ID: 954466178

View in Genome Browser
Species Human (GRCh38)
Location 3:50656338-50656360
Sequence ATTCTGTCCTGGGTGGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954466178_954466184 -7 Left 954466178 3:50656338-50656360 CCACTGACCACCCAGGACAGAAT No data
Right 954466184 3:50656354-50656376 ACAGAATGAGTCCAGGGCTCAGG No data
954466178_954466190 28 Left 954466178 3:50656338-50656360 CCACTGACCACCCAGGACAGAAT No data
Right 954466190 3:50656389-50656411 GATGTGAATCAGCCCCCACCTGG No data
954466178_954466185 -3 Left 954466178 3:50656338-50656360 CCACTGACCACCCAGGACAGAAT No data
Right 954466185 3:50656358-50656380 AATGAGTCCAGGGCTCAGGATGG No data
954466178_954466187 2 Left 954466178 3:50656338-50656360 CCACTGACCACCCAGGACAGAAT No data
Right 954466187 3:50656363-50656385 GTCCAGGGCTCAGGATGGGTTGG No data
954466178_954466186 -2 Left 954466178 3:50656338-50656360 CCACTGACCACCCAGGACAGAAT No data
Right 954466186 3:50656359-50656381 ATGAGTCCAGGGCTCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954466178 Original CRISPR ATTCTGTCCTGGGTGGTCAG TGG (reversed) Intergenic
No off target data available for this crispr