ID: 954455962 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:50600021-50600043 |
| Sequence | AGCACCAAGGGAGAGTAGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 954455962_954455971 | 6 | Left | 954455962 | 3:50600021-50600043 | CCCTCCTACTCTCCCTTGGTGCT | No data | ||
| Right | 954455971 | 3:50600050-50600072 | CCCCGGCTGCTCACTGGCCTAGG | No data | ||||
| 954455962_954455968 | 0 | Left | 954455962 | 3:50600021-50600043 | CCCTCCTACTCTCCCTTGGTGCT | No data | ||
| Right | 954455968 | 3:50600044-50600066 | TCACACCCCCGGCTGCTCACTGG | No data | ||||
| 954455962_954455974 | 10 | Left | 954455962 | 3:50600021-50600043 | CCCTCCTACTCTCCCTTGGTGCT | No data | ||
| Right | 954455974 | 3:50600054-50600076 | GGCTGCTCACTGGCCTAGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 954455962 | Original CRISPR | AGCACCAAGGGAGAGTAGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||