ID: 954456216

View in Genome Browser
Species Human (GRCh38)
Location 3:50601136-50601158
Sequence GGTGGAGGACACGCCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954456216_954456221 -6 Left 954456216 3:50601136-50601158 CCCCCTGGGGCGTGTCCTCCACC 0: 1
1: 0
2: 3
3: 16
4: 257
Right 954456221 3:50601153-50601175 TCCACCCGCCACTTCTGAGCTGG No data
954456216_954456229 19 Left 954456216 3:50601136-50601158 CCCCCTGGGGCGTGTCCTCCACC 0: 1
1: 0
2: 3
3: 16
4: 257
Right 954456229 3:50601178-50601200 CCAGGCCTGCCCAGCCGCCTGGG No data
954456216_954456225 1 Left 954456216 3:50601136-50601158 CCCCCTGGGGCGTGTCCTCCACC 0: 1
1: 0
2: 3
3: 16
4: 257
Right 954456225 3:50601160-50601182 GCCACTTCTGAGCTGGCACCAGG No data
954456216_954456227 18 Left 954456216 3:50601136-50601158 CCCCCTGGGGCGTGTCCTCCACC 0: 1
1: 0
2: 3
3: 16
4: 257
Right 954456227 3:50601177-50601199 ACCAGGCCTGCCCAGCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954456216 Original CRISPR GGTGGAGGACACGCCCCAGG GGG (reversed) Intergenic
900187003 1:1337335-1337357 GGTGGAGCAGAGGCCCCAGTGGG - Intronic
900292745 1:1930413-1930435 GGTGGAGGACAAGCCCCGGGGGG + Intronic
900324335 1:2100636-2100658 GGTGCAGGACAGGGCACAGGAGG + Intronic
900495949 1:2976309-2976331 GGTGGACACCAGGCCCCAGGCGG - Intergenic
900495975 1:2976400-2976422 GGTGGACGCCAGGGCCCAGGTGG - Intergenic
902197679 1:14809861-14809883 GGTGGTGGAAATGCCCCTGGTGG - Intronic
902915812 1:19638578-19638600 GCTAGAGGACACAGCCCAGGTGG + Intronic
904370468 1:30044723-30044745 GGTGGAGGCCAAGCCCCGGTTGG - Intergenic
905110067 1:35588529-35588551 TGCGGAGGACACCCCCCAGGAGG - Exonic
905173912 1:36124908-36124930 GGTGGGGGACTCGGGCCAGGGGG - Intronic
906901511 1:49841934-49841956 GGTGGAGGACACGCTCGAGGAGG - Intronic
907364403 1:53946635-53946657 GGGGGAGGGGACGCCCCAGAGGG + Intronic
913144573 1:115976633-115976655 GGTGGAGGAGGCGTTCCAGGCGG + Exonic
914379599 1:147104574-147104596 GGTGGAGGAAACGCCCCACCTGG + Intergenic
914719967 1:150281823-150281845 GATGGAGGAGCCGCCCCAGCGGG + Intergenic
914932346 1:151946491-151946513 GGTGTATGACACACCTCAGGAGG - Intergenic
915315053 1:155023803-155023825 GGAGAGGCACACGCCCCAGGGGG + Intronic
916763904 1:167841995-167842017 GCTGAAGGACAGCCCCCAGGAGG + Intronic
1062910068 10:1206438-1206460 CGAGGAGGAGACGCCCCAGTTGG - Intronic
1063639769 10:7818343-7818365 GGTGGAGGAGGCGCCCAGGGCGG - Intergenic
1067848592 10:49741014-49741036 GGTGGGGGACAGGCTGCAGGAGG - Intronic
1068632550 10:59312623-59312645 GGTGGTGGACACGCTGCATGGGG - Intronic
1069901086 10:71707082-71707104 GGTGGAGGCAGGGCCCCAGGAGG - Intronic
1072423714 10:95311150-95311172 GGTGGAGGACAGAACCCAGGGGG + Intergenic
1072519144 10:96214905-96214927 GGTGAAGTACAAGCCCAAGGTGG + Intronic
1073449720 10:103602274-103602296 GGTGGCGGTCAGGCCCCAGTCGG - Exonic
1076311697 10:129512415-129512437 GGTGTTGAACACGCCTCAGGTGG - Intronic
1076552191 10:131288509-131288531 GGTGGAGGGCAGGCCCTGGGTGG - Intronic
1076606957 10:131695390-131695412 GGAGGGGGAGAGGCCCCAGGAGG + Intergenic
1077116196 11:885680-885702 GGTGGAGGCCTCGGCCCAGAGGG - Intronic
1078999446 11:16738913-16738935 GGAGGAGGACGCGCCTGAGGTGG + Intronic
1083039092 11:59668966-59668988 GGTGGAGGACCCGCGCGCGGAGG - Exonic
1083306213 11:61763140-61763162 GGTGGGGGCGACGCTCCAGGTGG + Intronic
1084561019 11:69905505-69905527 GGTGGAGGACTCAGCCCAGTGGG - Intergenic
1084564097 11:69919897-69919919 GAAGGAGGACTCACCCCAGGAGG - Intergenic
1084564277 11:69920525-69920547 GAGGGAGGACTCACCCCAGGAGG - Intergenic
1086380280 11:86245180-86245202 GGCGGAGGCCCCGCCCCAGGCGG + Exonic
1086410789 11:86541853-86541875 GGTGGGGGACACCTCCCAGCAGG + Intronic
1089729887 11:120512867-120512889 GGTGGAGGAGGCGGCCGAGGGGG + Intronic
1092441629 12:8509566-8509588 GGTGGAGGACAGGACTCGGGGGG + Intronic
1101711154 12:107267977-107267999 GGTGGAGAGCAGGCCCCAAGTGG + Intergenic
1102035432 12:109768413-109768435 GGTGGAGCAGGCGCCTCAGGTGG - Exonic
1102469795 12:113153246-113153268 GGCGGAGGAGAGGCACCAGGCGG + Exonic
1102871251 12:116416015-116416037 AGCGGAGGGCACGCCCCGGGGGG - Intergenic
1104803484 12:131570376-131570398 GGTGGAGGGGACGGCTCAGGTGG - Intergenic
1104980373 12:132570803-132570825 GGGGGAGGCCTGGCCCCAGGAGG - Intronic
1105750857 13:23420790-23420812 GGTGGACACCACTCCCCAGGTGG - Intronic
1105751092 13:23421806-23421828 GGTAGACTACAGGCCCCAGGTGG - Intronic
1105751383 13:23425106-23425128 GGTGGACGTCAGGCCCCAAGTGG - Intronic
1105929008 13:25034384-25034406 GGTGGAGAGGAGGCCCCAGGAGG - Intergenic
1113821234 13:113214943-113214965 TGTGGAGGTCACGTCCCATGTGG + Intronic
1114032028 14:18586581-18586603 GGTGGACATCAGGCCCCAGGTGG - Intergenic
1114032222 14:18587538-18587560 GTTGGAAGTCAGGCCCCAGGTGG + Intergenic
1114032348 14:18588163-18588185 GGTGGATACCAGGCCCCAGGTGG + Intergenic
1114032445 14:18588634-18588656 GGTGGACATCAGGCCCCAGGTGG + Intergenic
1114077001 14:19166568-19166590 GTTGGAAGTCAGGCCCCAGGTGG + Intergenic
1114077129 14:19167189-19167211 GGTGGATACCAGGCCCCAGGTGG + Intergenic
1114077228 14:19167660-19167682 GGTGGACATCAGGCCCCAGGTGG + Intergenic
1114084937 14:19231904-19231926 GGTGGACATCAGGCCCCAGGTGG - Intergenic
1114085035 14:19232375-19232397 GGTGGATACCAGGCCCCAGGTGG - Intergenic
1114085159 14:19233000-19233022 GTTGGAAGTCAGGCCCCAGGTGG - Intergenic
1114085354 14:19233957-19233979 GGTGGACATCAGGCCCCAGGTGG + Intergenic
1114493859 14:23119360-23119382 GGGGCAGGACACACCCCAGAGGG + Exonic
1114602434 14:23967520-23967542 GGTGGAGGCAATCCCCCAGGTGG - Intronic
1114606803 14:24004646-24004668 GGTGGAGGCAATCCCCCAGGTGG - Intronic
1114612104 14:24049594-24049616 GGTGGAGGCAATCCCCCAGGTGG - Intergenic
1116973541 14:51093601-51093623 GGTCGGGGAGACGCCGCAGGCGG - Intronic
1118319755 14:64746354-64746376 GGTGGAGGACAGGACCCAGCTGG + Exonic
1119556165 14:75554569-75554591 GGAGGATGACACACCCAAGGAGG - Intergenic
1121669224 14:95695207-95695229 GGTGAAGGACAGCACCCAGGAGG - Intergenic
1122408191 14:101512645-101512667 TGTGGCCGACAGGCCCCAGGTGG + Intergenic
1122598212 14:102907963-102907985 GGTAGGGGACAGGCCTCAGGTGG - Exonic
1125929932 15:43593386-43593408 GGTGGAGGACACAGCACAGATGG + Intronic
1125943100 15:43693218-43693240 GGTGGAGGACACAGCACAGATGG + Intronic
1127453873 15:59140770-59140792 GGTGGTGGACTGTCCCCAGGAGG + Intronic
1127523668 15:59770862-59770884 GGTGGAGCACATGCCCAAGGTGG + Intergenic
1128450942 15:67805553-67805575 GGTGGAGGACAGGCCCAAGAGGG + Intronic
1128550062 15:68592111-68592133 GTTGGAGGACACGGCGCAGAAGG - Intronic
1129270620 15:74417558-74417580 GCTGGAGCAGGCGCCCCAGGGGG - Intronic
1129670646 15:77606013-77606035 GGGCGAGGACTCCCCCCAGGTGG + Intergenic
1129994653 15:79994136-79994158 AGTGGAGGAAAGGCCACAGGTGG + Intergenic
1136013754 16:27382068-27382090 GGTAGAGGACACGGCCCATGTGG + Intergenic
1137705881 16:50535622-50535644 GGTGCAGGACAGGCACCAAGCGG - Intergenic
1139465192 16:67150572-67150594 GCGGGAGGCCACGCCCCGGGGGG + Exonic
1140209327 16:72958618-72958640 ACTGGAGGACAGGCCCCATGAGG - Exonic
1140485544 16:75290282-75290304 GGTGTAAGCCAGGCCCCAGGAGG - Intergenic
1142150368 16:88509981-88510003 GGTGAAGGCCAAGTCCCAGGGGG + Intronic
1142194483 16:88733149-88733171 GATGGAGGACTCTCCCCTGGGGG - Intronic
1142311497 16:89316838-89316860 GGCGGAGAACAGGCCACAGGCGG + Intronic
1142608766 17:1096681-1096703 GGTGGGGAACCCGCCCCGGGAGG + Intronic
1143470834 17:7174161-7174183 GCTGGAGGACGCGCACCTGGTGG - Exonic
1145065005 17:19756111-19756133 AGCACAGGACACGCCCCAGGTGG - Intergenic
1145346756 17:22046730-22046752 GGTGGACATCAAGCCCCAGGTGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147936195 17:44012666-44012688 GGTGGGGGTCAGGCCCCAGCTGG - Intronic
1147964872 17:44189223-44189245 GGTGGTCCACATGCCCCAGGTGG - Exonic
1148841681 17:50502772-50502794 TGGGGAGGACACGCCCAAGATGG - Intergenic
1149430378 17:56592766-56592788 GGTGCAGGACCCGGCCAAGGAGG + Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1152422514 17:80201782-80201804 CCTGGAGGACACGACCCTGGAGG + Exonic
1152805654 17:82354585-82354607 GGTTCAGGACAGACCCCAGGAGG + Intergenic
1152805673 17:82354651-82354673 GGTTCAGGACAGACCCCAGGAGG + Intergenic
1152877318 17:82794238-82794260 CTTGGAGAACATGCCCCAGGGGG + Intronic
1152925369 17:83085223-83085245 CGTGGAGGCCACGCCGCAGCAGG + Exonic
1153493062 18:5669757-5669779 GCTCCAGGACACGCCACAGGGGG - Intergenic
1155392251 18:25350022-25350044 GGTGGAGGAGGCGGCCGAGGAGG + Intronic
1155420842 18:25654318-25654340 AGTGGAGGAGACTTCCCAGGGGG - Intergenic
1157293683 18:46427060-46427082 GGCTGAGGAGAGGCCCCAGGGGG + Intronic
1157305846 18:46517048-46517070 GCTGGAGGGCAGGACCCAGGCGG - Intronic
1160699411 19:498668-498690 GGAGGAGGAGGAGCCCCAGGGGG + Exonic
1160792693 19:929795-929817 GGAGGAGGACGCGGCCCGGGAGG + Exonic
1161103046 19:2430741-2430763 GCTGGAGGAGACCCGCCAGGAGG + Exonic
1161405897 19:4090933-4090955 GGTGGTGTCCCCGCCCCAGGTGG - Intronic
1161406619 19:4094699-4094721 GGGGCAGGACACCCCCCAGCGGG + Intronic
1161840582 19:6677971-6677993 GGTGGAGCACTGGCCCGAGGAGG - Exonic
1161977113 19:7612977-7612999 GGCGGAGGAGACGCCCCCCGAGG + Exonic
1162315193 19:9934517-9934539 AGTGGAGGAGAAGCCACAGGGGG + Intronic
1162348609 19:10135837-10135859 GGTGGAGCACGCGGCCCTGGGGG + Exonic
1162697075 19:12484723-12484745 GGTGGAGGAAGGGCCTCAGGTGG - Exonic
1163698436 19:18775457-18775479 GGTGGCGGGGAGGCCCCAGGTGG + Intronic
1164764836 19:30756456-30756478 GGTTGAGGACACGCCCAGGGTGG - Intergenic
1166020669 19:40025573-40025595 GGTGGAGGACCTGCCCATGGAGG - Intergenic
1166689164 19:44812527-44812549 GATGGAGGACTCTGCCCAGGAGG + Exonic
1167820436 19:51922673-51922695 GGTGGTGCACACAGCCCAGGAGG + Intronic
1167982924 19:53290970-53290992 GTTGGAGGAGACGCCCTGGGGGG - Exonic
1168646104 19:58060049-58060071 GGTGGAGGACACGCGCAAGGAGG - Intronic
925689216 2:6504236-6504258 GGTGGATGACACACACCATGGGG - Intergenic
928373856 2:30759592-30759614 TGTGGAAGACAAGCCGCAGGTGG + Intronic
928589918 2:32803486-32803508 GGTGGAGAACACAGCTCAGGTGG - Intronic
929592400 2:43155834-43155856 GGTGCAGGACTCACTCCAGGGGG - Intergenic
931851744 2:66258245-66258267 GGTAGAGTACAAGCTCCAGGTGG + Intergenic
932238837 2:70142088-70142110 GGAGGAGGGCACGCGCCGGGAGG - Intergenic
933787038 2:85851484-85851506 AGTGGAGGACATGGCCCATGTGG - Intronic
935218644 2:100993527-100993549 GGTGGGTGCCACGGCCCAGGGGG + Exonic
937312374 2:120910141-120910163 GGTGGACCAGATGCCCCAGGGGG - Intronic
938255931 2:129859736-129859758 GGTTGACCACATGCCCCAGGTGG - Intergenic
938490397 2:131758075-131758097 GGTGGACAATATGCCCCAGGTGG - Intronic
938491406 2:131763120-131763142 GGTGGACATCAGGCCCCAGGTGG - Intronic
938491605 2:131764078-131764100 GTTGGAAGTCAGGCCCCAGGTGG + Intronic
938491729 2:131764703-131764725 GGTGGATACCAGGCCCCAGGTGG + Intronic
938495837 2:131797639-131797661 GGTGGATACCAGGCCCCAGGTGG - Intronic
938495962 2:131798264-131798286 GTTGGAAGTCAGGCCCCAGGTGG - Intronic
938496155 2:131799203-131799225 GGTGGACATCAGGCCCCAGGTGG + Intronic
938787161 2:134640641-134640663 GGGAAAAGACACGCCCCAGGGGG + Intronic
940330233 2:152466251-152466273 GGGGGAGGACATGCCCCTGATGG + Intronic
948466552 2:238154702-238154724 GGTGAATGACACGGCCCCGGAGG - Intergenic
948612282 2:239177506-239177528 GCCGGAGGAAACGCCCCAGCGGG + Intronic
948735733 2:240003793-240003815 GGTGGAGGACAGACCCAAGCAGG + Intronic
1169046318 20:2536957-2536979 GGTGGCTGAGACGCCCCAGCAGG - Intronic
1171520800 20:25772803-25772825 GGTGGACATCAAGCCCCAGGTGG - Intronic
1171556121 20:26083688-26083710 GGTGGACATCAAGCCCCAGGTGG + Intergenic
1172272670 20:33663418-33663440 GGTGGACGACAGGACCCGGGTGG + Intronic
1175217938 20:57401256-57401278 GGGGAACCACACGCCCCAGGGGG - Intronic
1175647184 20:60684682-60684704 AGTGGAGGGCAGCCCCCAGGAGG - Intergenic
1175900524 20:62358228-62358250 GAAGGAGGACACGGCCCAAGGGG - Intronic
1175911870 20:62408827-62408849 GGTGGAGGGCAGGACGCAGGAGG + Intergenic
1176708526 21:10131971-10131993 GGTGGACATCAGGCCCCAGGTGG - Intergenic
1176708932 21:10134024-10134046 GGTGGACATCAGGCCCCAGGTGG + Intergenic
1177169306 21:17638215-17638237 GCTGGAGGAAATGTCCCAGGAGG - Intergenic
1178707939 21:34889875-34889897 GGTGGATGAGAGGCCCCGGGAGG - Intronic
1179485889 21:41710581-41710603 GGTGGCAGACACGCCCTGGGAGG + Intergenic
1179505854 21:41839755-41839777 GGAGCAGGACACACCCCGGGGGG - Exonic
1180292617 22:10859236-10859258 GGTGGACATCAGGCCCCAGGTGG - Intergenic
1180292812 22:10860193-10860215 GTTGGAAGTCAGGCCCCAGGTGG + Intergenic
1180292935 22:10860818-10860840 GGTGGATACCAGGCCCCAGGTGG + Intergenic
1180293033 22:10861289-10861311 GGTGGACATCAGGCCCCAGGTGG + Intergenic
1180456141 22:15513638-15513660 GGTGGACATCAGGCCCCAGGTGG - Intergenic
1180456336 22:15514595-15514617 GTTGGAAGTCAGGCCCCAGGTGG + Intergenic
1180456459 22:15515220-15515242 GGTGGATACCAGGCCCCAGGTGG + Intergenic
1180456556 22:15515691-15515713 GGTGGACATCAGGCCCCAGGTGG + Intergenic
1180495422 22:15888658-15888680 GGTGGACATCAGGCCCCAGGTGG - Intergenic
1180495619 22:15889615-15889637 GTTGGAAGTCAGGCCCCAGGTGG + Intergenic
1180495742 22:15890240-15890262 GGTGGATACCAGGCCCCAGGTGG + Intergenic
1180495838 22:15890711-15890733 GGTGGACATCAGGCCCCAGGTGG + Intergenic
1181047424 22:20222207-20222229 GGTGGAGGACACACGGCAGAGGG - Intergenic
1181459887 22:23079642-23079664 GGTGGAGCACAGGGCACAGGGGG + Intronic
1182322948 22:29490115-29490137 GGAGGAGGAGAAGCCCCAGGAGG + Exonic
1184552554 22:45212284-45212306 GCTGGAGGACACCTCCCAGGAGG + Exonic
1185249247 22:49791138-49791160 GGTGGGGGCCACGCCACAGCTGG - Intronic
951016623 3:17739513-17739535 GGTGGAGGACAAGCCCAGGCAGG + Intronic
953718120 3:45333264-45333286 AGGGGAGGACAACCCCCAGGTGG + Intergenic
954456216 3:50601136-50601158 GGTGGAGGACACGCCCCAGGGGG - Intergenic
956210595 3:66798090-66798112 GGTGGGGGACACGCCGCTGAGGG + Intergenic
962309235 3:134313635-134313657 GGTGGAGGACAGGGCCCCGAGGG + Intergenic
963039618 3:141059157-141059179 GGTACAGGGCAGGCCCCAGGAGG + Intronic
966532415 3:180995711-180995733 GGTTGAGGACAGGCCCAAGTAGG + Intergenic
968666074 4:1823047-1823069 GCTGGAGGCCACGCTGCAGGAGG - Exonic
968850653 4:3075245-3075267 GGGGAAGGCCTCGCCCCAGGAGG - Intronic
977206656 4:94170702-94170724 GGTGCAGGAGAGGACCCAGGGGG - Intergenic
979417526 4:120461359-120461381 GATGGAGGACACCTCCCAGCAGG + Intergenic
986174147 5:5337532-5337554 GGTGGGGGCAACACCCCAGGGGG + Intergenic
988497693 5:31758763-31758785 GGTGGAGAAAGCACCCCAGGTGG + Intronic
988870350 5:35382969-35382991 CGTGGAGCACATGACCCAGGTGG - Intergenic
992027140 5:72681488-72681510 GCTGGAGGACAAGCCCCACCAGG - Intergenic
992678482 5:79129474-79129496 GGTGAAAGACACCTCCCAGGAGG + Intronic
993111981 5:83668858-83668880 GGTTCAGGACACGCAGCAGGAGG + Intronic
996535531 5:124573187-124573209 AGTGGAGGACACTCCCCCTGAGG - Intergenic
998225422 5:140322942-140322964 GGGGGAACACAAGCCCCAGGAGG + Intergenic
998367375 5:141640002-141640024 GGTGGGGGACAGGACCCAGGGGG + Exonic
1001844042 5:174904812-174904834 ATGGGAGGACCCGCCCCAGGAGG - Intergenic
1001928626 5:175657652-175657674 GCTGGAGGACCTGCCCCGGGTGG - Intergenic
1002164173 5:177334341-177334363 GGTGGAGCACACGCCCGACGAGG - Exonic
1008027425 6:46653434-46653456 GGTGGAGGCCAGGCCCGCGGTGG + Intronic
1013793645 6:113860282-113860304 GCAGGAGGCCAAGCCCCAGGAGG + Exonic
1014818712 6:125961674-125961696 GGGAGAGGACACGCCTGAGGAGG - Intronic
1017015704 6:150097932-150097954 GCTGGAGGACACACACCATGGGG + Intergenic
1017524429 6:155230164-155230186 GGTGGAGGAGACCCACCTGGAGG - Intronic
1018927159 6:168214516-168214538 GGTGGAGAGCGAGCCCCAGGAGG - Intergenic
1020115776 7:5475600-5475622 GGGGGCAGACACTCCCCAGGGGG - Intronic
1020139163 7:5603380-5603402 GGTGGACTGCACGCCCCCGGTGG - Exonic
1023743754 7:43303250-43303272 GCTGGAGGCCAGGCTCCAGGAGG - Intronic
1023780110 7:43647496-43647518 GGAGGAGGTCAGGCCGCAGGCGG + Intronic
1025281285 7:57627766-57627788 GGTGGACATCAAGCCCCAGGTGG - Intergenic
1025303444 7:57837741-57837763 GGTGGACATCAAGCCCCAGGTGG + Intergenic
1026911339 7:74093485-74093507 GGTGGAGGACCGGCCTCATGGGG - Intronic
1027592718 7:80135367-80135389 GGGGGAGGAAGCGCCCGAGGAGG + Intronic
1033607838 7:142940413-142940435 GGTGGTGGACATGGCCCAGCAGG + Exonic
1034406259 7:150904438-150904460 GGTGGAGGATGCTTCCCAGGAGG + Intergenic
1035202668 7:157277240-157277262 GGGGAAGGACAGGCACCAGGAGG - Intergenic
1035243560 7:157547907-157547929 GGAGCAGGACACGCCCAGGGCGG - Intronic
1036748895 8:11430766-11430788 GCTGGAGGAGACGGCCAAGGCGG + Intronic
1037311161 8:17558251-17558273 GGTGAAGTAAACGGCCCAGGAGG - Intronic
1037739702 8:21598494-21598516 GGTGGGGGGCAAGCCCCAAGGGG + Intergenic
1039779973 8:40775416-40775438 GGTGGAGGAAACGTCTCAGCAGG + Intronic
1039880199 8:41620917-41620939 GGTGAAGGACACGTTCAAGGAGG + Exonic
1041045072 8:53880737-53880759 GGTGGAGGTCGCGCCCCGCGTGG + Intronic
1044973928 8:97644951-97644973 GGGGGAGGCCGCGCCCCAGCCGG + Intronic
1045173643 8:99697220-99697242 GCTGGAGGTCACGCTGCAGGAGG + Intronic
1049096943 8:140554191-140554213 TGGGGAGGAGACGCCCCGGGAGG - Intronic
1049222116 8:141432955-141432977 GGTGGGGGAGATGCCCCAGGTGG + Intergenic
1049411860 8:142477138-142477160 GCTGGAGCACACGCTCCACGGGG - Exonic
1049586519 8:143434955-143434977 GGTGGAGGAGCCGTGCCAGGAGG - Intergenic
1049774245 8:144397275-144397297 GGAGGAGGCCACGCGCCAGGGGG - Exonic
1049825113 8:144662891-144662913 GGTGGGGGATAGGCCCGAGGTGG - Intergenic
1052603792 9:30672280-30672302 GGTGGACACCAGGCCCCAGGTGG - Intergenic
1053150699 9:35740940-35740962 GGTGGAGACGATGCCCCAGGGGG - Exonic
1053206518 9:36190937-36190959 AGAGGAGGACAAGCGCCAGGAGG - Exonic
1053645493 9:40117484-40117506 GGTGGACATCAGGCCCCAGGTGG - Intergenic
1053760020 9:41345086-41345108 GTTGGAAGTCAGGCCCCAGGTGG - Intergenic
1053760221 9:41346043-41346065 GGTGGACATCAGGCCCCAGGTGG + Intergenic
1053761053 9:41350262-41350284 GGTGGACAATAGGCCCCAGGTGG + Intergenic
1054326511 9:63715385-63715407 GGTGGACATCAGGCCCCAGGTGG - Intergenic
1054539080 9:66258488-66258510 GGTGGACATCAGGCCCCAGGTGG + Intergenic
1056512208 9:87316704-87316726 GGTTGAGGAGGAGCCCCAGGAGG + Intergenic
1057022085 9:91707150-91707172 GGTGGAGGCCATGACCAAGGAGG - Intronic
1057800884 9:98191178-98191200 GGTGGAGAAGAGGCCCCATGGGG + Intronic
1059405233 9:114095124-114095146 GGGGGAGTGCACTCCCCAGGTGG - Exonic
1060529438 9:124339795-124339817 GGTGAAGGACAGGGCCCTGGTGG - Intronic
1061517966 9:131100546-131100568 GGGGGTGGACACGCAGCAGGAGG - Intronic
1061577201 9:131514465-131514487 GGTGGGGGACAGCACCCAGGAGG - Intronic
1061937635 9:133867065-133867087 GCAGGAGGACACGCCCCTGCAGG + Intronic
1062016317 9:134293041-134293063 GGTGAAGGTCAGGCCCCAGAGGG - Intergenic
1062172796 9:135144765-135144787 GGCGTAGGGCACGCCCCTGGGGG + Intergenic
1062267176 9:135692522-135692544 GGTGGCGGGCAGACCCCAGGGGG - Intergenic
1202793287 9_KI270719v1_random:100940-100962 GGTGGACATCAGGCCCCAGGTGG - Intergenic
1202793693 9_KI270719v1_random:102994-103016 GGTGGACATCAGGCCCCAGGTGG + Intergenic
1186713888 X:12229978-12230000 GGTAGAGGACACATCCAAGGTGG - Intronic
1190228067 X:48560870-48560892 GGCGCAGGACGCGCCCCAGGTGG - Exonic
1192728600 X:73778814-73778836 GGTGGAGCACAAGGCCAAGGAGG - Intergenic
1196258120 X:113546881-113546903 GGTGGCGGACACTCCCAAGATGG + Intergenic
1199679962 X:150217529-150217551 GGTGGGGGCCACACCCCAGCAGG - Intergenic
1200069264 X:153519733-153519755 CGTGCAGGGCACGGCCCAGGTGG - Intronic
1200214674 X:154362456-154362478 GGTCAAGTACACGCCCCGGGGGG - Exonic
1200962263 Y:9006460-9006482 GGTGGAGAAGACTCCCAAGGAGG + Intergenic
1201145609 Y:11063745-11063767 GCTGACGTACACGCCCCAGGAGG + Intergenic