ID: 954470074

View in Genome Browser
Species Human (GRCh38)
Location 3:50686266-50686288
Sequence AAACTCTGCTGCACAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954470073_954470074 -10 Left 954470073 3:50686253-50686275 CCATCACTGCAGAAAACTCTGCT 0: 1
1: 0
2: 13
3: 63
4: 416
Right 954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG 0: 1
1: 0
2: 6
3: 46
4: 242
954470072_954470074 10 Left 954470072 3:50686233-50686255 CCTTAATCTCGCTTTGGTTGCCA 0: 1
1: 0
2: 1
3: 12
4: 101
Right 954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG 0: 1
1: 0
2: 6
3: 46
4: 242
954470070_954470074 20 Left 954470070 3:50686223-50686245 CCAGTCAATGCCTTAATCTCGCT 0: 1
1: 0
2: 0
3: 6
4: 67
Right 954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG 0: 1
1: 0
2: 6
3: 46
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954470074 Original CRISPR AAACTCTGCTGCACAAAAAT AGG Intronic
900006573 1:58917-58939 AAACTCAGTTGCATAAAAAAGGG - Intergenic
903867092 1:26407861-26407883 AAACTCCTCTTCAGAAAAATGGG - Intergenic
905909669 1:41645186-41645208 AAGCTCTGCTGCACAAGACAGGG + Intronic
906901288 1:49839334-49839356 AAATTCTGCTGGAGAAATATTGG - Intronic
907087165 1:51686135-51686157 AGCCTCTGGTGCATAAAAATGGG + Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
913249544 1:116901147-116901169 AAACGCTGCAGCACAAGGATGGG + Intergenic
913383621 1:118235826-118235848 AAACTATGCTGTACAACAAATGG + Intergenic
916211872 1:162366332-162366354 TAGTTCTGCTGCAGAAAAATGGG + Intronic
917863261 1:179169176-179169198 AAACCCTTTTGCCCAAAAATGGG + Intronic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
922122558 1:222687029-222687051 AAATTCTTCTACACAAAAAAAGG + Exonic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
924576978 1:245289706-245289728 CAACTCTCCTGCAGAAAAATTGG - Intronic
1063583446 10:7330095-7330117 AATCTCGGCTGCCCAAAGATTGG + Intronic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1066415485 10:35217478-35217500 AAGCTATGCTGCACAAAAGCTGG - Intergenic
1066500594 10:35990226-35990248 AAATTCTGCTCTTCAAAAATGGG + Intergenic
1066628487 10:37434481-37434503 AAATTCTGCTCTTCAAAAATGGG + Intergenic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1069190362 10:65479891-65479913 AAATTTTGCTGCACAGAAAAAGG + Intergenic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1072463641 10:95642953-95642975 AAATTATGCTGTACTAAAATTGG - Intronic
1074628204 10:115218278-115218300 AAACTCTGCTCCACGAAGACAGG + Intronic
1075625071 10:123958130-123958152 AAAATCTTCTCCACAAATATTGG - Intergenic
1077025588 11:438524-438546 AGACTCTGCTGCAGAACACTGGG + Intronic
1078591323 11:12642650-12642672 AACCTCTGCCCCCCAAAAATTGG + Intergenic
1078784908 11:14480192-14480214 AAATTTTGCTGCACATAAAATGG - Intronic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080333063 11:31163886-31163908 AAACACTGTTGCTCACAAATAGG - Intronic
1080682233 11:34487603-34487625 TAACTCTGCTGCCCACAAAGTGG + Intronic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1083686126 11:64376397-64376419 GGTCACTGCTGCACAAAAATGGG + Intergenic
1084120567 11:67066608-67066630 AAACTCTGAGGCAAAAAACTAGG + Intronic
1084812439 11:71621928-71621950 AAACTCTGATTCAAAAAAAAAGG - Intergenic
1085027781 11:73247510-73247532 GGACTGTGCTGCACAAAGATGGG + Intergenic
1086218664 11:84414427-84414449 AATCCCTACAGCACAAAAATAGG - Intronic
1087248348 11:95867576-95867598 CAGCTCTGCTGGACAAAGATAGG - Intronic
1087531024 11:99382326-99382348 GAAATCTGCTGGACAGAAATTGG + Intronic
1089753564 11:120669209-120669231 AAAAAATGCTGCACAGAAATGGG - Intronic
1089807098 11:121100373-121100395 AAACTCTTCTGCACATCAATGGG - Intergenic
1090996851 11:131874208-131874230 CACCTCTCCTGCACACAAATGGG + Intronic
1091020931 11:132099177-132099199 AAACTCTGCTGACCAAGAAAGGG + Intronic
1093526696 12:20111913-20111935 AAAAGCTGTTGGACAAAAATGGG + Intergenic
1093909633 12:24731399-24731421 AAACCCTGCTGTTGAAAAATAGG + Intergenic
1094402320 12:30075277-30075299 AAAATCTTCTGAAGAAAAATTGG - Intergenic
1094626731 12:32131614-32131636 CAACTCTGTTGCACAAAAAGGGG + Intronic
1096139832 12:49233865-49233887 AAACTCTGCAACATAAAAAGAGG + Intronic
1097572069 12:61346335-61346357 ATTCTCTGCAGCACCAAAATGGG + Intergenic
1104589100 12:130070133-130070155 GAACTCTGCTGCACTTAAAGGGG - Intergenic
1105710411 13:23002699-23002721 AAACATTACTACACAAAAATAGG + Intergenic
1106061987 13:26302352-26302374 AAACTCAAATGCAAAAAAATTGG - Intronic
1106343188 13:28850949-28850971 ACACTCAGCTGCACACAAAAAGG - Intronic
1106623352 13:31393034-31393056 ACACTTTGCTTCACAAAGATAGG + Intergenic
1107030802 13:35851691-35851713 TAACTCTGCTTCGGAAAAATAGG + Intronic
1109031743 13:57199436-57199458 CAACTCAGCTGCAGAAGAATAGG - Intergenic
1110639583 13:77806720-77806742 AAACTTTGCTTCACAAACTTGGG - Intergenic
1112780873 13:102899469-102899491 AAATTCTGGTAGACAAAAATTGG - Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1115108284 14:29788158-29788180 AAACTCTCCTTCAAAAATATAGG - Intronic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1116271562 14:42775832-42775854 AAACACTGCTGATCAAAACTGGG + Intergenic
1118003670 14:61546022-61546044 AAACAATGCTGCAAAAAACTTGG - Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1119739188 14:77003143-77003165 ATCCTCTGCTGCAGAGAAATGGG - Intergenic
1120127801 14:80767045-80767067 AAACTATCCTGAACAAAAATTGG + Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1127231025 15:56995477-56995499 AAACACTGCTGAAAGAAAATCGG - Intronic
1127817771 15:62626989-62627011 AAACTCTGCTCCGCTAAAATAGG + Intronic
1128630043 15:69255630-69255652 AAACTTTTCAGCACAAAAAAAGG - Intronic
1128745162 15:70109039-70109061 AAAATCTGTTGCACAACAACAGG + Intergenic
1129036358 15:72651634-72651656 AAATTATCCTGCAGAAAAATTGG + Intergenic
1129213529 15:74085591-74085613 AAATTATCCTGCAGAAAAATTGG - Intergenic
1129396871 15:75255494-75255516 AAATTATCCTGCAGAAAAATTGG + Intergenic
1129400483 15:75279772-75279794 AAATTATCCTGCAGAAAAATTGG + Intronic
1129474100 15:75772475-75772497 AAATTATCCTGCAGAAAAATTGG + Intergenic
1129730662 15:77929912-77929934 AAATTATCCTGCAGAAAAATTGG - Intergenic
1130509370 15:84575708-84575730 AAATTATCCTGCAGAAAAATTGG - Intergenic
1130555454 15:84919240-84919262 AAAATATGCTGCACAAAACTAGG + Intronic
1131036893 15:89228468-89228490 AAAAAATGCTCCACAAAAATGGG + Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1132446948 15:101932040-101932062 AAACTCAGTTGCATAAAAAAGGG + Intergenic
1137630416 16:49939395-49939417 AAACTCTGTCGCAAAAAAAAAGG + Intergenic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1138608030 16:58101135-58101157 AAACTCTGTTTCAAAAAAAAGGG - Intergenic
1140601045 16:76475264-76475286 AAACTCTGCTCCCCAAAGATAGG + Intronic
1140666140 16:77229436-77229458 AAACTCTGTTTCAAAAAAAAGGG - Intergenic
1143297902 17:5884957-5884979 AAACTCAGCCGCACAAGAATAGG - Intronic
1145801034 17:27684980-27685002 TTTCTCTGCTGCACAAAAAATGG - Intergenic
1145849358 17:28076679-28076701 ATACACAGATGCACAAAAATGGG - Intronic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1149464543 17:56866587-56866609 GAACTCTGTTACATAAAAATTGG + Exonic
1151769488 17:76150706-76150728 AATTTCTGCTTTACAAAAATGGG - Intronic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1153748591 18:8206827-8206849 AGACTCTGCTTCAAAAAAAAGGG + Intronic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1155373743 18:25133986-25134008 TTACTCTGTGGCACAAAAATGGG - Intronic
1156636152 18:39031986-39032008 AAATTGTGCTGAACAAGAATGGG + Intergenic
1156687634 18:39669168-39669190 AAACTCTGTTGCTGAAACATAGG - Intergenic
1157494490 18:48145513-48145535 AAAGTCTCCTCCACAAATATTGG + Intronic
1159042746 18:63340425-63340447 AATCTCTGCAGCATAAAAATTGG - Intronic
1159719412 18:71868603-71868625 AAACTCTTCTACACTAAATTTGG + Intergenic
1159735477 18:72092076-72092098 AAATTTTGATGCACAAAAATGGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160162818 18:76488018-76488040 AATCACTGCTGCACAAACAGAGG + Intronic
1160638328 19:100493-100515 AAACTCAGTTGCATAAAAAAGGG - Intergenic
1160902727 19:1436786-1436808 ACACTCTGCTGCAGGAAAATGGG + Intergenic
1161912995 19:7208469-7208491 AAACTTTGCTTTAGAAAAATGGG + Intronic
1163094653 19:15048087-15048109 AAATTCTCCTCCCCAAAAATAGG + Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
927222761 2:20729260-20729282 TAACTCTGATGCAGAAAAAGTGG + Intronic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
928585041 2:32751219-32751241 AAACTGAGCAGAACAAAAATGGG - Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929332933 2:40706085-40706107 AAGCTCAGCTGCAAAAATATGGG - Intergenic
929648000 2:43649052-43649074 AAACTGTGATGAAAAAAAATAGG - Intronic
932014784 2:68014103-68014125 AAACTCTGCTGCACAGTAAAAGG + Intergenic
932075407 2:68657741-68657763 AAACTTTGCTGCCCAAAATAAGG - Intergenic
933396054 2:81732705-81732727 AAACTCTGCAGCCCAGACATTGG + Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
935377296 2:102412492-102412514 ATACTCTTCTGAACAAAATTTGG + Intergenic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
939175271 2:138740860-138740882 AAACTCTGCCACAGAAATATGGG + Intronic
939306519 2:140418567-140418589 AAATCCTGCTTCACAAATATGGG - Intronic
939922901 2:148139213-148139235 AAACTCTGTTTCAAAAAAAAAGG - Intronic
941470179 2:165874623-165874645 AACCTCTGCTGGAGAAAAAAGGG + Exonic
941626268 2:167834059-167834081 GAACTTTGCTGCACAAAATAGGG + Intergenic
942041927 2:172075374-172075396 AAACTCTTGTGCACAGAAAAGGG + Intronic
942607309 2:177706284-177706306 ATACTTTGCTGCATAATAATTGG + Intronic
942923432 2:181404814-181404836 AAAGACTGCTGAAGAAAAATGGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
945384047 2:209175700-209175722 AAAGTCTACTGCACAAACACAGG + Intergenic
945753836 2:213821991-213822013 GAACAGTGCTGCACAAACATGGG + Intronic
945759486 2:213895967-213895989 AAAATCTTCTGCACAATAAATGG + Intronic
1170544121 20:17418786-17418808 CAACTCTGCTGAACAGAGATGGG - Intronic
1176948522 21:15014898-15014920 AATCTTTGCAGCAAAAAAATTGG + Intronic
1178276198 21:31239694-31239716 AAACTCTGATGGAAAAAAAATGG + Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1183276767 22:36903291-36903313 AAATTCTGCTGCAACAGAATAGG + Intergenic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
949819688 3:8102940-8102962 AATCTCTGCTGCATACAGATTGG - Intergenic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
951176049 3:19601367-19601389 AAACACTGCTGAAGAAAATTGGG + Intergenic
952007315 3:28856854-28856876 AAACTGTGTTGTACAGAAATTGG - Intergenic
952812957 3:37421646-37421668 AAACACTCTTGCATAAAAATGGG - Intronic
954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG + Intronic
955651531 3:61199486-61199508 AAACTCTGGTGCATGAAAACTGG - Intronic
956800865 3:72757061-72757083 AAACTCTACAGCAAAAAAACAGG - Intronic
957311175 3:78520742-78520764 AAACTCAGCTCAACAAATATAGG - Intergenic
957590348 3:82189144-82189166 AAACTCTGTAGCAAAAAATTAGG - Intergenic
958527172 3:95277745-95277767 AAAAACTGCTGGAGAAAAATGGG + Intergenic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
961950264 3:130742316-130742338 AAACTATAATGCACAAAAAAAGG + Intronic
961980927 3:131077540-131077562 ATGCTCTGCTGCACAATAGTTGG + Intronic
962037702 3:131670197-131670219 CAACTCTGCTGCTAAATAATTGG + Intronic
962054070 3:131849864-131849886 AAACTCTGTGGCACAGGAATAGG - Intronic
962174988 3:133143698-133143720 TAAATCTGCTGCACTGAAATGGG + Intronic
963210867 3:142688347-142688369 CAACTCTGGTGCACAGAATTAGG + Intronic
963316480 3:143764306-143764328 CCAGTCTGCTGCACAGAAATAGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
963842019 3:150117401-150117423 AAACTCTGCTGCTCTAAGACAGG + Intergenic
964056028 3:152458874-152458896 AAATTTGGTTGCACAAAAATAGG + Intronic
965865604 3:173200921-173200943 AAACTCACCTGCACAAATATTGG - Intergenic
966673702 3:182561212-182561234 AAATTTTGCAGCACAGAAATGGG - Intergenic
970317745 4:14845588-14845610 AAACACTGCAGCCCAAAAAAAGG + Intergenic
970967987 4:21949278-21949300 AAATACTGCTGCACAAAGTTAGG + Intergenic
971612212 4:28740224-28740246 AAAATCTGATGCTCAAACATTGG + Intergenic
972116601 4:35643119-35643141 AAACTGTGCTGCACAGCAAGAGG - Intergenic
972186131 4:36530200-36530222 AAGGTGTGCTGCACAAAAGTAGG - Intergenic
974984807 4:69009890-69009912 AAACTCTGGTGAACAAATACTGG - Intronic
975330835 4:73110461-73110483 AAAAACTGCTGCAGAAAACTGGG - Intronic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
975798819 4:78036845-78036867 AAACTTTTCTTCACATAAATGGG + Intergenic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
977645647 4:99408533-99408555 AAACTTTCCTGCCAAAAAATAGG - Intergenic
977906999 4:102488601-102488623 AAAATCTTCTGCACAGAAAAAGG + Intergenic
978049598 4:104181382-104181404 AAAATCTTCTGCACAACAAAAGG + Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
979656546 4:123201519-123201541 ATACTTTGCTGAGCAAAAATGGG + Intronic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
981950294 4:150398375-150398397 AAATGCTGCTGGACAAAAAGTGG + Intronic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
982628901 4:157806293-157806315 AAAATCTGCTGCACAGAATTGGG + Intergenic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
983872658 4:172840077-172840099 TAAGTCAGCTGCACAAAAAAAGG + Intronic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987267385 5:16270984-16271006 AAACAGTGCTGCACAAACATGGG - Intergenic
987610420 5:20196675-20196697 AAACTCTGTTGTAGAAATATTGG - Intronic
987631885 5:20483948-20483970 AAAATCTTCTGCACTAAAAATGG + Intronic
987850394 5:23345268-23345290 AAACTCTGCTGAATAAAGCTGGG - Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988533493 5:32045342-32045364 AAACTCTGCTGACAAAAAAGGGG - Intronic
990716528 5:58643666-58643688 AAACTCTGTCTCAAAAAAATTGG + Intronic
990877668 5:60504546-60504568 AGCCTCTGCTACACTAAAATGGG + Intronic
992278888 5:75152432-75152454 AAACTTTCCTGCACACAAAGGGG + Intronic
993580927 5:89660461-89660483 AAACAGTGGAGCACAAAAATTGG + Intergenic
993682836 5:90900966-90900988 AAATTCTACAGGACAAAAATGGG - Intronic
995058505 5:107788682-107788704 AAACTTTGCTGGGCAAGAATTGG - Intergenic
995072667 5:107942379-107942401 AACCTCTGCTGCAATTAAATGGG + Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996116348 5:119624311-119624333 CAGCTCAGCTGCACAACAATAGG - Intronic
996796040 5:127349421-127349443 AAGATATGTTGCACAAAAATGGG - Intronic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
998299313 5:141002695-141002717 TAACTCTGTTGCACACACATAGG + Intronic
1000508942 5:162157882-162157904 AAAATCTGCTGGAGAAAAAGGGG - Intergenic
1001134830 5:169093591-169093613 AAACTCTGCTTCCCATAAGTTGG - Intronic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1004824982 6:19409850-19409872 AAATGGTGCTGCACAAACATAGG - Intergenic
1007335124 6:41150269-41150291 AAACTCTGCTGCTCAGGAATCGG + Exonic
1008953364 6:57185939-57185961 AAACTCCATTGCAAAAAAATGGG - Exonic
1011155005 6:84320992-84321014 AAACTCTTGGCCACAAAAATTGG + Intergenic
1011205321 6:84888048-84888070 CACATCTCCTGCACAAAAATAGG + Intergenic
1012221315 6:96652525-96652547 AAACTCTTCTGCACGACAACAGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013199980 6:107884649-107884671 AAACTCTTCTGAGCAAAAAAGGG + Intronic
1014152714 6:118076933-118076955 AAATACGGTTGCACAAAAATAGG - Intronic
1015275872 6:131383021-131383043 CAACTATGATCCACAAAAATAGG + Intergenic
1015998975 6:139023640-139023662 AACCTCTTCTCCACAAAAAAAGG - Intergenic
1016654594 6:146503482-146503504 AATGTCTGCTGAATAAAAATGGG + Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018233251 6:161696346-161696368 AAAATCTGCTGAACAAATAAAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019132485 6:169887427-169887449 AAAGTCTGTTTCACAAAAAAAGG - Intergenic
1019640228 7:2099408-2099430 TATCTCTGCTGCACAAAAGAAGG - Intronic
1021164740 7:17323399-17323421 AAATTCTGAAGCATAAAAATAGG - Intronic
1022625059 7:32026697-32026719 AAACTCAGGTCCACAAAAAATGG + Intronic
1022674640 7:32487626-32487648 AATCACTGCTCCCCAAAAATGGG + Intronic
1024137283 7:46423187-46423209 CCACTCTGCTGCAGACAAATGGG - Intergenic
1024751506 7:52470942-52470964 AAACAATGCTGATCAAAAATAGG + Intergenic
1027452804 7:78351985-78352007 AAATTCTGAAGCACAAAAAAAGG - Intronic
1028017528 7:85734707-85734729 TACCTCTGTTGCACAGAAATGGG - Intergenic
1028700325 7:93770955-93770977 AAACTTTGTTGCACCCAAATAGG + Intronic
1029680972 7:102109288-102109310 AAAATCCGCTCTACAAAAATAGG + Intronic
1029790294 7:102836257-102836279 AAAATCTGAGGCACAAAAATTGG + Intronic
1030064525 7:105649147-105649169 AAACACTGCTCCACAAAGAAAGG - Intronic
1030109565 7:106015267-106015289 AAACTCTGCTGGGCAATACTAGG + Intronic
1030465079 7:109890645-109890667 AAACAATGCTGGACAAAAAGTGG + Intergenic
1030986772 7:116250829-116250851 TATCTCTGCTGCCCATAAATAGG + Intronic
1032515189 7:132501647-132501669 AAACCCTGCTGGCCAAAAAGAGG + Intronic
1035461951 7:159045617-159045639 AAACTCTTCTGAAAAAACATAGG + Intronic
1037102342 8:15062026-15062048 ATACTCTGCTGCACCAGAACTGG + Intronic
1037327530 8:17708692-17708714 AAACTCTGCTGTACACATTTAGG - Intronic
1038075194 8:24065387-24065409 CAACTCTGATCCAAAAAAATGGG - Intergenic
1038596196 8:28889037-28889059 TAACTTGGCTGCACAAATATGGG + Intronic
1038627781 8:29210880-29210902 AAACACTGCTGCAGGAAAAGAGG + Intronic
1040930975 8:52735005-52735027 AAACTCTCTTGCACAATCATAGG + Intronic
1042322450 8:67491123-67491145 AAACACTGCGGCACCAAAATGGG + Intronic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1043841869 8:85115677-85115699 GAACACTGATGCACTAAAATAGG - Intronic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1046501031 8:115077361-115077383 AAACTCTGCTGTGGAAAAAGAGG + Intergenic
1048461436 8:134624646-134624668 AAACTCTGTCTCAAAAAAATAGG + Intronic
1048570815 8:135654473-135654495 AAACTCATCTGCTCAAAAGTTGG + Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050269681 9:3929319-3929341 AAACTCTTCTGCAAAGGAATGGG - Intronic
1050411744 9:5373430-5373452 CTACTCTGCTGCACAAATGTGGG + Intronic
1055591550 9:77820276-77820298 AAAATCTCCTGCAGAAAACTTGG + Intronic
1056689102 9:88791082-88791104 AAATTCTGCTTCAAAAAAATTGG - Intergenic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1188098912 X:26058077-26058099 AGACTCTGTAGCACAAAAAAAGG + Intergenic
1188590870 X:31833457-31833479 AATCTCTGCTGCAAAATAACTGG - Intronic
1189092717 X:38104126-38104148 AAACTCAGCTTCAGACAAATAGG + Intronic
1191232522 X:58107235-58107257 AGAGACTCCTGCACAAAAATAGG + Intergenic
1192950402 X:76010287-76010309 AAATTCTGAGGCACAAAAAAAGG - Intergenic
1193549050 X:82867075-82867097 AAAAGCTTCTGCACAATAATAGG - Intergenic
1193781535 X:85708523-85708545 AAACTCTTCTGGAAAAAAAGAGG + Intergenic
1193863013 X:86694498-86694520 AAAATAAGCTGGACAAAAATAGG - Intronic
1195282369 X:103348538-103348560 AAAATCTTTTGCACCAAAATGGG + Intergenic
1195471114 X:105231293-105231315 ATATGCTGCTGCACAAAACTTGG + Intronic
1195488974 X:105443783-105443805 AAACAGTGCTGCACAAGCATAGG + Intronic
1195500825 X:105596985-105597007 AAAAGCTTCTGCACAAAAAAGGG + Intronic
1196042530 X:111220498-111220520 AAACTCTGCTGCAGGAAAGATGG + Exonic
1198184511 X:134240275-134240297 AAAAACTGCTCCACCAAAATAGG - Intronic
1199301266 X:146216784-146216806 AAATTCTTCTGCAAAATAATGGG + Intergenic
1200637159 Y:5670250-5670272 GAACAGTGCTGCACAAACATAGG + Intronic
1201737690 Y:17287174-17287196 ATATTCTACTGCACAGAAATGGG - Intergenic
1201757877 Y:17507215-17507237 AAACTCTGCTTCAGAAAGACAGG - Intergenic
1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG + Intergenic