ID: 954467146

View in Genome Browser
Species Human (GRCh38)
Location 3:50662310-50662332
Sequence CTAATCAGGAGTCCCGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954467142_954467146 -10 Left 954467142 3:50662297-50662319 CCTGTAGTCCCAGCTAATCAGGA 0: 249
1: 43813
2: 163561
3: 222894
4: 210961
Right 954467146 3:50662310-50662332 CTAATCAGGAGTCCCGAGGCAGG No data
954467140_954467146 9 Left 954467140 3:50662278-50662300 CCAGGTGTGGTGGCACATGCCTG 0: 3478
1: 17987
2: 56069
3: 123305
4: 203360
Right 954467146 3:50662310-50662332 CTAATCAGGAGTCCCGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954467146 Original CRISPR CTAATCAGGAGTCCCGAGGC AGG Intergenic
No off target data available for this crispr