAGGAGGGCAGAGGGAGG + Intronic
1175812760 20:61867640-61867662 CACAGGAGGAGGGGCCTGGGGGG - Intronic
1175821753 20:61913752-61913774 CACAGCAGGAAGGCCCTGGCTGG + Intronic
1175822350 20:61917203-61917225 CACCTCAGGTAGAGCCTGGGAGG - Intronic
1175846715 20:62063663-62063685 CCCCTCGGGAGGGCAGTGGGAGG - Intronic
1175990090 20:62784424-62784446 CCCCTCTTGAGGGCCCTGGAGGG - Intergenic
1176367197 21:6040261-6040283 CACCTCAACAGGGCCCTGTCTGG - Intergenic
1176632135 21:9149751-9149773 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1176641172 21:9305072-9305094 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
1176868963 21:14072055-14072077 CCCCTGCGGAGGGCCCGGGGTGG - Intergenic
1179501659 21:41813035-41813057 CACGTCTGGGGGGCTCTGGGGGG + Intronic
1179525963 21:41976027-41976049 TGCCTCAGGAGGGCCCTGCAGGG - Intergenic
1179719239 21:43306078-43306100 CACCACTGCAGGGCCCAGGGTGG - Intergenic
1179756322 21:43498285-43498307 CACCTCAACAGGGCCCTGTCTGG + Intergenic
1180160453 21:45996816-45996838 CATCTCATGAGGACCCTGTGGGG - Intronic
1180176491 21:46092990-46093012 AACCTCAGCAGGGCCCTTTGTGG + Intergenic
1181031071 22:20149122-20149144 CGCCCAAGCAGGGCCCTGGGTGG + Intronic
1181078054 22:20394442-20394464 CACCTCAGCCGGGCGCGGGGAGG + Intronic
1181275696 22:21686439-21686461 CACCTCAGCAGTGCCATGGGAGG - Intronic
1181322917 22:22022587-22022609 CGCCTTGGGAGGGCCCTGGGAGG - Intergenic
1181358676 22:22318517-22318539 CCCCTCGGGAGGGCCCTGGGAGG - Intergenic
1181456205 22:23061508-23061530 CAGCTCACAAGGGGCCTGGGTGG + Intronic
1182663863 22:31943864-31943886 CACCAGAGGAGGGGACTGGGTGG - Intronic
1182954264 22:34406586-34406608 CACTTCCTGAGGGCCCTGGAAGG + Intergenic
1183428526 22:37752085-37752107 CACCTCAGTAGGAGCCTGGGTGG + Intronic
1183541399 22:38431260-38431282 CACCTCTGGAGGGGCCTTGGGGG + Intronic
1184644030 22:45886432-45886454 CACCTAAGGAGGGTCCTAGGGGG + Intergenic
1184665447 22:45986674-45986696 CACCAGAGGTGGGCCCTGGATGG + Intergenic
1184755848 22:46515259-46515281 CTCCCCAGGAGGGCCCAGGTGGG - Intronic
1185036102 22:48477688-48477710 GACCTCAGGCCAGCCCTGGGAGG + Intergenic
1185048121 22:48539247-48539269 CACCTCTCCAGGGCCCTGGCTGG - Exonic
1185182213 22:49369927-49369949 GACCTGAGGAGCGCTCTGGGGGG + Intergenic
1185230463 22:49677546-49677568 CCCCTGAGCAGGACCCTGGGAGG + Intergenic
949495552 3:4628267-4628289 CACCTCAGGAGGTCATTGTGAGG + Intronic
949877424 3:8635341-8635363 CACCTTTGGAGGCCCCAGGGAGG - Exonic
950097409 3:10338076-10338098 CACCAGAGCTGGGCCCTGGGGGG + Intronic
950822552 3:15776648-15776670 CACCTCAGAAGTGCCCTTGTTGG - Intronic
951825606 3:26865039-26865061 AATCTCAGGAGGGAACTGGGAGG - Intergenic
952125120 3:30290961-30290983 CACCTAAGGGGGGTCATGGGAGG - Intergenic
952884323 3:38003264-38003286 CACTTCTGGGAGGCCCTGGGAGG + Exonic
954453807 3:50586169-50586191 CACCTCAGGAGGGCCCTGGGGGG - Intergenic
956294518 3:67697193-67697215 CAGCCCTGGAAGGCCCTGGGTGG - Intergenic
956929411 3:74025664-74025686 GCCCTCAGGAGGGCTCTGGTAGG + Intergenic
956979050 3:74614872-74614894 GGCCTCCGCAGGGCCCTGGGCGG + Intergenic
958044429 3:88266642-88266664 AGGCTCAGGAGGGCTCTGGGTGG + Intergenic
958064753 3:88528926-88528948 CTGCTTAGGAGGGCCCTGGTTGG + Intergenic
962604715 3:137023804-137023826 CACCTCTGCAGGGGCCTAGGTGG + Intergenic
963839886 3:150094410-150094432 TCCCTCAGGAGGGCCCTGCCAGG + Intergenic
966917106 3:184591070-184591092 GACCCCAGAATGGCCCTGGGAGG + Intronic
967028740 3:185586477-185586499 CTCTTCAGGAGGGCCCGGGCAGG - Exonic
967932509 3:194700560-194700582 CATCTCAGGGGGGCCGTGGCAGG - Intergenic
1202745724 3_GL000221v1_random:99954-99976 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
968629408 4:1642387-1642409 CACCTCCGGAGGGCAGAGGGAGG - Intronic
968819254 4:2837447-2837469 CACCTCAGGATGGGCGAGGGTGG + Exonic
968944152 4:3654837-3654859 CACCCCACGAGGGTCCTGTGAGG + Intergenic
969114444 4:4862330-4862352 TTCCTCTGGATGGCCCTGGGAGG + Intronic
972730250 4:41787999-41788021 CAGCTCAGGAGGGCACAAGGAGG - Intergenic
972872099 4:43312950-43312972 CACAGCAGGGGGGCCCTGGACGG - Intergenic
982067887 4:151670930-151670952 CACATCAGGAGGGTCCGGTGAGG - Exonic
1202756060 4_GL000008v2_random:63339-63361 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
985808966 5:2069164-2069186 CACGTCCAGAGGGCCCTAGGAGG + Intergenic
985966240 5:3340627-3340649 CTGGACAGGAGGGCCCTGGGCGG + Intergenic
986094119 5:4538885-4538907 CAGCACGGGAGGACCCTGGGGGG + Intergenic
986482371 5:8202336-8202358 CATCTCAGGGAGGCCCTGGGAGG - Intergenic
986751505 5:10792111-10792133 CAGATCAGAAGGGCCCTGAGAGG - Intergenic
987011807 5:13773975-13773997 GACCTCAGGAGAGCCTGGGGAGG + Intronic
997382318 5:133446624-133446646 CACCTGCGGAGGGCCCCGGGAGG - Intronic
998006008 5:138657459-138657481 CTCATCAGGAGGTGCCTGGGAGG - Intronic
999132908 5:149298173-149298195 TTCCTCAGGAGGGCCCAGGGTGG + Intronic
1002364654 5:178700538-178700560 CACCTCACTGGGCCCCTGGGAGG + Intergenic
1002696143 5:181092451-181092473 GACCTCAGGAGGGCCAGGGGTGG - Intergenic
1003308536 6:4949242-4949264 CACCCCAGCAGGCCCCTGAGAGG - Intronic
1006031402 6:31179256-31179278 CATCTCAGGAAGGCACTGGGAGG - Intronic
1006397542 6:33796989-33797011 CTCCTGAGGAGGGAGCTGGGAGG - Intronic
1007165164 6:39823974-39823996 TCCCTCAGCTGGGCCCTGGGTGG + Intronic
1007285031 6:40741444-40741466 CACAGCAGGAGTGGCCTGGGAGG + Intergenic
1013803390 6:113971159-113971181 CACCTCAGGAGGCCGCAGGGAGG + Exonic
1014089526 6:117387928-117387950 GACTTCAGGAGGGTCTTGGGTGG + Exonic
1018422193 6:163649126-163649148 CAGCTCTGGATGGCTCTGGGTGG + Intergenic
1019358239 7:592069-592091 CACCTCACGGAGGCCCTGGTGGG - Intronic
1019543755 7:1562994-1563016 GACCTCGGGAGGGCACTGGGGGG + Intergenic
1019558656 7:1645168-1645190 CACCCCAGGACACCCCTGGGTGG + Intergenic
1019747755 7:2710009-2710031 CACCACACGCGGGCCCTGGCAGG - Intronic
1022937949 7:35199876-35199898 TACCTCAGAAAGGCCCAGGGAGG + Intergenic
1023262126 7:38368597-38368619 CTTCTCAGAATGGCCCTGGGTGG - Intergenic
1023766628 7:43517643-43517665 TTTGTCAGGAGGGCCCTGGGAGG - Intronic
1024930618 7:54664156-54664178 CAGCCCAGGACGGCGCTGGGAGG - Intergenic
1029179550 7:98690171-98690193 CACACCAGGAGGGACCCGGGAGG + Intergenic
1029516149 7:101024530-101024552 CCCCACTGGAGGGCCATGGGAGG - Intronic
1033216923 7:139500035-139500057 CACCTCATCCGGGCCCTGGTGGG - Intergenic
1034283025 7:149866614-149866636 CACCTAAGGAAGGCACTGGCCGG - Exonic
1034374146 7:150628274-150628296 CACCTCTGGCGAGACCTGGGGGG + Exonic
1034530008 7:151689712-151689734 AACCCCAGGAGAGCCCTGGTTGG - Intronic
1035230976 7:157465276-157465298 CATCTCACGGGGGTCCTGGGTGG - Intergenic
1036295110 8:7528890-7528912 CGCATCAGCAGGGCTCTGGGAGG - Intergenic
1036327453 8:7792101-7792123 CGCATCAGCAGGGCTCTGGGAGG + Intergenic
1036799562 8:11780057-11780079 CAAGACAGCAGGGCCCTGGGGGG - Intronic
1037736905 8:21574817-21574839 CACCTGATGAGGGCGCTAGGAGG - Intergenic
1039913355 8:41842121-41842143 CACCCCAGGAGGCACCAGGGTGG + Intronic
1039989611 8:42476507-42476529 AACCACAGGAGCGCCCTGGGTGG + Intronic
1040531718 8:48271578-48271600 CACCTCAGAAAGCACCTGGGAGG - Intergenic
1040595291 8:48832299-48832321 GACCCCAGGAGGACCCTGGGAGG - Intergenic
1040977268 8:53207748-53207770 CACCACAGCTGGGCCCTGAGGGG - Intergenic
1041638731 8:60173894-60173916 GAGCTGAGGACGGCCCTGGGTGG + Intergenic
1045245390 8:100437755-100437777 CTCCTCATGAAGGCTCTGGGTGG - Intergenic
1046015485 8:108599594-108599616 AACCTCAGCAGGGCCCAGGGAGG + Intergenic
1047370517 8:124252335-124252357 CACCTCAGAAGGTCCTTGTGAGG - Intergenic
1048351354 8:133619202-133619224 CAAGTCAGGAGGGGCTTGGGAGG - Intergenic
1048577786 8:135706496-135706518 CCACTCAGGAGGGACTTGGGGGG + Intergenic
1049235565 8:141510667-141510689 CTCCCCAGAAAGGCCCTGGGGGG - Intergenic
1049385582 8:142341445-142341467 CATCCCAGGAGGGCCCTGGCAGG + Intronic
1049423253 8:142526071-142526093 CACCCCATAAGGGCCCTGGCTGG - Intronic
1049658177 8:143808043-143808065 CACCTCAGGAGGGCCCGACAAGG + Intronic
1049684941 8:143935570-143935592 CGCCTCCGGAGGGGCCTGGTGGG - Intronic
1049818991 8:144622796-144622818 CCGCGCAGGAGGGCCCTGGCCGG + Intergenic
1052855056 9:33401943-33401965 CCCCTCAGGAGGGGACTGCGTGG + Intronic
1053169010 9:35865088-35865110 CACCTCAGCAGGGCCCTCCTGGG - Intergenic
1053683074 9:40498284-40498306 CCCCTCAGGAGGGGACTGCGTGG + Intergenic
1053933057 9:43126600-43126622 CCCCTCAGGAGGGGACTGCGTGG + Intergenic
1054280640 9:63126644-63126666 CCCCTCAGGAGGGGACTGCGTGG - Intergenic
1054296174 9:63333782-63333804 CCCCTCAGGAGGGGACTGCGTGG + Intergenic
1054394190 9:64638287-64638309 CCCCTCAGGAGGGGACTGCGTGG + Intergenic
1054428840 9:65143486-65143508 CCCCTCAGGAGGGGACTGCGTGG + Intergenic
1054501539 9:65878049-65878071 CCCCTCAGGAGGGGACTGCGTGG - Intronic
1057302625 9:93895623-93895645 CACCTGAGAAGGGCCCTGAGAGG + Intergenic
1057701528 9:97366368-97366390 CACTCCAGGTGGGCCCAGGGAGG + Intronic
1057936191 9:99240869-99240891 AACATCAGCAGGGCCATGGGAGG - Intergenic
1058678610 9:107422487-107422509 CACCTAGGGAGGTCCCTGGAAGG + Intergenic
1059842182 9:118230068-118230090 GACCTTAGGAGGGCCCAGTGGGG + Intergenic
1060018611 9:120109257-120109279 CATCTCTGGTGGGCCCTGAGGGG + Intergenic
1061177432 9:129006231-129006253 AACATCAGGAGGGACCTGGGAGG - Exonic
1061763934 9:132869644-132869666 CCCATGGGGAGGGCCCTGGGAGG - Intronic
1062106142 9:134756077-134756099 CACCACAGGAGAGCCCTGCAAGG - Intronic
1062206586 9:135341032-135341054 CACCTCAGGGGTGCCCTGGGCGG + Intergenic
1062459264 9:136656034-136656056 CCCCTCTGGGGGGCTCTGGGGGG + Intergenic
1062495660 9:136830426-136830448 ACCCTCAGGAGAGCCCTCGGTGG + Intronic
1062718421 9:138022746-138022768 CCTGTCAGGAGGACCCTGGGGGG - Intronic
1203435147 Un_GL000195v1:130925-130947 CATCTCAGGAAGGACCTGGAAGG + Intergenic
1203754962 Un_GL000218v1:117370-117392 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1203714343 Un_KI270742v1:129910-129932 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1203536863 Un_KI270743v1:48176-48198 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
1185615730 X:1420643-1420665 CACCTCAGGAAGGTTCTGGGCGG + Intronic
1186352150 X:8750932-8750954 GACCCCAGGAGGCCCCTGGGTGG + Intergenic
1187134020 X:16529489-16529511 CACCCCAGGAGGACCACGGGAGG - Intergenic
1188527292 X:31100019-31100041 CATCTTTGGAGGCCCCTGGGAGG - Intronic
1189850091 X:45169205-45169227 CACCTCATGAGGGCGTTGAGAGG + Intronic
1190492814 X:50999949-50999971 GACCTCAGGAAGCACCTGGGAGG + Intergenic
1190511828 X:51180608-51180630 GACCTCAGGAAGCACCTGGGAGG - Intergenic
1191908480 X:66121866-66121888 CCCCTCAGGGGGTCCCTGAGAGG + Intergenic
1192177285 X:68894052-68894074 CACTTCAGCCAGGCCCTGGGTGG - Intergenic
1193228349 X:79012798-79012820 CATCTCAGGAGAGCTCTGGATGG - Intergenic
1197729271 X:129796002-129796024 CACCTCAGGGGGACACTGTGAGG - Intergenic
1198394412 X:136207702-136207724 CACCTCTGGAGGGCCTGGGGAGG + Intronic
1199680381 X:150220344-150220366 CACATCAGCAGAGTCCTGGGAGG - Intergenic
1201168585 Y:11234979-11235001 CACCCCAGGGGGGTCCTGGCTGG - Intergenic