ID: 954463284

View in Genome Browser
Species Human (GRCh38)
Location 3:50639814-50639836
Sequence GTGTAGAAGCAGAAGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 230}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954463284_954463295 29 Left 954463284 3:50639814-50639836 CCCAGCACCTTCTGCTTCTACAC 0: 1
1: 0
2: 1
3: 22
4: 230
Right 954463295 3:50639866-50639888 AATCACAAGGGAGGCACCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 230
954463284_954463290 17 Left 954463284 3:50639814-50639836 CCCAGCACCTTCTGCTTCTACAC 0: 1
1: 0
2: 1
3: 22
4: 230
Right 954463290 3:50639854-50639876 GCCCAGGGTGAGAATCACAAGGG 0: 1
1: 0
2: 0
3: 14
4: 177
954463284_954463293 20 Left 954463284 3:50639814-50639836 CCCAGCACCTTCTGCTTCTACAC 0: 1
1: 0
2: 1
3: 22
4: 230
Right 954463293 3:50639857-50639879 CAGGGTGAGAATCACAAGGGAGG 0: 1
1: 0
2: 2
3: 11
4: 197
954463284_954463288 2 Left 954463284 3:50639814-50639836 CCCAGCACCTTCTGCTTCTACAC 0: 1
1: 0
2: 1
3: 22
4: 230
Right 954463288 3:50639839-50639861 ACATTTCTCATAGATGCCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 171
954463284_954463289 16 Left 954463284 3:50639814-50639836 CCCAGCACCTTCTGCTTCTACAC 0: 1
1: 0
2: 1
3: 22
4: 230
Right 954463289 3:50639853-50639875 TGCCCAGGGTGAGAATCACAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
954463284_954463287 1 Left 954463284 3:50639814-50639836 CCCAGCACCTTCTGCTTCTACAC 0: 1
1: 0
2: 1
3: 22
4: 230
Right 954463287 3:50639838-50639860 TACATTTCTCATAGATGCCCAGG 0: 1
1: 0
2: 1
3: 27
4: 225
954463284_954463294 28 Left 954463284 3:50639814-50639836 CCCAGCACCTTCTGCTTCTACAC 0: 1
1: 0
2: 1
3: 22
4: 230
Right 954463294 3:50639865-50639887 GAATCACAAGGGAGGCACCAAGG 0: 1
1: 0
2: 1
3: 11
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954463284 Original CRISPR GTGTAGAAGCAGAAGGTGCT GGG (reversed) Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901278228 1:8009852-8009874 GTTGACAGGCAGAAGGTGCTAGG + Intronic
902444924 1:16456493-16456515 GTATAGAAGAAGGAGGTACTGGG - Intronic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
903968143 1:27102346-27102368 GTGTGGGAGCAGAAGCTGCCTGG + Intronic
904203655 1:28838353-28838375 TTGAAGAAGCAGAAGGAACTTGG + Intronic
904341941 1:29841177-29841199 GAGGAGAAGCATAAGGTGATTGG - Intergenic
904470140 1:30730867-30730889 GAGTAGAAAAAAAAGGTGCTTGG + Intergenic
904549322 1:31302286-31302308 ATATAGAAGAAGAAGGAGCTAGG - Intronic
904813522 1:33179549-33179571 GTTTGGAAGCAGAAGGTTTTTGG - Intronic
905010334 1:34742725-34742747 CTGTAGGGGCAGAAGCTGCTGGG - Intronic
905918023 1:41699330-41699352 GTGTAGAATGAGTAGGTTCTGGG - Intronic
907732336 1:57079356-57079378 GTGGACAAGCAAAAGGTACTTGG - Intronic
907826473 1:58021896-58021918 GTTCAGAAGCAGAAGGGGGTTGG + Intronic
914726031 1:150328506-150328528 TTGAAGAAGCAAAAGGTGCATGG + Intronic
915317059 1:155034565-155034587 GTGTGGAAGCAGAAAGTTCGGGG + Intronic
916765282 1:167854231-167854253 CTGTAGAGTCAGAAGGTTCTGGG - Intronic
918739957 1:188117074-188117096 GTGTAACAGTAGAAGGTGATGGG - Intergenic
919059212 1:192609220-192609242 CAGTAGCAGCAGATGGTGCTTGG - Intergenic
921827525 1:219690156-219690178 GAGTAGAAGCAGAAGATCCTTGG - Intronic
1063868601 10:10393840-10393862 GTGTATGAGCAGAAGCTGCCTGG + Intergenic
1065019631 10:21494057-21494079 GGGAAAAAGCAGAAGTTGCTGGG - Exonic
1065857893 10:29845110-29845132 GTGCAAAAGCAGAAGCTGCAAGG - Intergenic
1067074208 10:43164467-43164489 GTCTAGATGCAGATAGTGCTTGG + Intronic
1068871755 10:61952685-61952707 CTGTAGAAGCAGCAGCTACTTGG + Intronic
1070635065 10:78119041-78119063 GTGTATAAGAAAGAGGTGCTTGG + Intergenic
1073403298 10:103276430-103276452 TTGGAGAAGCAGGAGGCGCTGGG - Intergenic
1074519863 10:114209315-114209337 GTGAAGAAGCAGAAGCTGACTGG + Intronic
1075819817 10:125297229-125297251 GAGGAGAGGCTGAAGGTGCTGGG - Intergenic
1076422448 10:130340902-130340924 ATGTAGAAGCAGAGGGCGGTGGG - Intergenic
1076738180 10:132467996-132468018 GTGCATGAGCACAAGGTGCTGGG + Intergenic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1078238571 11:9509100-9509122 GTGAAGAAGCAGAGGTTGCTGGG + Intronic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1078643228 11:13115102-13115124 GTGCTGGAGCAGAAGCTGCTGGG - Intergenic
1080904831 11:36533060-36533082 GAGTAGCTGCAGAATGTGCTAGG + Intronic
1084316631 11:68349523-68349545 GTCTGGAAGCAGAACCTGCTGGG + Intronic
1084482911 11:69432413-69432435 GTGATGAGGGAGAAGGTGCTGGG - Intergenic
1084551689 11:69847303-69847325 GTGTAGAGGGAGAAGGGGCAGGG - Intergenic
1085698951 11:78729393-78729415 GTCTACAACCAGAAGGTGTTTGG - Exonic
1087237607 11:95737595-95737617 GGGATGAAGCAGAAGGTCCTGGG - Intergenic
1087992645 11:104764790-104764812 GTATCTAAACAGAAGGTGCTGGG + Intergenic
1089097574 11:115931884-115931906 GTGTAGAACTAGCAGGTGGTAGG - Intergenic
1089217548 11:116843928-116843950 GTGGAGAAGGACAAGGTGCATGG + Intronic
1089271094 11:117301752-117301774 GTGAAGAAGAGGAAGGTGTTAGG - Intronic
1091446761 12:548191-548213 GGGTAGATGCAGAAGGTGGGAGG - Intronic
1091514386 12:1164119-1164141 TGTTAGAAGCAGAAGCTGCTTGG + Intronic
1093509425 12:19908656-19908678 ATGTAGAAAAAGAAGGTGTTTGG - Intergenic
1094153494 12:27312580-27312602 TGGTAGAAGCAGATGGTGCCTGG + Exonic
1095832595 12:46603773-46603795 GTGTAGATGCAGGGGCTGCTGGG - Intergenic
1099616894 12:84947694-84947716 GTCTAGAAACAGAAGCTGATGGG + Intergenic
1102361993 12:112296138-112296160 GTGTAGGTGCAGCAGGTGGTAGG + Intronic
1102417544 12:112777354-112777376 ATGCAGAAGCAGAAGCTACTAGG - Intronic
1102867904 12:116388685-116388707 TAGTAGAAGCAGAAGGTTGTTGG + Intergenic
1103379043 12:120479631-120479653 CTGAAGAACCAGATGGTGCTAGG + Intronic
1108275396 13:48804261-48804283 GTGTAGAAAAATAAGGTGCTTGG - Intergenic
1108477138 13:50831466-50831488 GTGTGGAGTCAGAAGGGGCTGGG + Intronic
1110184812 13:72660408-72660430 GTGTACAAATAGAGGGTGCTTGG + Intergenic
1111370557 13:87311449-87311471 CTGTATAAGCAGAAAGTTCTAGG + Intergenic
1111899927 13:94188277-94188299 GTGCAGAAGGGGAAAGTGCTTGG - Intronic
1112590271 13:100757079-100757101 TGGCAGAAGCAGAAGGGGCTCGG + Intergenic
1113857073 13:113452906-113452928 TATTAGAAACAGAAGGTGCTAGG + Intronic
1118078557 14:62329960-62329982 GGGAAGAAGGAGAATGTGCTAGG + Intergenic
1119816223 14:77570815-77570837 GTGTAAAAGCAGATTTTGCTAGG - Intronic
1120788695 14:88559735-88559757 GTGTAGAAGCACTAGGGGATGGG - Intergenic
1121349218 14:93160356-93160378 TTGTAGAAACAGGTGGTGCTGGG - Intergenic
1121517121 14:94560159-94560181 GTGGAGAAGCAGCAGATGCTGGG + Intergenic
1121558470 14:94856521-94856543 GTGGAGCTGCAGAATGTGCTCGG - Intergenic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1122284295 14:100641731-100641753 GACTAGAAGCAGAAGATGCAGGG - Intergenic
1122783545 14:104153735-104153757 GTGTGGAAGCATCAGGGGCTGGG + Intronic
1123887587 15:24742162-24742184 ATGTAGAAGCAAGAGGGGCTAGG - Intergenic
1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG + Intronic
1127267209 15:57371972-57371994 GTGCAGAAGCTATAGGTGCTGGG + Intergenic
1127540273 15:59930837-59930859 GTGAAGATGGAGAAGGTGCAGGG - Intergenic
1129277368 15:74455350-74455372 GTTTATAAATAGAAGGTGCTTGG - Intronic
1129340975 15:74886482-74886504 GGGAAGAAGTAGAAGGTTCTAGG + Intergenic
1130145762 15:81272742-81272764 GTTCAGAAGCAGAAAGTGATTGG + Intronic
1131038735 15:89243324-89243346 GTTCAGAAGGCGAAGGTGCTCGG - Intergenic
1131853403 15:96566534-96566556 CTGTAGAAGGAGAGGGGGCTGGG - Intergenic
1132486117 16:192274-192296 GAGTAGAAGCAGCAGGACCTTGG - Intronic
1132907801 16:2292191-2292213 GAGAAGAAGCAGAAAGAGCTGGG - Exonic
1133056857 16:3149707-3149729 GTGTGCGAGCAGGAGGTGCTGGG + Exonic
1134072184 16:11267203-11267225 GCATAGAATCTGAAGGTGCTGGG - Intronic
1134197959 16:12173631-12173653 CTCCAGAAGCAGAAGGTGTTTGG - Intronic
1134643149 16:15845426-15845448 GTATAGAAACAGAAGGTACTTGG - Intronic
1137377518 16:47965760-47965782 GTGGAGCTGCAGAAGGGGCTGGG - Intergenic
1139292174 16:65868953-65868975 AGGTAGAGACAGAAGGTGCTTGG + Intergenic
1139446540 16:67001719-67001741 GTGGAGAGGCAGAAGGTGCTGGG - Intronic
1139458876 16:67106607-67106629 CAATAGAAGCAGAAGGTGCCTGG - Intergenic
1141660494 16:85438773-85438795 GTGAAGAAGCAAAGGGTGCTGGG + Intergenic
1141874977 16:86818036-86818058 GTGCAAAAGCAGAAGCTTCTAGG + Intergenic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1147637364 17:41972269-41972291 CTGCAGAAGGCGAAGGTGCTTGG - Intronic
1148587691 17:48792431-48792453 GTGTGGAAGGAGGAGGTGCAGGG + Intronic
1148695742 17:49556945-49556967 GTGTGGGAGCAGAGGGTGCTGGG - Intergenic
1150391006 17:64789904-64789926 GTGCAGAAGCAGGTGGTGGTGGG + Intergenic
1150409788 17:64933958-64933980 GTGCAGAAGCAGGTGGTGGTGGG + Intergenic
1150621566 17:66811770-66811792 GTGTGGATGCAGAGTGTGCTGGG - Intergenic
1152596462 17:81240019-81240041 GTGAAGACCCGGAAGGTGCTGGG - Intronic
1156653129 18:39251597-39251619 GTGGAGATGCAGGAGCTGCTGGG - Intergenic
1158426042 18:57340422-57340444 GTGAAAAGGCAGAAGGAGCTGGG - Intergenic
1158695677 18:59701219-59701241 CTGTATAAGCAGAAAGTCCTGGG + Intergenic
1158931881 18:62330743-62330765 GTGCAGGGGCAGAAGGTGCAGGG + Intronic
1160544657 18:79644856-79644878 GTCGAGAAGCAGATGGTTCTCGG - Intergenic
1160764274 19:800401-800423 CTGGAGAAGAAGAAGGTCCTGGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162244209 19:9385745-9385767 GTGTAGCAACAGCTGGTGCTGGG + Intergenic
1163251125 19:16127011-16127033 GTGTCAAAGCAGAAGGTCCCAGG + Intronic
1164089438 19:21934918-21934940 GTGAAGAAGCATAAGGTTCTGGG + Intronic
1165144801 19:33724313-33724335 GTGCAGAAGGGGAAGGTGCTGGG + Intronic
1165991987 19:39821111-39821133 GAGTAGAAGCAGAATCTGCCAGG + Intergenic
1166388880 19:42397765-42397787 TTGGAGGAGCAGAAGGTGCCAGG + Intergenic
925339795 2:3128173-3128195 ATGTTCAAGAAGAAGGTGCTGGG - Intergenic
926647989 2:15310738-15310760 GTTTAGAGGCAGAAGGAGCCAGG - Intronic
927081954 2:19639343-19639365 TTGTAGAAGCAGAGAGTGTTGGG - Intergenic
927848423 2:26484173-26484195 GTATAGCAGCAGGAAGTGCTGGG - Intronic
929771916 2:44899413-44899435 GTGCAGAAGCAGCAGCTCCTTGG + Intergenic
929827426 2:45319998-45320020 GGGTAGAAGCAAAAAGTGCCGGG - Intergenic
931368490 2:61640274-61640296 GTGTAAAAACAGAAGGTGTTGGG + Intergenic
933269948 2:80222586-80222608 GTGAAGAAGAAAAAAGTGCTTGG - Intronic
934731614 2:96662054-96662076 GTGTGGAAGAAGAAGGGGCATGG + Intergenic
935515988 2:104039541-104039563 GTGTCCAAGCAGAAGCTGCAGGG + Intergenic
935823040 2:106913618-106913640 CTGTATAAGCAGAAAGTTCTAGG + Intergenic
936122023 2:109755209-109755231 GTGTAGAAGTACAAGTGGCTTGG - Intergenic
936142307 2:109950844-109950866 GTGTGGAAATAGAAGCTGCTGGG + Intergenic
936178997 2:110248803-110248825 GTGTGGAAATAGAAGCTGCTGGG + Intergenic
936202381 2:110420629-110420651 GTGTGGAAATAGAAGCTGCTGGG - Intronic
936222671 2:110616265-110616287 GTGTAGAAGTACAAGTGGCTTGG + Intergenic
945374013 2:209057855-209057877 GTGTACTGGGAGAAGGTGCTGGG + Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
948072166 2:235136282-235136304 GTGTTGAAACATAAGCTGCTCGG - Intergenic
948489852 2:238305568-238305590 GTGTAGAAAGAGAAGTGGCTTGG - Intergenic
948660160 2:239501973-239501995 GTGCTGGAGCAGAAGGAGCTGGG - Intergenic
1170920096 20:20669923-20669945 GTGTAGAAACACAAGGTACTTGG - Intronic
1173026176 20:39309588-39309610 GTGCAGAAGCAGAAGCTGTTTGG + Intergenic
1173255574 20:41392355-41392377 GTGCAGCAGGAGAGGGTGCTGGG + Intergenic
1173302713 20:41818092-41818114 GGGCAGAAGCAGAAGGATCTCGG - Intergenic
1173432060 20:42997171-42997193 GTGTAGAAGCAAATGGGGGTGGG - Intronic
1174170077 20:48611872-48611894 ATGTAGAGGCAGATGGTTCTTGG - Intergenic
1178630877 21:34260408-34260430 GACTAGAAACAGAAGGTGCAAGG - Intergenic
1178982481 21:37276591-37276613 ATGTAAAAGCAGAAGTTGCCAGG - Intergenic
1179003873 21:37491958-37491980 GATTAGAATCAGAAGGTGGTAGG + Intronic
1180254021 21:46610233-46610255 GTGGACATGCAGAAGGAGCTGGG - Intergenic
1180559689 22:16605625-16605647 GTACAGAAGCAGCAGGTGGTAGG + Intergenic
1180713730 22:17857595-17857617 ATGTAGAAGCACAAAGAGCTGGG + Intronic
1182546583 22:31080278-31080300 GTCTGGACTCAGAAGGTGCTGGG + Intronic
1183483633 22:38077949-38077971 GTGTAGAGACACAAGGGGCTGGG - Intergenic
1183739842 22:39663416-39663438 GGGCAGAAGCAGAGGGTACTAGG + Intronic
1183981270 22:41541928-41541950 GTGGAGCATCAGAAGGTGATGGG - Intronic
1184128866 22:42505377-42505399 GCGTGGAAGCAGCATGTGCTTGG - Intergenic
1184137661 22:42558692-42558714 GCGTGGAAGCAGCATGTGCTTGG - Intronic
949891991 3:8740174-8740196 TCCTAAAAGCAGAAGGTGCTAGG + Intronic
951558176 3:23942307-23942329 TTGTGGAGGCAGGAGGTGCTTGG - Intronic
952110145 3:30113345-30113367 ATGGAGAATGAGAAGGTGCTAGG - Intergenic
953187104 3:40648267-40648289 GTGTAAAACCAGATGGTGCTTGG + Intergenic
953946439 3:47152543-47152565 TTGAAGAAGCAGAAGATGCTAGG - Intronic
954463284 3:50639814-50639836 GTGTAGAAGCAGAAGGTGCTGGG - Intronic
954801090 3:53187278-53187300 GAGGAGAAGCAGAGGCTGCTCGG + Intronic
954995292 3:54875689-54875711 GTGCTGAAGCAGAAGCTCCTTGG - Intronic
955046300 3:55363548-55363570 GTGGGGAAGCATAAGGTGCTAGG - Intergenic
955281293 3:57597162-57597184 GGGCAGAAGCAGAAGGGGTTTGG + Exonic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
961574604 3:127824040-127824062 GTGTAAAAGCAGATGGTGCATGG + Intergenic
961591393 3:127984394-127984416 GTGAAGAAGCAGTGTGTGCTGGG + Exonic
963124677 3:141804173-141804195 GTGTGCAAGCTGAAGGTGCAAGG - Intronic
967138685 3:186534249-186534271 GTTGAGAAGCAGAAGTTGCACGG + Intergenic
967326079 3:188241162-188241184 CTCTAGGAGCAGAAGGTGGTGGG + Intronic
967982001 3:195071332-195071354 GTGATGAAGCAGAAGGTACGGGG + Intronic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968943588 4:3652110-3652132 GTGCAGAAGCACAAGGGGCAAGG - Intergenic
968954682 4:3712206-3712228 GGGGAGAAGCAGAGGGTGTTGGG - Intergenic
971228190 4:24774657-24774679 GAGTAGAATCACAAGGTCCTAGG + Intergenic
972103617 4:35453617-35453639 GTGTAACAGCAGAAGTTGGTAGG + Intergenic
972797558 4:42437108-42437130 GAGCAGAAACAGATGGTGCTCGG + Intronic
973039488 4:45452662-45452684 ATGTAGAAACAGAAGCTACTGGG - Intergenic
976161961 4:82211136-82211158 GGGTGGAAGGGGAAGGTGCTGGG + Intergenic
977719674 4:100224538-100224560 GTATAGATGCAGAGGCTGCTGGG + Intergenic
978508356 4:109485931-109485953 GTGGAGAATCAGAAGTTACTGGG + Intronic
979790951 4:124780662-124780684 GGGCAGAAGCACCAGGTGCTTGG - Intergenic
980262615 4:130471815-130471837 CTCTAGTAGCAGAAGGTGGTCGG - Intergenic
981280893 4:142956772-142956794 GTGTTGGAGAAGAAGCTGCTGGG - Intergenic
983686860 4:170420676-170420698 ATGTACAAGCTGAAGGGGCTGGG - Intergenic
984652607 4:182286550-182286572 CTGTAGATGCAGAAGGTTGTGGG + Intronic
985302237 4:188503188-188503210 AGGTAAAAGCATAAGGTGCTGGG + Intergenic
985648020 5:1094120-1094142 TTTTAGAAGAAGAAGGTGCCAGG - Intronic
986250937 5:6058232-6058254 GTGGAGAAGCAGCACGGGCTTGG - Intergenic
986409932 5:7467317-7467339 GTGTAGGAGAAGAGGGAGCTTGG - Intronic
986557452 5:9025796-9025818 GTGTCTCAGCAGTAGGTGCTGGG - Intergenic
986652595 5:9979431-9979453 GTGGAGAGGCAGGAGGTGGTGGG - Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
990809523 5:59706784-59706806 GTGCATAAGGAGAAGGAGCTCGG - Intronic
992671123 5:79062177-79062199 GAGGAGAAGAAGGAGGTGCTAGG - Intronic
993841903 5:92890393-92890415 GTGGAGCAGAAGAAGCTGCTTGG - Intergenic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
997280708 5:132642971-132642993 ATGTAGGAGAAGAAGGTGGTGGG - Exonic
999991006 5:157049784-157049806 ATGCAGATGCAGAAGGAGCTGGG - Intronic
1001007083 5:168062093-168062115 GTGGTGAAGCAGAAGTTGGTCGG + Exonic
1004784741 6:18955121-18955143 ATGAAGAAGGAGAAGGGGCTGGG - Intergenic
1007681097 6:43633973-43633995 GTGTAGAATGAGAATGGGCTAGG - Intronic
1008603221 6:53116074-53116096 CTGTAGTAGCAGAAGGCGCCAGG - Intergenic
1010767547 6:79793340-79793362 ATCTAAAAGCAGAAGGTGTTAGG - Intergenic
1011049991 6:83135786-83135808 GTGTACAAGCAGAACGTTATTGG + Exonic
1011726825 6:90218278-90218300 GTTTAAAAGAAGAAGGTGTTGGG - Intronic
1015356649 6:132285279-132285301 GTGGAAAAGCACAAGGTGTTAGG - Intergenic
1015517553 6:134099101-134099123 GTGTGGAAGAAGAAGGTCCAAGG - Intergenic
1015538750 6:134293917-134293939 GTGTACATCCAGAAGGTGCTAGG + Intronic
1017166320 6:151411486-151411508 CAGTAGAGGCAGAAGGGGCTTGG + Intronic
1018371826 6:163175559-163175581 GTGTAAAAGCTCTAGGTGCTGGG + Intronic
1018931234 6:168241724-168241746 GTGCAAAAGCAGAAGGTGCCAGG + Intergenic
1019109501 6:169698593-169698615 GGGAAGAAGCAGAAAGAGCTTGG - Intronic
1022474185 7:30699624-30699646 GTGGATAAGCAGAGGGTTCTGGG - Intronic
1028741215 7:94278052-94278074 GTATGGAAGCAGAAGTTGCAGGG + Intergenic
1029304299 7:99607434-99607456 GGGCAGATGCAGAGGGTGCTAGG + Intronic
1029524814 7:101088114-101088136 GCCCAGAAGCAGGAGGTGCTGGG + Exonic
1029877675 7:103771224-103771246 TTTTACAAGCAGAAGGTGATTGG - Intronic
1030484327 7:110147868-110147890 GTGTAGAAACAGAAAGTGAATGG + Intergenic
1030655060 7:112158306-112158328 ATGTATAAGCAATAGGTGCTAGG - Intronic
1031065383 7:117099075-117099097 AAGAAGAAGAAGAAGGTGCTTGG + Intronic
1031850263 7:126854549-126854571 ATGTAGAAGCAGCTGGTGCTGGG + Intronic
1034257492 7:149732671-149732693 GAGTAAAAGCAGAAGGGGGTGGG + Intronic
1034374368 7:150629603-150629625 GTGCACAAGCAGAATGTACTTGG - Intronic
1034617549 7:152432181-152432203 GTACAGAAGCAGCAGGTGGTAGG - Intronic
1034961032 7:155364548-155364570 GCAGAGAAGCAGAAGGTGCTGGG - Intronic
1037580787 8:20245030-20245052 GAATAGAAGTAGAAGCTGCTAGG + Intergenic
1039565927 8:38552687-38552709 CTTTAGAAGCAGAAGGTGTTAGG - Intergenic
1042514043 8:69641401-69641423 GTGAATAACGAGAAGGTGCTGGG + Intronic
1045252890 8:100496128-100496150 GAGTGGAAGGAGAAGGGGCTGGG + Intergenic
1045300125 8:100903621-100903643 GTGGAGAAGCAGAGGGCGATAGG - Intergenic
1045749101 8:105460126-105460148 GTATAGGAGCAGAAGCTGTTTGG + Intronic
1046026953 8:108736036-108736058 GTTTAAAAGCAGAAAATGCTTGG - Intronic
1046291992 8:112174577-112174599 TTGAAGAAGCACTAGGTGCTGGG - Intergenic
1048327972 8:133453269-133453291 GTGCAGAAGCAGATGGGCCTTGG + Intergenic
1048468098 8:134684171-134684193 GTGGATGGGCAGAAGGTGCTGGG - Intronic
1048972124 8:139651034-139651056 GGGAAGAAGCAGAAGGGGGTGGG - Intronic
1049223937 8:141440803-141440825 GGGTAGAAGCAGATGCCGCTGGG - Intergenic
1049802637 8:144525277-144525299 GTGGAGAAGGAGAAGGTGACAGG - Intronic
1051493941 9:17697769-17697791 TTGCAGAAGCAGAAAATGCTAGG + Intronic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1056698062 9:88877766-88877788 ATGTAGAAGGATAGGGTGCTAGG - Intergenic
1057225375 9:93290102-93290124 GTGCGGATGCAGAAGGTTCTGGG - Intronic
1058058651 9:100473593-100473615 GTGTAGCAGCAGAAGGCGAGCGG - Exonic
1059424299 9:114211108-114211130 GGGGAGAAGCAGAAGATGCCAGG - Intronic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1062198887 9:135290282-135290304 CTGTGGAAACAGAAGGTCCTTGG - Intergenic
1189865813 X:45325907-45325929 GGGTGAAAACAGAAGGTGCTGGG + Intergenic
1192549006 X:72038960-72038982 TTGTAGAAGCAGAAGTGGATTGG + Intergenic
1192631614 X:72781929-72781951 ATGGAGCAGCAGAAGGGGCTTGG + Intronic
1192650095 X:72938872-72938894 ATGGAGCAGCAGAAGGGGCTTGG - Intronic
1192890289 X:75383475-75383497 GTGCAGAAGCAGAAGGTATAAGG - Intronic
1194828936 X:98596931-98596953 GTGCAGAAGCAAAATGTGTTGGG - Intergenic
1198036660 X:132807772-132807794 GACTAAAAGCAGAGGGTGCTGGG + Intronic
1201868068 Y:18676256-18676278 GTGTAGAAACAGCAGGTGTATGG - Intergenic