ID: 954468938

View in Genome Browser
Species Human (GRCh38)
Location 3:50675207-50675229
Sequence GTCCCCGCCGCGTTGTCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 29}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954468925_954468938 23 Left 954468925 3:50675161-50675183 CCGTCCCCGCCTCGACTCGCGGT 0: 1
1: 0
2: 1
3: 4
4: 47
Right 954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
954468934_954468938 -9 Left 954468934 3:50675193-50675215 CCGGGCCCGCGGCCGTCCCCGCC 0: 1
1: 2
2: 7
3: 99
4: 860
Right 954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
954468926_954468938 19 Left 954468926 3:50675165-50675187 CCCCGCCTCGACTCGCGGTGCGC 0: 1
1: 0
2: 0
3: 4
4: 30
Right 954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
954468923_954468938 28 Left 954468923 3:50675156-50675178 CCTGACCGTCCCCGCCTCGACTC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
954468927_954468938 18 Left 954468927 3:50675166-50675188 CCCGCCTCGACTCGCGGTGCGCC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
954468928_954468938 17 Left 954468928 3:50675167-50675189 CCGCCTCGACTCGCGGTGCGCCA 0: 1
1: 0
2: 0
3: 1
4: 16
Right 954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
954468929_954468938 14 Left 954468929 3:50675170-50675192 CCTCGACTCGCGGTGCGCCACAG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 29
954468933_954468938 -3 Left 954468933 3:50675187-50675209 CCACAGCCGGGCCCGCGGCCGTC 0: 1
1: 0
2: 0
3: 24
4: 271
Right 954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954468938 Original CRISPR GTCCCCGCCGCGTTGTCGCC CGG Intergenic
1062970520 10:1644615-1644637 GTCCACTCCGCGTAGGCGCCTGG - Intronic
1085022458 11:73218167-73218189 GACCCCGCGGCCTTGTCGCTGGG + Intergenic
1093707280 12:22288481-22288503 GTCCCAGCCTCATTGTTGCCAGG + Intronic
1100632138 12:96399946-96399968 GTCCGCGCCGCGCTTTCCCCTGG - Intronic
1102573767 12:113843392-113843414 CTCCCCACCTCATTGTCGCCTGG - Intronic
1113539311 13:111093924-111093946 GTCCCAGCCCCCATGTCGCCTGG + Intergenic
1118607448 14:67514540-67514562 GACCCCGCCGCCTTCTCCCCAGG - Intronic
1121127438 14:91417395-91417417 GACCCCGCCGCGCTTTCGGCCGG - Intronic
1124121663 15:26893753-26893775 GTGCCCACCGCCTGGTCGCCGGG - Intronic
1136625413 16:31459141-31459163 GTCCCCGCCGAGTGCACGCCGGG + Exonic
1148471325 17:47895650-47895672 GTCCCTCTCTCGTTGTCGCCTGG - Intergenic
1155218269 18:23662429-23662451 GTCCCCGCCGCCCCGTCGCCGGG + Intronic
1161384673 19:3984686-3984708 GCCCCCTCCACGTTGTCACCGGG + Intronic
1161428180 19:4216074-4216096 CTCCCAGCCGCCTTGTCCCCTGG + Intronic
1171417491 20:24992844-24992866 GTCCCCGGCGCGTCGTTGCTCGG + Exonic
1181085297 22:20436948-20436970 ATCCCCACCTGGTTGTCGCCAGG + Intronic
953657225 3:44863307-44863329 CCCCCCGCCGCCTTGTCTCCAGG + Intronic
954468938 3:50675207-50675229 GTCCCCGCCGCGTTGTCGCCCGG + Intergenic
969295836 4:6270256-6270278 GTCCCCCGCGCGCTGTCGCCTGG + Intronic
985073621 4:186191689-186191711 CTCCCCGCTGCGGGGTCGCCCGG - Exonic
988949357 5:36241723-36241745 GTCCCCGCAGCGCCGCCGCCCGG + Exonic
998071073 5:139198341-139198363 GTCGCCGCCGCGTTTGCGCAGGG - Exonic
998849433 5:146339344-146339366 GTCTCCCCCGCGTTCTCTCCCGG + Intronic
1002189925 5:177473019-177473041 GTCCCCGCCCCGTCCCCGCCCGG + Exonic
1005676583 6:28161648-28161670 GTCCCCGCCGCGGTGTAGGCAGG - Intergenic
1005900533 6:30213407-30213429 GTCCCCGCCCCGTAATCTCCCGG + Intronic
1007967503 6:46015916-46015938 GTCCCCGCCGCGTCCCCGCCCGG - Intronic
1017110238 6:150925246-150925268 TCCCCCGCCGCGTGGTCTCCCGG + Intronic
1041355243 8:56993431-56993453 GGCCCCGCCGCGCCGCCGCCAGG + Exonic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1056746929 9:89311199-89311221 GTCTCCGGCGAGTTGTTGCCTGG + Exonic
1056787970 9:89606072-89606094 GTCCCCGCCGGGCTGTCACTCGG - Exonic
1059021258 9:110579368-110579390 CTCCCCGCCGCTTCGTCGCCAGG + Exonic
1195589826 X:106611794-106611816 GTGCCCGCCGGGTTGCCGTCTGG - Intergenic
1200147633 X:153934838-153934860 GTCCGCGCCGCGTGGGCGCCGGG - Intronic
1201065734 Y:10092656-10092678 GTCCCGCCCGGGTTGTAGCCAGG + Intergenic