ID: 954455962

View in Genome Browser
Species Human (GRCh38)
Location 3:50600021-50600043
Sequence AGCACCAAGGGAGAGTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954455962_954455971 6 Left 954455962 3:50600021-50600043 CCCTCCTACTCTCCCTTGGTGCT No data
Right 954455971 3:50600050-50600072 CCCCGGCTGCTCACTGGCCTAGG No data
954455962_954455968 0 Left 954455962 3:50600021-50600043 CCCTCCTACTCTCCCTTGGTGCT No data
Right 954455968 3:50600044-50600066 TCACACCCCCGGCTGCTCACTGG No data
954455962_954455974 10 Left 954455962 3:50600021-50600043 CCCTCCTACTCTCCCTTGGTGCT No data
Right 954455974 3:50600054-50600076 GGCTGCTCACTGGCCTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954455962 Original CRISPR AGCACCAAGGGAGAGTAGGA GGG (reversed) Intergenic
No off target data available for this crispr