ID: 954468866

View in Genome Browser
Species Human (GRCh38)
Location 3:50674941-50674963
Sequence GAGCCGAGCCGCGGCGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954468861_954468866 -4 Left 954468861 3:50674922-50674944 CCTGCGAGCCCGCTGGGGCGAGC No data
Right 954468866 3:50674941-50674963 GAGCCGAGCCGCGGCGGCGCCGG No data
954468855_954468866 30 Left 954468855 3:50674888-50674910 CCTGCGCGGCAGGGAGTGGCGCA No data
Right 954468866 3:50674941-50674963 GAGCCGAGCCGCGGCGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954468866 Original CRISPR GAGCCGAGCCGCGGCGGCGC CGG Intergenic