ID: 954467653

View in Genome Browser
Species Human (GRCh38)
Location 3:50665897-50665919
Sequence TGGGGTATGAACTGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954467653_954467662 27 Left 954467653 3:50665897-50665919 CCCTCCTCACAGTTCATACCCCA No data
Right 954467662 3:50665947-50665969 TTAACAGAGTTACTATGGGTTGG No data
954467653_954467660 22 Left 954467653 3:50665897-50665919 CCCTCCTCACAGTTCATACCCCA No data
Right 954467660 3:50665942-50665964 TTGAATTAACAGAGTTACTATGG No data
954467653_954467661 23 Left 954467653 3:50665897-50665919 CCCTCCTCACAGTTCATACCCCA No data
Right 954467661 3:50665943-50665965 TGAATTAACAGAGTTACTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954467653 Original CRISPR TGGGGTATGAACTGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr