ID: 954471404

View in Genome Browser
Species Human (GRCh38)
Location 3:50699087-50699109
Sequence TTCTATGTGATAGTAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1069
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 1034}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954471401_954471404 12 Left 954471401 3:50699052-50699074 CCATTTTAGGTCTTTTATCCATT 0: 1
1: 1
2: 7
3: 77
4: 579
Right 954471404 3:50699087-50699109 TTCTATGTGATAGTAGAGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 1034
954471402_954471404 -6 Left 954471402 3:50699070-50699092 CCATTTCGAGTTAATTTTTCTAT 0: 1
1: 37
2: 911
3: 6610
4: 21554
Right 954471404 3:50699087-50699109 TTCTATGTGATAGTAGAGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 1034

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954471404 Original CRISPR TTCTATGTGATAGTAGAGAA GGG Intronic
900241409 1:1619199-1619221 TTCTATTTTTTAGTAGAGACGGG - Intronic
901096755 1:6687528-6687550 TTGTATTTGTTAGTAGAGACGGG + Intronic
901154723 1:7127904-7127926 TTTTATGTCAGAATAGAGAACGG - Intronic
901299377 1:8188136-8188158 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
901874633 1:12160357-12160379 TTATTTTTAATAGTAGAGAAGGG - Intergenic
902935045 1:19758927-19758949 TTGTATTTTGTAGTAGAGAAGGG - Intronic
903072520 1:20733380-20733402 TTGTATGTGACAGTACAGCAAGG + Intergenic
903219708 1:21862409-21862431 TTGTATTTGTTAGTAGAGATGGG - Intronic
903494688 1:23757670-23757692 TTCTATTTTTTAGTAGAGACGGG + Intronic
903517036 1:23918213-23918235 TTCTATCTTTTAGTAGAGACAGG - Intergenic
903530184 1:24024108-24024130 TTCTATTTTTTAGTAGAGACGGG - Intergenic
903823988 1:26129138-26129160 TTCTTTGTGATTCTAGAAAAAGG + Intergenic
903942925 1:26944065-26944087 TTCTATTTTTTAGTAGAGACAGG + Intronic
903985144 1:27221855-27221877 TTCTATTTTTTAGTAGAGAAGGG + Intergenic
904114160 1:28149504-28149526 TTGTATGTTTTAGTAGAGATGGG + Exonic
904168250 1:28572759-28572781 TTCTATTTTTTAGTAGAGACGGG - Intronic
904767429 1:32861237-32861259 ATCTATGTGATGGTGGTGAAAGG + Intergenic
905085440 1:35371287-35371309 TTCTATGTTTTAGTAGAGACGGG + Intronic
905367549 1:37462047-37462069 TTGTTTGTGATAGTAAAGACTGG + Intergenic
905555773 1:38882882-38882904 TTCTATGAACTAATAGAGAAAGG + Intergenic
905713615 1:40129188-40129210 TTGTATGTTTTAGTAGAGACGGG + Intergenic
905754941 1:40501211-40501233 TTGTATTTTATAGTAGAGATGGG + Intergenic
905844762 1:41219619-41219641 TTCTATTTGATAGTAAACACTGG - Intronic
906233110 1:44182654-44182676 TTCTATTTTTTAGTAGAGACAGG + Intergenic
906281272 1:44555646-44555668 TTCTATTTTTTAGTAGAGACAGG + Intronic
906351641 1:45065619-45065641 GTTTATTTGATAGGAGAGAAAGG + Intronic
906362587 1:45176434-45176456 TTCTATTTTTTAGTAGAGACGGG + Intronic
906807758 1:48795823-48795845 TTCTATTTTTTAGTAGAGATGGG + Intronic
907163819 1:52392299-52392321 TTTTATGTTTTAGTAGAGATAGG + Intronic
907187667 1:52622816-52622838 TTCTATTTTTTAGTAGAGATGGG - Intergenic
907221589 1:52911147-52911169 TTGTATTTTTTAGTAGAGAAGGG + Intronic
907416368 1:54317009-54317031 TTCAGTGTGATAGTAGTGAAAGG - Intronic
908372699 1:63499319-63499341 TTGTATTTTTTAGTAGAGAAGGG + Intronic
908471273 1:64446378-64446400 TTCTATTTTTTAGTAGAGACGGG + Intergenic
908964973 1:69749888-69749910 TTTTATATTTTAGTAGAGAAGGG - Intronic
908968997 1:69802855-69802877 ATCTTTGTGATATTAGAGTAGGG - Intronic
909148593 1:71970517-71970539 TTCTATTTTTTAGTAGAGATGGG - Intronic
910164369 1:84308661-84308683 TTATATATCATAGAAGAGAAGGG + Intronic
910402339 1:86849840-86849862 TTGTATGTTTTAGTAGAGATGGG + Intergenic
910680343 1:89857209-89857231 TTCTATTTTTTAGTAGAGACGGG - Intronic
911010742 1:93278157-93278179 TTGTATGTTTTAGTAGAGACAGG + Intronic
911442792 1:97949726-97949748 TTCTATTTTTTAGTAGAGACGGG + Intergenic
911711281 1:101076554-101076576 TTTTATGTTATATTAGAAAATGG - Intergenic
911833832 1:102590243-102590265 TTCTATTTTTTAGTAGAGACGGG + Intergenic
912118470 1:106438006-106438028 TTCTATTTTTTAGTAGAGACGGG - Intergenic
912426292 1:109594808-109594830 TTGTATGTCTTAGTAGAGACGGG + Exonic
912596828 1:110887235-110887257 TTCTATTTTTTAGTAGAGACGGG + Intronic
912820435 1:112863422-112863444 TTGTATTTGTTAGTAGAGACGGG - Intergenic
913104464 1:115599262-115599284 TTCTATTTTTTTGTAGAGAAAGG - Intergenic
913537268 1:119785145-119785167 TCCAGTGTGATAATAGAGAAGGG - Intergenic
914225353 1:145715374-145715396 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
914315320 1:146505754-146505776 TTCTATTTTTTAGTAGAGACAGG + Intergenic
914373217 1:147049897-147049919 TTGTATTTTATAGTAGAGACAGG + Intergenic
914499036 1:148227626-148227648 TTCTATTTTTTAGTAGAGACAGG - Intergenic
915229836 1:154437268-154437290 TTCTATTTTTTAGTAGAGACGGG + Intronic
915499122 1:156302290-156302312 TTGTATTTTATAGTAGAGATGGG + Intergenic
915896644 1:159816432-159816454 TTGTATTTGTTAGTAGAGATGGG + Intergenic
916089967 1:161300219-161300241 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
916158097 1:161878284-161878306 TTGTATGTTTTAGTAGAGATAGG + Intronic
916969597 1:169997697-169997719 TTTTATGTTTTAGTAGAGACAGG - Intronic
918253153 1:182722801-182722823 TTCTATTTTTTAGTAGAGACGGG - Intergenic
918258981 1:182776831-182776853 TTCTATGTGACAGTGGTGGAGGG + Intergenic
918299680 1:183191684-183191706 TTGTATGTTTTAGTAGAGACAGG - Intronic
918789444 1:188807556-188807578 TTCAATTTGATAGCAGAGTAGGG + Intergenic
918825708 1:189321167-189321189 TTCTATTTTTCAGTAGAGAAGGG + Intergenic
918995051 1:191747462-191747484 TTCTAGGTCAAAGCAGAGAAAGG + Intergenic
919321662 1:196048418-196048440 TTCTATTTGATAATTAAGAATGG + Intergenic
919642091 1:200055365-200055387 TTGTATGTTTTAGTAGAGATGGG + Intronic
919705674 1:200672890-200672912 TTATATTTTTTAGTAGAGAAGGG + Intergenic
919713591 1:200752788-200752810 TTGTATTTTATAGTAGAGACGGG + Intronic
919846065 1:201642945-201642967 TTGTTTGTTTTAGTAGAGAAGGG + Intronic
920027799 1:203013684-203013706 TTGTATTTTTTAGTAGAGAAGGG + Intronic
921078187 1:211716589-211716611 TTGTATTTTATAGTAGAGACGGG + Intergenic
921157473 1:212449716-212449738 TTCTATTTTTTAGTAGAGACGGG - Intergenic
921224819 1:213008033-213008055 TTGTATGTTTTAGTAGAGACGGG + Intronic
921397515 1:214684155-214684177 TTCTATGTGATACAAGAGCTGGG + Intergenic
921408087 1:214803432-214803454 TTCTATTTTTTAGTAGAGACGGG + Intergenic
921651454 1:217683611-217683633 TTCTATTTTTTAGTAGAGACGGG + Intronic
921778968 1:219138408-219138430 TTGTATGTGGTATTAGATAAGGG - Intergenic
921875371 1:220189550-220189572 TTCTATCTGAAAATAAAGAAAGG + Intronic
921935139 1:220788613-220788635 TTGTATTTTTTAGTAGAGAAGGG - Intronic
923064572 1:230506185-230506207 TTCTATTTTTTAGTAGAGATGGG - Intergenic
923154694 1:231268127-231268149 TTCTATTTTTTAGTAGAGACGGG - Intronic
923740380 1:236649511-236649533 TTCTATTTTTTAGTAGAGACAGG + Intergenic
924000114 1:239541682-239541704 TTCTATGTTTTTGTAGAGACGGG + Intronic
924028639 1:239865047-239865069 TTGTATGTAATAGTAGAAAATGG + Intronic
924349636 1:243102202-243102224 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
924784374 1:247182017-247182039 TTGTATGTTTTAGTAGAGACGGG + Intergenic
1063405588 10:5791436-5791458 TTGTATGTTTTAGTAGAGACCGG - Intronic
1063786662 10:9392575-9392597 TTCGATGAGATAAAAGAGAAGGG + Intergenic
1064050054 10:12052293-12052315 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1064085362 10:12341986-12342008 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1064128771 10:12689041-12689063 TTCTATGGGACTGAAGAGAAGGG - Intronic
1064404482 10:15048928-15048950 TTTTATGTTTTAGTAGAGACGGG - Intronic
1064763607 10:18647908-18647930 TTATATGTTTTAGTAGAGACAGG + Intronic
1065199516 10:23299802-23299824 TTGTATGTTTTAGTAGAGACAGG - Intronic
1065250446 10:23805840-23805862 TTGTATTTGTTAGTAGAGATGGG - Intronic
1065320167 10:24501920-24501942 TTCTATGTTTTAGTAGAGACGGG + Intronic
1065333952 10:24635716-24635738 TTGTATGTTTTAGTAGAGACGGG + Intronic
1065687359 10:28299938-28299960 TTCTATTTTTTAGTAGAGACAGG + Intronic
1065993343 10:31032942-31032964 TTTTATGTTTTAGTAGAGACAGG + Intergenic
1066570305 10:36763698-36763720 TTGTATTTTATAGTAGAGACGGG - Intergenic
1066939310 10:41869099-41869121 TGCAATGTAATAGTATAGAATGG + Intergenic
1067727999 10:48787506-48787528 CCCAATGTGCTAGTAGAGAAAGG - Intronic
1067961917 10:50863796-50863818 TACTATTTGATAGTATAGTAGGG + Intronic
1068044557 10:51869606-51869628 TTCTAAGAGATAATAGAAAATGG + Intronic
1068713595 10:60161230-60161252 TTCTATGTGCTAACAGAAAATGG + Intronic
1070053356 10:72910729-72910751 TTCTAGGTTAAAGTAAAGAAAGG - Intronic
1070189869 10:74102036-74102058 TTCTATTTTTTAGTAGAGACAGG + Intronic
1070295935 10:75161646-75161668 TTCTATGTGACAGTAATGAGAGG + Intronic
1070531003 10:77337445-77337467 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1070643343 10:78184618-78184640 TTCTATATGATTGGAGAGCAGGG + Intergenic
1070845368 10:79518434-79518456 TTGTATGTTTTAGTAGAGATGGG - Intergenic
1071219437 10:83446637-83446659 TTGTATTTGTTAGTAGAGAAGGG + Intergenic
1071580400 10:86763962-86763984 TTCTATTTTTTAGTAGAGACAGG + Intronic
1072044085 10:91637426-91637448 TTTTATTTTTTAGTAGAGAAGGG - Intergenic
1072398337 10:95068885-95068907 TTGTATGTTTTAGTAGAGACAGG - Intronic
1072399100 10:95079015-95079037 TTGTATGTTTTAGTAGAGATGGG - Intergenic
1072955599 10:99885335-99885357 TTCTATTTTTTAGTAGAGATGGG - Intronic
1073246656 10:102095292-102095314 TTATATTTTTTAGTAGAGAAGGG + Intergenic
1073427934 10:103467360-103467382 TTGTATGTTTTAGTAGAGACGGG - Intergenic
1073483860 10:103804493-103804515 TTGTATGTTTTAGTAGAGACAGG + Intronic
1074068186 10:110037893-110037915 TTCTATTTTTTAGTAGAGACGGG - Intronic
1074345193 10:112678246-112678268 TTCTATGTGACATTCAAGAATGG - Intronic
1075047441 10:119157255-119157277 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1075364616 10:121874830-121874852 TTGTATGTTTTAGTAGAGACGGG - Intronic
1075370337 10:121929488-121929510 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1076346522 10:129782519-129782541 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1076555894 10:131321205-131321227 TTATATGTGATAGTCCACAAGGG - Intergenic
1077726091 11:4676343-4676365 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1077777061 11:5283679-5283701 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1077789692 11:5424806-5424828 TTCTATTTTTTAGTAGAGATGGG - Intronic
1077973987 11:7226689-7226711 TTCTATTTTTTAGTAGAGATGGG + Intergenic
1078015978 11:7615162-7615184 TTGTATGTTTTAGTAGAGATGGG - Intronic
1078134258 11:8639124-8639146 ATCCATGTGATGGCAGAGAAGGG - Intronic
1078208023 11:9247054-9247076 TTCTATTTTTTAGTAGAGACGGG - Intronic
1078237904 11:9503002-9503024 TTGTATGTTTTAGTAGAGACGGG + Intronic
1078735801 11:14019746-14019768 TTTTATGGAATAGAAGAGAAAGG - Intronic
1079217069 11:18523246-18523268 TTATATCTGATAGTAAAGAGAGG - Intronic
1079401056 11:20106815-20106837 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1079403282 11:20123867-20123889 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1079830965 11:25267161-25267183 TTCTATTTTTTAGTAGAGATGGG + Intergenic
1079963572 11:26953261-26953283 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1080550272 11:33368485-33368507 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1080910342 11:36590960-36590982 TTCTATTTGTTAGTAGAAAATGG - Intronic
1080911918 11:36609506-36609528 TTGTCAGTGATAGTAGGGAAGGG + Intronic
1081249421 11:40811667-40811689 TTTTATATTTTAGTAGAGAAGGG + Intronic
1081285705 11:41267298-41267320 TTCTAAGTGGTAGCAGGGAAGGG - Intronic
1081360276 11:42168831-42168853 TGCTATTTGATAGTACAGTAGGG - Intergenic
1081896283 11:46589793-46589815 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1081995953 11:47364221-47364243 TTCTATTTTTTAGTAGAGACGGG + Intronic
1082063308 11:47878870-47878892 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1083441798 11:62681539-62681561 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1083456357 11:62781498-62781520 TTCTATTTTTTAGTAGAGACGGG - Intronic
1083468558 11:62866050-62866072 TACTATGTGAGACCAGAGAATGG - Intronic
1083772141 11:64873848-64873870 TTCTATTTTTTAGTAGAGATGGG + Intronic
1084879536 11:72160397-72160419 ATATATGTAATAGTAGAGACAGG + Intergenic
1085074250 11:73575696-73575718 TTTTATGTTTTAGTAGAGACAGG - Intronic
1085882390 11:80483469-80483491 TTGTATGTTTTAGTAGAGATGGG - Intergenic
1086153732 11:83642373-83642395 TTCTATCTGAAAACAGAGAAGGG - Intronic
1087502467 11:98975574-98975596 TTCTATAAGGTAGAAGAGAATGG + Intergenic
1087505238 11:99012798-99012820 TTTTGTGTTTTAGTAGAGAAGGG - Intergenic
1087607059 11:100389754-100389776 TTGTATGTGGTATAAGAGAAGGG - Intergenic
1087625166 11:100587517-100587539 TTCCATGTGATACAAGAGACTGG - Intergenic
1087742212 11:101901048-101901070 TTGTATGTTTTAGTAGAGACGGG + Intronic
1087763092 11:102122720-102122742 TTCTATTTTTTAGTAGAGATGGG - Intronic
1087865675 11:103223917-103223939 TTCTGTATTTTAGTAGAGAAGGG + Intronic
1088002364 11:104897608-104897630 TTTTATTTGATAGGTGAGAATGG + Intergenic
1088256017 11:107904220-107904242 TTGTATGTTTTAGTAGAGATGGG + Intronic
1088354511 11:108928292-108928314 TTCTATGTATTGATAGAGAAAGG - Intronic
1089123138 11:116155279-116155301 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1089150372 11:116359213-116359235 GTCTACGTGATAATAGGGAATGG - Intergenic
1089893733 11:121906773-121906795 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1090130736 11:124138947-124138969 TTCTATGTGATGAGAGATAAGGG + Intronic
1090670118 11:128940130-128940152 TTCTTTGTGATAATAGACCAGGG - Intronic
1090962459 11:131569315-131569337 TTGTATGTTTTAGTAGAGACAGG + Intronic
1091126360 11:133102572-133102594 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1091268114 11:134286601-134286623 TTCTATTTTTTAGTAGAGACGGG - Intronic
1091268174 11:134286985-134287007 TTCTATTTTTTAGTAGAGACGGG - Intronic
1091276236 11:134353235-134353257 TTGTATTTTTTAGTAGAGAATGG - Intronic
1091407390 12:217760-217782 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1091438533 12:494510-494532 TACTATGGGATGGTAGAAAATGG - Intronic
1091466407 12:688660-688682 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1091946693 12:4551322-4551344 TTTTGTGTTTTAGTAGAGAAGGG - Intronic
1091985056 12:4904073-4904095 TTGTATTTTATAGTAGAGATGGG - Intergenic
1092188967 12:6503804-6503826 TTCTATTTTTTAGTAGAGACGGG - Intronic
1092345856 12:7714053-7714075 TTCTATTTTTTAGTAGAGAAGGG - Intronic
1092393161 12:8099704-8099726 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1092454714 12:8633086-8633108 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1093037634 12:14347770-14347792 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1093081412 12:14815879-14815901 TGCTATGTGGTAGGAGAGAAAGG - Intronic
1093529764 12:20147054-20147076 TTCTATTTGGTAGTAGAATAGGG + Intergenic
1093650099 12:21633505-21633527 TTTTGTATGATAGTAGAAAATGG + Intergenic
1094796105 12:33974419-33974441 TTATATTTGTTAGTAGAGACAGG - Intergenic
1095108828 12:38268283-38268305 TTATATTTGTTAGTAGAGACAGG - Intergenic
1095224261 12:39660722-39660744 TAATATTTGATAGTAGAGTAGGG - Intronic
1095459998 12:42433494-42433516 TTCTATTTTTTAGTAGAGACGGG + Intronic
1095755826 12:45766338-45766360 TTCTATTTTTTAGTAGAGATGGG + Intronic
1095770214 12:45946148-45946170 TTTTAAGTCATTGTAGAGAATGG - Intronic
1095846287 12:46748672-46748694 TTCTATGTGATGTAAGGGAAAGG - Intergenic
1096173189 12:49490968-49490990 TTCTATTTTTTAGTAGAGACGGG - Intronic
1096177175 12:49529989-49530011 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1096517192 12:52163479-52163501 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1096708827 12:53440814-53440836 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1097612983 12:61849013-61849035 TTGTATTTGTTAGTAGAGACAGG + Intronic
1097644540 12:62220932-62220954 TTCTATTTTTTAGTAGAGATGGG - Intronic
1097718327 12:62992431-62992453 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1097840269 12:64314806-64314828 TTCTATTTTTTAGTAGAGACGGG + Intronic
1098404760 12:70112448-70112470 TTGTATGTTTTAGTAGAGATGGG - Intergenic
1098545491 12:71706840-71706862 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1098880922 12:75916495-75916517 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1099059966 12:77895705-77895727 ATATATGTGGTAGTAGAGGATGG - Intronic
1099299545 12:80874808-80874830 TTCTATTTTTTAGTAGAGACGGG - Intronic
1099354624 12:81618703-81618725 TTGTATTTTTTAGTAGAGAAAGG + Intronic
1100014880 12:89997033-89997055 TTCTTTTTAATAGTAGATAAAGG + Intergenic
1100047017 12:90394988-90395010 TTGTATTTCTTAGTAGAGAAGGG - Intergenic
1100182808 12:92103948-92103970 TTGTATGTTTTAGTAGAGATGGG - Intronic
1100782432 12:98043308-98043330 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1100790630 12:98126251-98126273 TTGTATGTTTTAGTAGAGACGGG - Intergenic
1100939864 12:99714613-99714635 TTCTATGTGATAGTGGATCATGG - Intronic
1101310996 12:103579184-103579206 TTCTATGTGATAGAATGTAATGG - Intergenic
1101360783 12:104024897-104024919 TTTTGTGTTTTAGTAGAGAAAGG - Intronic
1101636255 12:106544730-106544752 TTCTATTTTTTAGTAGAGACGGG - Intronic
1101982299 12:109417987-109418009 TTCTATTTTGTAGTAGAGACGGG + Intronic
1102053943 12:109882258-109882280 TTGTATTTGTTAGTAGAGATGGG - Intergenic
1102843011 12:116146291-116146313 TTTTATGTTTTAGTAGAGATGGG + Intronic
1103150636 12:118635667-118635689 TGCTATGGGATTGTAAAGAAGGG + Intergenic
1103424465 12:120820487-120820509 TTCTATTTTTTAGTAGAGACGGG + Intronic
1103786976 12:123439965-123439987 TTGTATGTTTTAGTAGAGACAGG + Intergenic
1104493291 12:129213319-129213341 TTCTATTTGTTTGTAGAGACAGG - Intronic
1105382056 13:19896581-19896603 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1105490174 13:20880783-20880805 TTGTATGTGTTCGTAGAGATGGG - Intronic
1105526148 13:21179437-21179459 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1105590535 13:21789398-21789420 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1105601620 13:21893003-21893025 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1105612971 13:21985563-21985585 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1105877643 13:24573148-24573170 TTCTTTTTTTTAGTAGAGAAGGG + Intergenic
1106158072 13:27175748-27175770 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1106159593 13:27188775-27188797 TTCTGTCTGTTTGTAGAGAAGGG - Intergenic
1106496484 13:30282779-30282801 TTCTATTTTTTAGTAGAGATGGG - Intronic
1106557484 13:30822540-30822562 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1106637413 13:31543779-31543801 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1106697632 13:32193757-32193779 TTCTATTTTTTAGTAGAGACAGG + Intronic
1106713798 13:32367261-32367283 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1106835947 13:33635484-33635506 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1107587621 13:41868710-41868732 TTCTATTTTTTAGTAGAGACGGG - Intronic
1107931764 13:45312949-45312971 TTCTGTATTTTAGTAGAGAAGGG + Intergenic
1108142565 13:47440097-47440119 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1108259147 13:48639571-48639593 TTCTATTTCTTAGTAGAGACGGG - Intergenic
1108567428 13:51714462-51714484 TTGTATGTTTTAGTAGAGATGGG + Intronic
1108606113 13:52040254-52040276 TTCTATTTTTTAGTAGAGACGGG + Intronic
1108906127 13:55476700-55476722 TTGTATATGACAGTAGAGACTGG + Intergenic
1109298175 13:60561266-60561288 TTCTCTGTGATAGAAGGCAAAGG + Intronic
1109547359 13:63846056-63846078 CTCTATGAGATAAAAGAGAAAGG - Intergenic
1109716563 13:66228802-66228824 TTCTAAGTGAAAGCAGAGAGAGG + Intergenic
1110439620 13:75513098-75513120 TTCTATGTGTGGGAAGAGAAGGG - Intergenic
1110487241 13:76061000-76061022 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1110724245 13:78801285-78801307 TTGTATGTTTTAGTAGAGACAGG + Intergenic
1112064548 13:95779295-95779317 TTCTATTTTTTAGTAGAGACGGG + Intronic
1112191310 13:97180560-97180582 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1112628438 13:101133994-101134016 TTCTATTTTTTAGTAGAGACGGG - Intronic
1112794385 13:103039574-103039596 TTCTATGTAATTGTCTAGAAAGG + Intergenic
1112920423 13:104605030-104605052 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1113772897 13:112922659-112922681 TTCTGTGTTTTAGTAGAGACAGG - Intronic
1113841066 13:113361974-113361996 TTCTATTTTTTAGTAGAGATGGG - Intronic
1114370456 14:22081737-22081759 TACTATTTGATAGTACAGTAGGG + Intergenic
1114628282 14:24143568-24143590 TTCTATGTGAGTGTGGAGTAAGG - Exonic
1115278012 14:31630058-31630080 TTATTTGTAATAATAGAGAAAGG - Intronic
1115426480 14:33266235-33266257 TTATATATGATAGCAGTGAAAGG + Intronic
1115540792 14:34418829-34418851 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1115610453 14:35044294-35044316 TTGTATTTTATAGTAGAGACGGG + Intergenic
1116157022 14:41218606-41218628 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1116512831 14:45768071-45768093 TTCTATTTTTTAGTAGAGACAGG + Intergenic
1116575990 14:46576222-46576244 TTTTATTTAATAGAAGAGAAGGG - Intergenic
1116643593 14:47497427-47497449 TTCTATTTTTTAGTAGAGAAGGG + Intronic
1116806915 14:49502897-49502919 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1117057937 14:51932071-51932093 TTCTATTTTTTAGTAGAGACGGG - Intronic
1118193900 14:63607044-63607066 TTCTATGTATCAGAAGAGAAAGG + Intronic
1118265235 14:64288519-64288541 TTCTATTTTTTAGTAGAGACGGG + Intronic
1118310335 14:64687582-64687604 TTGCATGTTTTAGTAGAGAACGG - Intergenic
1118564367 14:67123501-67123523 TTCTATTTTGTAGTAGAGATGGG - Intronic
1119016373 14:71060186-71060208 TGCTTTGTGATAGGACAGAATGG - Intronic
1119295879 14:73532779-73532801 TTGTATGTTTTAGTAGAGATGGG - Intronic
1119822600 14:77630735-77630757 TTATATTTTTTAGTAGAGAAGGG + Intergenic
1119988151 14:79163363-79163385 TTCTATGAGAAAGGAGAAAATGG + Intronic
1120061694 14:79991010-79991032 TAGTATGTGATAGTACAGTAGGG - Intergenic
1120297155 14:82656506-82656528 TTCTAAGTGAGAGTTGAAAAAGG - Intergenic
1120438727 14:84509820-84509842 TTGTATTTTATGGTAGAGAAGGG + Intergenic
1120465590 14:84853144-84853166 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1120811060 14:88803838-88803860 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1120816205 14:88861556-88861578 TTCTATTTGATAGTACAGTAGGG - Intronic
1120940948 14:89948907-89948929 TAGTATTTGATAGTACAGAATGG + Intronic
1121053178 14:90832612-90832634 TTGTATGTTTTAGTAGAGACGGG - Intergenic
1121669430 14:95696505-95696527 TTCTAAGTGATAGGAGTGAGAGG + Intergenic
1121804588 14:96805956-96805978 TTCTCTGTGATAATACTGAAGGG - Intronic
1121844786 14:97163437-97163459 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1121964541 14:98291956-98291978 TTCTGTATGTTAGTAGAGATGGG - Intergenic
1122490295 14:102110752-102110774 TTCTATTTTTTAGTAGAGATGGG + Intronic
1122681997 14:103472035-103472057 TTCTATTTTTTAGTAGAGACAGG - Intronic
1122686186 14:103508418-103508440 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1122908500 14:104814778-104814800 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1123000503 14:105291502-105291524 TTGTATGTTTTAGTAGAGACGGG - Intronic
1123133758 14:106009083-106009105 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1124220728 15:27847788-27847810 GTATTTGTGATAGTAGGGAAAGG + Intronic
1124484849 15:30104518-30104540 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1124518730 15:30392720-30392742 TTCTATTTTTTAGTAGAGACGGG + Intronic
1124539926 15:30573526-30573548 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1124545045 15:30618950-30618972 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1124758725 15:32434056-32434078 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1125493399 15:40166511-40166533 TTCTATTTTTTAGTAGAGACGGG + Intronic
1125495275 15:40187297-40187319 TTCTATTTTTTAGTAGAGACGGG + Intronic
1125627808 15:41123103-41123125 TTCTATTTTTTTGTAGAGAAGGG - Intergenic
1125807064 15:42502728-42502750 TTCTATGTGAAAGATAAGAACGG - Intronic
1125909513 15:43423484-43423506 TTTTTTGTGTTAGTAGAGACGGG - Intronic
1126036757 15:44553317-44553339 TTCTATTTTTTAGTAGAGACGGG - Intronic
1126708148 15:51426899-51426921 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1126763531 15:51991379-51991401 TTCTATCTCATAGAAGAGAAAGG - Intronic
1127415911 15:58757017-58757039 TTTTGTGTTCTAGTAGAGAATGG + Intergenic
1127582816 15:60353095-60353117 TTCTAGCAGGTAGTAGAGAAGGG - Intronic
1127621664 15:60740048-60740070 TTCTATTAGAAAGGAGAGAAAGG + Intronic
1127694180 15:61428230-61428252 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1128177526 15:65569072-65569094 TTCTATTTTTTAGTAGAGACGGG - Intronic
1128427487 15:67556722-67556744 TTCTATTTTTTAGTAGAGACAGG + Intronic
1129131849 15:73505703-73505725 TTGTATGTTTTAGTAGAGACAGG + Intronic
1129282760 15:74499032-74499054 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1129343747 15:74903425-74903447 TTCTATTTTTTAGTAGAGATGGG - Intronic
1129987858 15:79934482-79934504 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1130006284 15:80101964-80101986 TTGTATTTTTTAGTAGAGAACGG + Intronic
1130089864 15:80811726-80811748 TTCTATGTCTTCGTAGAGATGGG + Intronic
1130232509 15:82107804-82107826 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1130435248 15:83892041-83892063 TTCTACGTTTTAGTAGAGATGGG - Intronic
1131037548 15:89233541-89233563 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1131289096 15:91089578-91089600 TTCTATTTTTTAGTAGAGATGGG + Intergenic
1131488575 15:92842506-92842528 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1131548733 15:93338298-93338320 TTCTATGTTCTTGTAAAGAATGG + Intergenic
1132173759 15:99690876-99690898 CTGTATTTGATAGGAGAGAAGGG + Intronic
1132922226 16:2402899-2402921 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1133329852 16:4966137-4966159 TTCTATTTTTTAGTAGAGACGGG + Intronic
1133460444 16:5982445-5982467 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1133773241 16:8880012-8880034 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1133881760 16:9788913-9788935 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1133993720 16:10730772-10730794 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1134233402 16:12446991-12447013 TTTTATATTATAGTAGAGACGGG - Intronic
1134251164 16:12575064-12575086 TTTTATGTTTTAGTAGAGACAGG + Intergenic
1134252855 16:12586891-12586913 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1134444600 16:14321343-14321365 TTCTATTTTTTAGTAGAGATGGG + Intergenic
1134472736 16:14541646-14541668 TTCTATTTTTTAGTAGAGACGGG + Intronic
1134611365 16:15611283-15611305 TTCTATTTTTTAGTAGAGACGGG - Intronic
1134883889 16:17772826-17772848 TTTTATTTTATAGTAGAGACGGG + Intergenic
1135533322 16:23273279-23273301 TTGTATGTTTTAGTAGAGATGGG - Intergenic
1135580395 16:23620899-23620921 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1135684929 16:24491274-24491296 TTTTATGGGGTAATAGAGAAGGG - Intergenic
1135729349 16:24881457-24881479 TTGTATTTTATGGTAGAGAAAGG + Intronic
1135843990 16:25901708-25901730 TTCTGTGTGAGAACAGAGAAAGG - Intronic
1136017496 16:27411633-27411655 TTGTATTTGTTAGTAGAGATGGG + Intronic
1136563495 16:31055486-31055508 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1137791989 16:51182907-51182929 TTCTAAGTGACATTAGGGAATGG + Intergenic
1137823317 16:51466077-51466099 TTTTATGTTTTTGTAGAGAAGGG + Intergenic
1137882175 16:52061375-52061397 TTCTATGTGCACATAGAGAATGG + Intronic
1138042962 16:53694264-53694286 TTTTATGTTTTAGTAGAGACGGG - Intronic
1139200179 16:64967389-64967411 TTTTGTGTTTTAGTAGAGAAGGG + Intronic
1139402302 16:66692732-66692754 TTCTATTTTTTAGTAGAGATGGG - Intronic
1139444387 16:66987912-66987934 TTCTTTGTTTTAGTAGAGACGGG + Intergenic
1139462932 16:67136979-67137001 TTCTATTTTTTAGTAGAGATGGG - Intronic
1140067477 16:71624104-71624126 TGCTCTGTGGGAGTAGAGAAAGG - Intergenic
1140335227 16:74098599-74098621 TTGTATGTTTTAGTAGAGACGGG + Intergenic
1140558954 16:75954830-75954852 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1140698595 16:77560099-77560121 TTGTATGTTTTAGTAGAGATGGG + Intergenic
1141358284 16:83370212-83370234 TTCTATTTTTTAGTAGAGATGGG - Intronic
1141394915 16:83696060-83696082 TTCTATTTGTTTGTAGAGATGGG + Intronic
1141768418 16:86073856-86073878 TTCAATGTGATAACAGACAAGGG + Intergenic
1142357232 16:89607173-89607195 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1142392217 16:89809077-89809099 TTCTATTTTTTAGTAGAGACGGG + Intronic
1142719039 17:1764009-1764031 TTTTATGTTTTAGTAGAGATGGG - Intronic
1142998705 17:3777132-3777154 TTCTATTTTTTAGTAGAGACAGG + Intronic
1143538284 17:7554788-7554810 TTTTATGTTTTAGTAGAGACGGG + Intronic
1143598153 17:7928067-7928089 TTCAATGTGATAAGAGGGAATGG - Intronic
1143739641 17:8942777-8942799 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1144374589 17:14626706-14626728 TTGCATGTGAGAGTAGAGTAGGG + Intergenic
1144477820 17:15603897-15603919 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1144743308 17:17596450-17596472 TTCTATTTTTTAGTAGAGACAGG + Intergenic
1144920474 17:18759786-18759808 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1145694732 17:26778762-26778784 TTTTGTATTATAGTAGAGAAGGG - Intergenic
1145949414 17:28804505-28804527 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1146037853 17:29423388-29423410 TTCTATTTTTTAGTAGAGACGGG + Intronic
1147060462 17:37873061-37873083 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1147128119 17:38386910-38386932 TTCTATTTTTTAGTAGAGACGGG - Intronic
1147406173 17:40213909-40213931 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1147600592 17:41742897-41742919 TTGTATGTTTTAGTAGAGACGGG + Intergenic
1147670472 17:42174127-42174149 TTTTGTGTTTTAGTAGAGAAGGG + Intronic
1148355201 17:46971164-46971186 TTTTATATGTTAGTAGAGATGGG - Intronic
1148409749 17:47455546-47455568 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1148410542 17:47462899-47462921 TTGTATGTTTTAGTAGAGACGGG + Intergenic
1148525140 17:48325073-48325095 TTGTATTTGTTAGTAGAGACGGG - Intronic
1148762734 17:50015729-50015751 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1149238567 17:54621463-54621485 TTTGATGTCAAAGTAGAGAAAGG - Intergenic
1149358517 17:55869202-55869224 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1149653015 17:58289507-58289529 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1150480133 17:65502879-65502901 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1150770056 17:68033303-68033325 TTGTATGTTTTAGTAGAGACAGG + Intergenic
1151401785 17:73860405-73860427 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1151482095 17:74375835-74375857 TTGTATTTGTTAGTAGAGATGGG - Intergenic
1151920493 17:77151204-77151226 TTATATGTCATAGGAGAAAATGG - Intronic
1151937377 17:77270897-77270919 TTCTATTTTTTAGTAGAGATGGG + Intergenic
1152031176 17:77844418-77844440 TTGTATGTTTTAGTAGAGAGGGG + Intergenic
1152167740 17:78721729-78721751 TTTTATAAGATAGTTGAGAAGGG - Intronic
1152647109 17:81474416-81474438 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1152666807 17:81575272-81575294 TTCTATTTTTTAGTAGAGACGGG + Intronic
1152676985 17:81646504-81646526 TTCTATTTTTTAGTAGAGACGGG - Intronic
1152704671 17:81836833-81836855 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1153897541 18:9580521-9580543 TTGTATTTGTTAGTAGAGACGGG + Intronic
1154017828 18:10635984-10636006 TTCTATTTTTTAGTAGAGACAGG + Intergenic
1154187041 18:12193599-12193621 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1154208906 18:12362168-12362190 TTCTCTGTGACAGTAGAGAAGGG - Intronic
1154216390 18:12419752-12419774 TTCTATTTTTTAGTAGAGAGGGG - Intronic
1154252548 18:12756374-12756396 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1154388726 18:13918500-13918522 TTTTATGTTTTAGTAGAGATGGG + Intergenic
1154509741 18:15084965-15084987 TTCTATGGAATAGAAGAGAAGGG + Intergenic
1154944180 18:21145304-21145326 TTATATTTGATACCAGAGAAGGG - Intergenic
1155291943 18:24351174-24351196 TTCTATTTTTTAGTAGAGACAGG - Intronic
1155750113 18:29412465-29412487 TTTTATGTTTTAGTAGAGACCGG + Intergenic
1156015548 18:32542957-32542979 TTCTATGTTTTAGTAGAGACAGG + Intergenic
1156142608 18:34133848-34133870 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1156205587 18:34882539-34882561 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1156645397 18:39155878-39155900 TTCCATTTTTTAGTAGAGAAAGG + Intergenic
1156869335 18:41927383-41927405 ATCAAGGTGATAGTAGATAAGGG - Intergenic
1157868111 18:51203932-51203954 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1157973407 18:52297735-52297757 TTCTATTTGTTTGTAGAGACAGG - Intergenic
1158343958 18:56495891-56495913 GTCCATGTGGTAGTACAGAAAGG + Intergenic
1158811056 18:61034941-61034963 TTCTATCTGGTATTAGAGATAGG - Intergenic
1159284479 18:66331549-66331571 TTGTATCTTTTAGTAGAGAAGGG - Intergenic
1159334605 18:67045707-67045729 TTGTATGTTTTAGTAGAGACAGG + Intergenic
1159520151 18:69509462-69509484 TTCTATTTTTTAGTAGAGACGGG - Intronic
1159664900 18:71145901-71145923 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1159710673 18:71755019-71755041 TTCTATCTGTTAGTAGAGACAGG - Intronic
1159713176 18:71789048-71789070 TTGTATTTGTTAGTAGAGATAGG - Intergenic
1160166469 18:76517270-76517292 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1160205756 18:76830040-76830062 TTTTGTGTGTTAGTAGAGATGGG + Intronic
1160280365 18:77484697-77484719 TTTTATTTTTTAGTAGAGAAGGG - Intergenic
1160751878 19:738217-738239 TTCTATTTTTTAGTAGAGACGGG - Intronic
1161252335 19:3286859-3286881 TTCTATTTTTTAGTAGAGACAGG - Intronic
1161338824 19:3729607-3729629 TTGTATTTGTTAGTAGAGATGGG - Intronic
1161461732 19:4401508-4401530 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1161472552 19:4466436-4466458 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1161671530 19:5614125-5614147 TTGTATGTTTTAGTAGAGACGGG + Intronic
1161859833 19:6789768-6789790 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1162216022 19:9134752-9134774 TTTTATGTTTTAGTAGAGACGGG + Intergenic
1162443780 19:10709673-10709695 TTCTATTTTTTAGTAGAGATGGG - Intronic
1162559696 19:11409305-11409327 TTCTATTTTTTAGTAGAGACGGG - Intronic
1162644894 19:12041614-12041636 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1162759412 19:12879930-12879952 TTGTATGTTTTAGTAGAGATGGG - Intronic
1163029560 19:14535332-14535354 TTCTATTTTTTAGTAGAGACGGG - Intronic
1163097930 19:15073888-15073910 TTGTATTTTTTAGTAGAGAAAGG - Intergenic
1163137408 19:15322534-15322556 TTGTATGTTTTAGTAGAGACGGG - Intronic
1164238378 19:23359394-23359416 TTGTATTTTTTAGTAGAGAAGGG + Exonic
1164612746 19:29644018-29644040 TTGTATTTTATAGTAGAGACGGG - Intergenic
1164754139 19:30677673-30677695 TTATATGTAATTGTAGAGACTGG + Intronic
1164780934 19:30891999-30892021 TGTTATGGGATATTAGAGAAGGG + Intergenic
1165235970 19:34421914-34421936 TTTTATATTATAGTAGAGACAGG - Intronic
1165500826 19:36187809-36187831 TTGTATCTTTTAGTAGAGAAGGG + Intronic
1166515552 19:43444095-43444117 TTGTATGTTTTAGTAGAGCAAGG + Intergenic
1166579493 19:43881783-43881805 TTGTATGTTTTAGTAGAGACAGG - Intronic
1166723840 19:45013310-45013332 TTGTATTTCTTAGTAGAGAAGGG + Intronic
1167221475 19:48201644-48201666 TTCTATTTTTTAGTAGAGACGGG + Intronic
1167337747 19:48897059-48897081 TTTTGTGTGTTAGTAGAGACGGG + Intronic
1167405692 19:49306713-49306735 TTGTATTTGTTAGTAGAGATGGG + Intronic
1167638900 19:50669335-50669357 TTCTATGGGATAGTGGAGCAGGG - Intronic
1168088638 19:54066939-54066961 TTTTGTGTGTTAGTAGAGACGGG - Intergenic
1168155060 19:54469165-54469187 TTGTATTTTATAGTAGAGATGGG + Intronic
1168326015 19:55538669-55538691 TTGTATGTTTTAGTAGAGACAGG + Intergenic
1168690976 19:58377331-58377353 TTCTATTTTTTAGTAGAGACGGG - Intronic
925314489 2:2910719-2910741 TTCCATGTTACAGTAGAGGAAGG + Intergenic
925749478 2:7074746-7074768 TTCTAGGTGGAAGAAGAGAAAGG + Intergenic
925881178 2:8353973-8353995 TTCTGTGTGAAAGTAGAGTCTGG + Intergenic
926432720 2:12805779-12805801 TTCTATTTGTTGGTAGAGACGGG - Intergenic
926437311 2:12851279-12851301 TACTATTTGATAGTACAGCAGGG + Intergenic
926470883 2:13256362-13256384 TTTTTTGTGATTGTATAGAATGG - Intergenic
927752496 2:25681965-25681987 TTGTATGTTTTAGTAGAGACAGG - Intergenic
927918852 2:26955987-26956009 TTCAATTTTATAGTAGAGACAGG + Intergenic
928246819 2:29637535-29637557 TTGTATTTTTTAGTAGAGAAGGG - Intronic
928525621 2:32136892-32136914 TTTTGTGTGAAAGAAGAGAAGGG + Exonic
928626893 2:33149039-33149061 TTCTATATTTTAGTAGAGACGGG - Intronic
929104173 2:38347648-38347670 TTGTAGGTGCTGGTAGAGAATGG - Intronic
929193920 2:39165701-39165723 TTGTATGTTTTAGTAGAGACAGG + Intergenic
929476901 2:42259901-42259923 TTGTATTTGTTAGTAGAGACGGG + Intronic
929623902 2:43386720-43386742 TTGTATGTTTTAGTAGAGATGGG - Intronic
930046835 2:47179953-47179975 TTGTATGTTTTAGTAGAGACAGG + Intergenic
930399074 2:50860380-50860402 TTATATATGATTTTAGAGAAGGG + Intronic
930594921 2:53375625-53375647 TTCTTTGTGACAGTTGTGAATGG - Intergenic
930666755 2:54106754-54106776 TTGTATGTTTTAGTAGAGACGGG + Intronic
931082178 2:58786306-58786328 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
931275119 2:60737689-60737711 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
931388875 2:61822521-61822543 ACATATGTGATAGTTGAGAAGGG + Intergenic
931420576 2:62123330-62123352 TTGTATTTTTTAGTAGAGAAGGG - Intronic
932155273 2:69411269-69411291 ATCTTTGTGATACTGGAGAAAGG + Intronic
932229956 2:70074939-70074961 TTCTATTTTTTAGTAGAGACAGG - Intergenic
933116313 2:78477701-78477723 TTGTATTTTTTAGTAGAGAATGG - Intergenic
933212044 2:79581352-79581374 TTCTGTATGTTAGTAGAGATGGG - Intronic
933273717 2:80261504-80261526 TTCTATGTAATAGGAGAGGCGGG + Intronic
933332274 2:80909109-80909131 TTCTATTTTTTAGTAGAGACGGG + Intergenic
933490536 2:82980808-82980830 TTCTATTTTTTAGTAGAGACAGG - Intergenic
933810458 2:86029771-86029793 TTGTATTTTTTAGTAGAGAAGGG + Intronic
934675600 2:96247543-96247565 TTGTATTTTTTAGTAGAGAATGG - Intergenic
935528407 2:104201480-104201502 TTATATGAGATAAAAGAGAAGGG - Intergenic
935680488 2:105632155-105632177 CTCTGTGTCATAGTAGAAAATGG + Intergenic
935994795 2:108758123-108758145 TTTTGTGTAATAGTAGAGATGGG - Intronic
936027950 2:109047635-109047657 TTGTATGTTTTAGTAGAGATGGG - Intergenic
936140955 2:109939643-109939665 TTCAAAGAGATACTAGAGAAAGG + Intergenic
936177646 2:110237588-110237610 TTCAAAGAGATACTAGAGAAAGG + Intergenic
936203738 2:110431843-110431865 TTCAAAGAGATACTAGAGAAAGG - Intronic
936269611 2:111039547-111039569 TTCTACGTGTCAGTAGACAAAGG - Intronic
936625865 2:114148785-114148807 TTCTATTTTTTAGTAGAGACGGG - Intergenic
936821163 2:116523171-116523193 TTCTTTGTGACAGTTGTGAATGG + Intergenic
937105236 2:119306130-119306152 TTCTATGTAAGAGTGAAGAACGG + Intronic
937543993 2:122991817-122991839 TTGTATTTTTTAGTAGAGAAAGG - Intergenic
937620950 2:123984469-123984491 TTGTATGTTTTAGTAGAGATGGG + Intergenic
938154136 2:128915409-128915431 TTCCCTGTGATAAGAGAGAAGGG - Intergenic
938396088 2:130949525-130949547 TTCTATTTTTTAGTAGAGACAGG + Intronic
938624506 2:133093755-133093777 TACTATTTGATAGAGGAGAAGGG + Intronic
939108010 2:137972276-137972298 TTGTATTTTTTAGTAGAGAAGGG + Intronic
939922168 2:148129320-148129342 TTCTATTTTTTAGTAGAGACAGG - Intronic
940010647 2:149051336-149051358 TTCTATTTTTTAGTAGAGATGGG + Intronic
940161666 2:150720287-150720309 TTGTATGTTTTAGTAGAGATGGG - Intergenic
941421724 2:165291213-165291235 TTCTATTTTTTAGTAGAGATGGG + Intronic
942287538 2:174435643-174435665 TTGTATTTTATAGTAGAGACGGG + Exonic
942558073 2:177191955-177191977 TTCTATTTTTTAGTAGAGACGGG + Intergenic
942801084 2:179876526-179876548 TTCTCTGTTATAGGGGAGAATGG + Intergenic
943000212 2:182318123-182318145 ATGTTTGTGAAAGTAGAGAAAGG - Intronic
943032447 2:182701551-182701573 TTGTATTTTATAGTAGAGACGGG + Intergenic
943218183 2:185066540-185066562 TGCTATGTGAAAGATGAGAAAGG - Intergenic
943448917 2:188023938-188023960 TTCTATTTTTTAGTAGAGACGGG + Intergenic
943720262 2:191196765-191196787 TTCTATTTTTTAGTAGAGACGGG - Intergenic
943844643 2:192629652-192629674 TTCTATTTTTTAGTAGAGACGGG - Intergenic
944139154 2:196436225-196436247 TTCTATTTTGTAGTAGAGATGGG - Intronic
945295446 2:208166821-208166843 TTCTATTTTTTAGTAGAGATGGG + Intronic
945406211 2:209451868-209451890 TTCTTTGTGAGAGTAGAGAGAGG - Intronic
945503560 2:210609237-210609259 TTCTGTGTGAGAGGAAAGAAAGG + Intronic
945955935 2:216085697-216085719 TTGTATTTTTTAGTAGAGAAGGG - Intronic
946351336 2:219156073-219156095 TTCTATTTTTTAGTAGAGACAGG - Intronic
946612650 2:221476045-221476067 TTCTATTTTTTAGTAGAGATGGG - Intronic
946839236 2:223803704-223803726 TTCTATTTTTTAGTAGAGACTGG - Intronic
946948610 2:224848458-224848480 TTCTATGTGTTAGAGCAGAATGG + Intronic
946950054 2:224864334-224864356 TTGTATTTTATAGTAGAGATGGG - Intronic
947015109 2:225610619-225610641 AACTATGGGATAGTATAGAATGG + Intronic
947435558 2:230069091-230069113 TTCTCTGAGATGGGAGAGAAGGG + Intergenic
947679547 2:232017565-232017587 TCCTATGTGAAACAAGAGAAGGG - Intronic
947906637 2:233768753-233768775 TTGTATTTTTTAGTAGAGAAAGG + Intronic
948050820 2:234978125-234978147 TTGTATTTTTTAGTAGAGAAGGG + Intronic
948265942 2:236635443-236635465 TTCTATTTTTTAGTAGAGACGGG + Intergenic
949011752 2:241683884-241683906 TTTTATGTTTTAGTAGAGACAGG - Intronic
1170674738 20:18468246-18468268 TTTTATGTTTTAGTAGAGACGGG + Intronic
1170898104 20:20434762-20434784 TTTAATGTGTTAGTAGAGACGGG - Intronic
1172496463 20:35388891-35388913 TTATATTTTTTAGTAGAGAAGGG - Intronic
1172521198 20:35567115-35567137 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1172521618 20:35570503-35570525 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1173392683 20:42648990-42649012 TTCTATTTTTTAGTAGAGATGGG + Intronic
1173435255 20:43026656-43026678 TACTATGTGATAGTACAACAGGG - Intronic
1173881698 20:46418454-46418476 TTCTATTTTTTAGTAGAGACGGG + Intronic
1173912301 20:46679383-46679405 TTGTATTTGTTAGTAGAGACAGG - Intronic
1174232709 20:49059704-49059726 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1174317876 20:49716678-49716700 TTGTATGTTTTAGTAGAGATGGG - Intergenic
1174350194 20:49961946-49961968 TTCTATTTTTTAGTAGAGACCGG + Intergenic
1174509444 20:51040088-51040110 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1176788326 21:13286818-13286840 TTCTATGGAATAGAAGAGAAGGG - Intergenic
1177256421 21:18669061-18669083 TTGTATGTTTTAGTAGAGACAGG - Intergenic
1177412439 21:20747618-20747640 TGCTATATAATAATAGAGAAAGG - Intergenic
1177987474 21:27995018-27995040 TTCTATGGAATAGAAGAGAAGGG - Intergenic
1178209432 21:30511796-30511818 TTGTATGTTTTAGTAGAGACAGG - Intergenic
1178566428 21:33690424-33690446 TTCTATTTTTTAGTAGAGACGGG - Intronic
1178851180 21:36213617-36213639 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1178863591 21:36309488-36309510 TTGTATGTTTTAGTAGAGACAGG + Intergenic
1178887462 21:36495154-36495176 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1180192781 21:46174154-46174176 TTCTATTTTTTAGTAGAGATGGG - Intronic
1180631169 22:17231083-17231105 TTCTATTTTTTAGTAGAGATGGG + Intergenic
1180893637 22:19310784-19310806 TTGTATGTTTTAGTAGAGACAGG - Intergenic
1181779413 22:25182002-25182024 TTCTATTTTTTAGTAGAGACGGG - Intronic
1181816418 22:25440582-25440604 TTATATGTTTTAGTAGAGACGGG + Intergenic
1182334716 22:29576189-29576211 TTGTATGTTTTAGTAGAGACGGG + Intronic
1182479772 22:30600159-30600181 TTTTATGTTTTAGTAGAGATGGG - Intronic
1182496660 22:30713250-30713272 TTCTATTTTTTAGTAGAGACAGG + Intronic
1182640137 22:31760375-31760397 TTCTATTTTTTAGTAGAGAAGGG + Intronic
1183634897 22:39055539-39055561 TTCTATTTTTTAGTAGAGATGGG + Intronic
1183800750 22:40162265-40162287 TTCTATTTTTTAGTAGAGACGGG + Intronic
1183830265 22:40415128-40415150 TTCTAAGGGATGGCAGAGAAAGG - Intronic
1183869431 22:40729952-40729974 TTGTATTTGTTAGTAGAGACGGG - Intergenic
1184027345 22:41867631-41867653 TTCTATTTTTTAGTAGAGATGGG - Intronic
1184051508 22:42008950-42008972 TTCTATTTTTTAGTAGAGACGGG + Intronic
1184543105 22:45142991-45143013 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1184626133 22:45731850-45731872 TTTTCTGTGATAGGAAAGAAAGG + Intronic
1185348562 22:50321533-50321555 TTCTATTTTTTAGTAGAGACAGG + Intronic
949782129 3:7701474-7701496 TTGTATGTTTTAGTAGAGACAGG + Intronic
949819342 3:8099296-8099318 TTCAATGAGATCATAGAGAAGGG - Intergenic
950059041 3:10054037-10054059 TTCTATGTTTTTGTAGAGATGGG - Intronic
950083766 3:10241727-10241749 TTTTGTGTTTTAGTAGAGAAGGG - Intronic
950369784 3:12519570-12519592 TTATATTTTTTAGTAGAGAAGGG - Intronic
950409918 3:12829316-12829338 TTATATGTTTTAGTAGAGACAGG + Intronic
950795165 3:15504685-15504707 TTGTATTTTTTAGTAGAGAAGGG - Intronic
951014956 3:17721010-17721032 TTGTATTTGTTAGTAGAGACAGG + Intronic
951417927 3:22447943-22447965 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
951606722 3:24442650-24442672 TTGTATTTTTTAGTAGAGAAGGG - Intronic
951866831 3:27317974-27317996 TTCTATTTTTTAGTAGAGACGGG + Intronic
951928687 3:27939141-27939163 TACTAGGTGATAGGAGACAAAGG + Intergenic
952053405 3:29413948-29413970 GTCTATGTGTAATTAGAGAAGGG - Intronic
952094305 3:29930283-29930305 TTCTATTTTTTAGTAGAGACGGG + Intronic
952107988 3:30091441-30091463 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
952146866 3:30542744-30542766 TTGTATGTTTTAGTAGAGACGGG - Intergenic
953425358 3:42792498-42792520 TTCTATCTTTTAGTAGAGACAGG - Intronic
953491961 3:43360234-43360256 TTCTATTTTTTAGTAGAGACAGG - Intronic
953950387 3:47184982-47185004 TTCTATTTTTTAGTAGAGATGGG + Intergenic
954120212 3:48493702-48493724 TTCTATTTTTTAGTAGAGATGGG + Intronic
954174576 3:48833862-48833884 TTGTATTTTTTAGTAGAGAAGGG - Intronic
954210919 3:49096624-49096646 TTCTATTTTTTAGTAGAGACGGG - Intronic
954471404 3:50699087-50699109 TTCTATGTGATAGTAGAGAAGGG + Intronic
954486107 3:50853100-50853122 TAGTATGTGATAGTACAGTAGGG - Intronic
955005988 3:54969430-54969452 TTGTATGTTTTAGTAGAGATGGG + Intronic
955633021 3:60995145-60995167 TTCTATTTCTTAGTAGAGACAGG - Intronic
955895519 3:63695302-63695324 TTCTATTTATTAGTAGAGACGGG - Intergenic
956133503 3:66076272-66076294 TTTTATTTGATTGTAGAGATGGG - Intergenic
956189541 3:66595689-66595711 TTTTGTGTTATAGTAGAGACGGG - Intergenic
956329029 3:68084624-68084646 TTGTATGTTTTAGTAGAGATGGG - Intronic
956646255 3:71460105-71460127 TTCTATTTTTTAGTAGAGACGGG + Intronic
957165922 3:76673922-76673944 ATCTATGTAATAGAATAGAATGG + Intronic
957267384 3:77984447-77984469 TTCTATGTGATAGCACAATAGGG - Intergenic
957877208 3:86162999-86163021 TTGTATTTGATAGTATAGTAGGG + Intergenic
957953906 3:87159710-87159732 TTCTATTTTTTAGTAGAGATGGG - Intergenic
957988609 3:87602873-87602895 TTCTATTTTTTAGTAGAGACGGG + Intergenic
958035428 3:88164698-88164720 TTCTATTTTTTAGTAGAGATGGG + Intronic
960268573 3:115649525-115649547 ATCAATGTGACAGTAAAGAAGGG + Intronic
960311743 3:116125115-116125137 TCCTACTTGAAAGTAGAGAATGG + Intronic
960342417 3:116490116-116490138 TTGTATGTTTTAGTAGAGATGGG - Intronic
960645650 3:119879352-119879374 TTCTATTTTTTAGTAGAGATGGG + Intronic
960655039 3:119994033-119994055 TTCTATTTTTTAGTAGAGACGGG + Intronic
961694430 3:128694592-128694614 TTCTATTTTTTAGTAGAGAGGGG + Intergenic
962521215 3:136199125-136199147 TTGTATTTTTTAGTAGAGAAAGG - Intergenic
962649654 3:137475763-137475785 TTCTATTTTTTAGTAGAGATGGG + Intergenic
962726739 3:138235977-138235999 TTCTATATTTTAGTAGAGACAGG + Intronic
962795873 3:138849072-138849094 TTCTATTTTTTAGTAGAGACAGG - Intergenic
963199673 3:142573272-142573294 TTCTATCTTTTAGTAGAGAAAGG - Intronic
963232028 3:142917299-142917321 TTGTATGTTTTAGTAGAGATGGG + Intergenic
963333328 3:143941476-143941498 TTGTATATGATAGCAGATAAGGG - Intergenic
963909616 3:150804978-150805000 TGCTATGGGTTAGTAGATAATGG + Intergenic
964311297 3:155396029-155396051 TTCTATTTTTTAGTAGAGACAGG - Intronic
964311314 3:155396164-155396186 TTCTATTTTTTAGTAGAGACAGG - Intronic
964351999 3:155812211-155812233 ATGTATGTGTTAGTAGAGGAAGG - Intergenic
964619850 3:158710379-158710401 TTCTATTTTTTAGTAGAGACGGG + Intronic
965168848 3:165234177-165234199 TTCTTTGTTTTAGTAGAGACAGG + Intergenic
965395784 3:168159304-168159326 TGCGATGTGACAGTAGAGCAGGG + Intergenic
965575203 3:170210873-170210895 TTGTATGTTTTAGTAGAGACGGG - Intergenic
965722825 3:171680405-171680427 TTGTATTTGATAGTAGAGACAGG + Intronic
966720254 3:183055228-183055250 TTCTATTTTTTAGTAGAGACGGG - Intronic
966845604 3:184127266-184127288 TTGTATTTGATAGTACAGTAGGG - Intergenic
968157722 3:196396587-196396609 TTCTATTTTTTAGTAGAGATGGG - Intronic
968231257 3:197006045-197006067 TTCTATTTTTTAGTAGAGAAGGG - Intronic
968315085 3:197717268-197717290 TTCTATTTTTTAGTAGAGACGGG - Intronic
968440214 4:619728-619750 TTCTATTTTTTAGTAGAGACGGG + Intergenic
969399595 4:6945157-6945179 TTCCATGTGAAAGGAGACAAGGG + Intronic
969698541 4:8750473-8750495 TTCTATTTTTTAGTAGAGACGGG - Intergenic
969994037 4:11293283-11293305 TTCTATATTTTAGTAGAGATGGG - Intergenic
970519888 4:16871791-16871813 TTGTATTTTTTAGTAGAGAAGGG + Intronic
970843757 4:20510863-20510885 TTATATGGGAAAGTAGACAATGG + Intronic
971116931 4:23659503-23659525 TTCTATTTTTTAGTAGAGACGGG + Intergenic
971206075 4:24570589-24570611 TTCTATCTAATAGCAGAAAATGG + Intronic
971287040 4:25300845-25300867 TTCTATTTTTTAGTAGAGACGGG + Intergenic
971305319 4:25474992-25475014 TTCTGTGTCTTAGCAGAGAAAGG - Intergenic
971448519 4:26778240-26778262 TTCTATTTTTTAGTAGAGACGGG - Intergenic
971585820 4:28404482-28404504 TTCTATTTTTTAGTAGAGACGGG + Intergenic
971903922 4:32700911-32700933 TTCTATGTGATAAAACATAAAGG + Intergenic
972465389 4:39351075-39351097 TTCTATTTTTTAGTAGAGACGGG - Intronic
972562010 4:40237279-40237301 TTGTATTTTTTAGTAGAGAAGGG - Intronic
972650329 4:41011600-41011622 TTTAATGTTTTAGTAGAGAAGGG + Intronic
972773245 4:42218042-42218064 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
972802708 4:42494028-42494050 TTTTTTGTTTTAGTAGAGAAGGG - Intronic
972995287 4:44871318-44871340 TTTTATGTGAAAGCCGAGAATGG - Intergenic
973023412 4:45233831-45233853 TTCTATGTTTTAGAAGAGACAGG + Intergenic
973050600 4:45591472-45591494 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
973348692 4:49084471-49084493 TTCTATTTTTTAGTAGAGACGGG - Intergenic
974646121 4:64695021-64695043 CTCTATGTGAGAGAAGAGCATGG - Intergenic
974801332 4:66822958-66822980 TTGTATGTTTTAGTAGAGACGGG + Intergenic
975171658 4:71238849-71238871 CTCTAGGTGATAGTATAAAACGG + Intronic
975372441 4:73604299-73604321 TTCTATTTTTTAGTAGAGATGGG - Intronic
975705382 4:77107087-77107109 TTGTATATGATAGGAGATAAGGG - Intergenic
975742977 4:77448489-77448511 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
976006480 4:80436473-80436495 TTGTATGTTTTAGTAGAGACGGG + Intronic
976190496 4:82482180-82482202 TTGTATGTTTTAGTAGAGACAGG + Intergenic
976306358 4:83563879-83563901 TTCTAAGTAATAATAGAGAAAGG - Intronic
976387983 4:84482410-84482432 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
976711211 4:88073351-88073373 TTCTATTTTTTAGTAGAGATGGG - Intronic
976726965 4:88224262-88224284 TTGTATTTTTTAGTAGAGAAGGG - Intronic
977509889 4:97950169-97950191 TTATTTGAGATACTAGAGAAAGG - Intronic
977590793 4:98824308-98824330 TTCAATGAAATAGTAGAGAGTGG + Intergenic
977806194 4:101300621-101300643 TTCTATTTTTTAGTAGAGAGAGG - Intronic
977868962 4:102066428-102066450 TTCTATTTTTTAGTAGAGACGGG + Intronic
979108217 4:116715305-116715327 TTCTATTTTTTAGTAGAGACGGG - Intergenic
979252301 4:118578357-118578379 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
979466061 4:121039837-121039859 TTCTATGTGTTAGTAAGAAAAGG - Intronic
979526294 4:121720796-121720818 TTGTATGTTTTAGTAGAGATGGG + Intergenic
979532165 4:121780354-121780376 TTTTATTTGTTTGTAGAGAAGGG - Intergenic
980186940 4:129474547-129474569 TTCAAGGAGATACTAGAGAATGG - Intergenic
980740382 4:136942583-136942605 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
980750452 4:137080221-137080243 TTGTATGTTTTAGTAGAGACGGG + Intergenic
981029811 4:140113103-140113125 TTCTATTTTTTAGTAGAGATGGG - Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981286291 4:143023009-143023031 TTCTATTTTGTGGTAGAGAAAGG - Intergenic
981401708 4:144321438-144321460 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
981535146 4:145792025-145792047 TTCTATGACAAAGTAGATAAAGG + Intronic
981951102 4:150408810-150408832 TTCTATGTGATATTGGAATAGGG - Intronic
982604679 4:157499550-157499572 TACTATTTGATAGTACAGTAGGG + Intergenic
982970418 4:161977437-161977459 TTCTATTTTTTAGTAGAGACGGG - Intronic
983199580 4:164846206-164846228 TAATATTTGATAGTAGAGTAGGG + Intergenic
983219274 4:165028964-165028986 TTGTTTGTTTTAGTAGAGAAGGG - Intergenic
983219491 4:165031035-165031057 TTCTATTTTTTAGTAGAGACGGG - Intergenic
983370209 4:166848856-166848878 ATCCATGTGATAGTACAGAAAGG - Intronic
983493437 4:168415984-168416006 TTCTATGTTATGATGGAGAAAGG - Intronic
983731620 4:171000829-171000851 TTGTATGTTTTAGTAGAGATGGG - Intergenic
983807013 4:172006454-172006476 TTCTATTTTATTGTAAAGAAAGG - Intronic
984385547 4:179052390-179052412 TTTTTTCTGATGGTAGAGAAAGG + Intergenic
984532218 4:180930862-180930884 TTGTATTTGTTAGTAGAGACGGG - Intergenic
985232446 4:187835630-187835652 TTTTCTGTAATAGTACAGAAAGG + Intergenic
985608913 5:875519-875541 TTCTATTTTTTAGTAGAGACGGG + Intronic
985673264 5:1217219-1217241 GTGTGTGTGATAGGAGAGAATGG - Intronic
985931364 5:3060061-3060083 TTCTATTTTTTAGTAGAGATGGG - Intergenic
987416172 5:17663867-17663889 TTCTATTTTTTAGTAGAGATGGG + Intergenic
987658841 5:20845998-20846020 TTGTATGTGATAGTTGTGGAGGG + Intergenic
987670382 5:20999444-20999466 TTCTATTTTTTAGTAGAGACGGG + Intergenic
987704176 5:21442647-21442669 TCCTATGTTTTAGTAGAGACGGG + Intergenic
987801060 5:22697396-22697418 TTCTATTTTTTAGTAGAGACGGG - Intronic
988433632 5:31148552-31148574 TTCTGTATTTTAGTAGAGAAAGG - Intergenic
988650001 5:33138576-33138598 TTCTATTTTTTAGTAGAGACGGG + Intergenic
988764840 5:34359970-34359992 TTGTATGTGATAGTTGTGGAGGG - Intergenic
989061977 5:37418491-37418513 TTCTATTTTTTAGTAGAGACGGG + Intronic
989064016 5:37441643-37441665 TTGTATTTTTTAGTAGAGAAGGG - Intronic
989409934 5:41108176-41108198 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
989610279 5:43284307-43284329 TACTATTTGATAGCAGAGCAGGG - Intergenic
990398490 5:55410041-55410063 TTTTATATTATAGTAGAGATGGG - Intronic
990475777 5:56160410-56160432 TTCTATTTTTTAGTAGAGACGGG + Intronic
990634588 5:57710330-57710352 TTCTCTGTGTTTGTAGAAAATGG + Intergenic
992135227 5:73737686-73737708 TTGTATTTTTTAGTAGAGAAGGG + Intronic
992560796 5:77950883-77950905 TTCTATGTGTTAGAACAGGAAGG - Intergenic
992595961 5:78347597-78347619 TTCTATTTTTTAGTAGAGACGGG + Intergenic
992670685 5:79057576-79057598 CTCCATGTGGAAGTAGAGAAGGG + Intronic
992687289 5:79211131-79211153 TTTTTTGTGTTAGTAGAGACGGG + Intronic
992856139 5:80863495-80863517 TTCTATTTTTTAGTAGAGACGGG - Intronic
992930219 5:81635755-81635777 TTCTATTTTTTAGTAGAGACGGG + Intronic
993229870 5:85220928-85220950 TTTTATGTTTTAGTAGAGATGGG + Intergenic
993295535 5:86134048-86134070 TTGTATGTTTTAGTAGAGACGGG - Intergenic
993518088 5:88862830-88862852 TTCTATGGCATACCAGAGAATGG + Intronic
993858497 5:93104728-93104750 TTCTGTCTGAGTGTAGAGAATGG - Intergenic
994417827 5:99497472-99497494 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
994462137 5:100077684-100077706 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
995157137 5:108929215-108929237 TTGTTTGTGATAGTAAAAAAGGG + Intronic
995352153 5:111191294-111191316 TTGTATGGGACAGTAGAGACTGG - Intergenic
995842908 5:116461380-116461402 TTAAATGTGAGAGTAGAGCAAGG - Intronic
995888330 5:116920953-116920975 TTGTATTTTATAGTAGAGATGGG + Intergenic
996858043 5:128031823-128031845 TTCTATTTTTTAGTAGAGACAGG - Intergenic
996879590 5:128280656-128280678 GTTTCTGTGATATTAGAGAAAGG + Intronic
997058765 5:130476800-130476822 TTCAAGGAGATATTAGAGAAGGG - Intergenic
997246389 5:132353348-132353370 TTGTATTTTTTAGTAGAGAACGG + Intergenic
997460106 5:134046199-134046221 TTCTATTTTTTAGTAGAGACGGG + Intergenic
997460440 5:134048139-134048161 TTCTATTTTTTAGTAGAGACGGG + Intergenic
997572150 5:134938626-134938648 TTGTGTGTGAGAGTGGAGAAGGG + Intronic
998221343 5:140283404-140283426 TTCTATTTTTTAGTAGAGACAGG + Intronic
998227043 5:140335208-140335230 TTCTATTTTTTAGTAGAGACGGG - Intronic
998440165 5:142153561-142153583 TTATATTTGATAATAGAGAAGGG + Exonic
998810920 5:145965019-145965041 TTTTATGTTTTAGTAGAGACGGG - Intronic
999454646 5:151705013-151705035 TTGTATTTGTTAGTAGAGACGGG - Intergenic
999818071 5:155197790-155197812 TTCTAAATGATAGTGGAGATGGG - Intergenic
1000148947 5:158481050-158481072 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1000304281 5:159981667-159981689 TTCTATTTTTTAGTAGAGATGGG + Intergenic
1000826934 5:166056493-166056515 ATCCATGAGATAGCAGAGAAAGG - Intergenic
1001263043 5:170249148-170249170 TTCTATTTTCTAGTAGAGACAGG - Intronic
1001279469 5:170376334-170376356 TTCTATTTTTTAGTAGAGACAGG + Exonic
1001392644 5:171392109-171392131 TTCATAGTTATAGTAGAGAAGGG + Intronic
1001623187 5:173106254-173106276 TTCTATTTTTTAGTAGAGACAGG - Intronic
1001973310 5:175974927-175974949 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1002012795 5:176297327-176297349 TTCTATTTTTTAGTAGAGACAGG - Intronic
1002022909 5:176376186-176376208 TTGTATTTTATAGTAGAGACAGG - Exonic
1002244127 5:177868856-177868878 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1003201425 6:3964862-3964884 TTGTATGTATTAGTAGAGATGGG + Intergenic
1003915389 6:10782032-10782054 TTGTATGTTTTAGTAGAGACGGG - Intronic
1004284127 6:14304956-14304978 TACTAGGTGATAGCATAGAATGG + Intergenic
1004385882 6:15172413-15172435 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1004518792 6:16343169-16343191 TTCTATTTTTTAGTAGAGACAGG - Intronic
1004667134 6:17758554-17758576 TTCCATGGGAAAGGAGAGAAGGG - Intergenic
1004734817 6:18394782-18394804 TACTATCTGATAGGAAAGAATGG - Intronic
1004848887 6:19676187-19676209 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1005085857 6:22005845-22005867 TTCTATTTTTTAGTAGAGATGGG + Intergenic
1005585311 6:27270950-27270972 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1005891813 6:30146582-30146604 TTCTATATTTTAGTAGAGATGGG + Intronic
1005979448 6:30825342-30825364 TTGTATTTTATAGTAGAGACGGG + Intergenic
1006134111 6:31885302-31885324 TTCTATTTTTTAGTAGAGACAGG - Intronic
1006232963 6:32600847-32600869 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1006465806 6:34194124-34194146 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1006481355 6:34297103-34297125 TTCTATTTTTTAGTAGAGACAGG + Intronic
1006674275 6:35751083-35751105 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1006769768 6:36543236-36543258 TTCTATTTTTTAGTAGAGACAGG + Intronic
1006869224 6:37235537-37235559 TTCTATTTTTTAGTAGAGATGGG + Intronic
1006960517 6:37925529-37925551 TTCTATTTTTTAGTAGAGACAGG - Intronic
1006980059 6:38140431-38140453 TTCTAAGTGATAATTGAAAAGGG + Intronic
1007687056 6:43673299-43673321 TTCTAGGTGACAGAAGAGTAAGG + Intronic
1007692565 6:43712192-43712214 TTCAATGAGATAGTAGAGGCTGG + Intergenic
1007788091 6:44293097-44293119 TTCAATGGGATAGCTGAGAATGG + Intronic
1007923514 6:45631945-45631967 TTCTATTTTTTAGTAGAGACGGG + Intronic
1008025348 6:46629699-46629721 TTCTATCTGTTAGAAGAAAAAGG + Intronic
1008256516 6:49308164-49308186 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1008301133 6:49841342-49841364 TTCTCTGGGATAGGAGAGATGGG + Intronic
1008309579 6:49950177-49950199 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1008863304 6:56177619-56177641 TTCTATTTTTTAGTAGAGAACGG - Intronic
1009511437 6:64554256-64554278 TTCTATGGTATAGCAGAAAATGG - Intronic
1009728243 6:67562358-67562380 TTCTATTTGATAGAAAAGAAAGG + Intergenic
1009753404 6:67902178-67902200 TTCTATTTTTTAGTAGAGACAGG + Intergenic
1009829882 6:68916628-68916650 TTGTATTTGATAGTCGGGAAGGG + Intronic
1009881715 6:69575276-69575298 TTTTGTATGTTAGTAGAGAAGGG - Intergenic
1009968309 6:70600971-70600993 TTCTTTTTTAAAGTAGAGAAAGG - Intergenic
1010109824 6:72213598-72213620 TTGTATGAGATAGTAAAGCATGG - Intronic
1010141249 6:72617498-72617520 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1010215909 6:73401627-73401649 TTGTATTTTATAGTAGAGACGGG - Intronic
1010453422 6:76028654-76028676 TTCTATTTTTTAGTAGAGACGGG - Intronic
1011145737 6:84214103-84214125 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1011232927 6:85183660-85183682 TTGTATGTTTTAGTAGAGACGGG + Intergenic
1011427146 6:87241589-87241611 TTGTATGTTTTAGTAGAGATGGG + Intronic
1011582254 6:88882066-88882088 TAGTATGTGATAGTAAAGACAGG - Intronic
1012281498 6:97332756-97332778 TTGTATGTTTTAGTAGAGACAGG - Intergenic
1012587619 6:100943441-100943463 TTTTTTATGATAGCAGAGAATGG - Intergenic
1013384213 6:109608397-109608419 TGATATATGATAGTGGAGAAAGG + Intronic
1013532107 6:111029656-111029678 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1013866927 6:114709742-114709764 TTCTATTTTATAGTAAATAAAGG - Intergenic
1014497092 6:122138835-122138857 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1014629116 6:123767594-123767616 TTCTATGTTTTTGTAGAGATGGG - Intergenic
1014642694 6:123932588-123932610 TTCTATTTTTTAGTAGAGACGGG + Intronic
1014838882 6:126193664-126193686 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1014908840 6:127064461-127064483 TTCTATTTTTTAGTAGAGACAGG + Intergenic
1015029342 6:128575502-128575524 TTGTATTTTTTAGTAGAGAAAGG - Intergenic
1016032011 6:139347598-139347620 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1016087782 6:139936005-139936027 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1016547660 6:145242330-145242352 TTCTATTTTTTAGTAGAGATTGG + Intergenic
1016549997 6:145269109-145269131 TTGTATGTTTTAGTAGAGACGGG + Intergenic
1016723737 6:147334160-147334182 GTCTGTGTGATATTAGTGAAGGG + Exonic
1016802987 6:148185211-148185233 TTTTATGTTTTAGTAGAGATGGG + Intergenic
1016827587 6:148402780-148402802 TTCTATTTTTTAGTAGAGACAGG + Intronic
1017172732 6:151472955-151472977 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1017721309 6:157245144-157245166 TTGTATTTTTTAGTAGAGAACGG - Intergenic
1017802196 6:157907455-157907477 TTGTATTTTATAGTAGAGACGGG + Intronic
1017898275 6:158700082-158700104 TTGTATTTCTTAGTAGAGAAGGG - Intronic
1017993123 6:159507049-159507071 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1018098236 6:160412188-160412210 TTCTATTTTTTAGTAGAGATGGG - Intronic
1018465373 6:164039471-164039493 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1018589114 6:165397536-165397558 TTCTATTTTTTAGTAGAGACAGG - Intronic
1018638661 6:165886802-165886824 TTCCCTGAGATACTAGAGAAAGG - Intronic
1019773752 7:2899850-2899872 TTGTATGTTTTAGTAGAGATGGG + Intergenic
1020188715 7:5977944-5977966 TTCTATTTTTTAGTAGAGACGGG - Intronic
1020294200 7:6746827-6746849 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1020825591 7:13023992-13024014 GTCTATCTGAAAGGAGAGAATGG + Intergenic
1020939256 7:14510000-14510022 TTCTATTTTTTAGTAGAGACGGG - Intronic
1021462434 7:20903529-20903551 TTCTATAAGATATAAGAGAATGG + Intergenic
1021544959 7:21803438-21803460 TTCAAAGAGACAGTAGAGAAAGG + Intronic
1021708233 7:23389331-23389353 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1021729142 7:23579503-23579525 TTGTATGTTTTAGTAGAGATGGG + Intergenic
1022873726 7:34506476-34506498 TTCTATTTTTTAGTAGAGACAGG + Intergenic
1024208980 7:47187686-47187708 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1024847169 7:53659993-53660015 TTATATGTGGAAGTAAAGAATGG + Intergenic
1024999273 7:55301089-55301111 TTGTATTTGTTAGTAGAGACAGG + Intergenic
1025034565 7:55585697-55585719 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1025061405 7:55811668-55811690 TTCTGTTTTTTAGTAGAGAAGGG + Intronic
1025981507 7:66411027-66411049 TTGTATTTCATAGTAGAGACAGG - Intronic
1025991535 7:66501146-66501168 TTCTATTTTTTAGTAGAGACAGG + Intergenic
1026052044 7:66955089-66955111 TTTTAACTGTTAGTAGAGAAGGG - Intronic
1026210140 7:68296741-68296763 TTCTAGGGGATAGTAGAGTGTGG - Intergenic
1026571009 7:71530739-71530761 TTCTATTTTTTAGTAGAGACGGG + Intronic
1026602962 7:71791834-71791856 TTCTATGTTTTAGTAGAGACAGG - Intronic
1026605874 7:71815428-71815450 TGTTATGTGAAAGAAGAGAAAGG - Intronic
1027002830 7:74666010-74666032 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1027309452 7:76939291-76939313 TTCTTTCTTATTGTAGAGAAGGG - Intergenic
1027410794 7:77915382-77915404 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1027750189 7:82133897-82133919 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1027865249 7:83638115-83638137 TGCTATGTTATCATAGAGAAAGG - Intronic
1027907619 7:84206493-84206515 TTCTATTTTTTAGTAGAGACAGG + Intronic
1029011301 7:97264551-97264573 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1029017865 7:97332933-97332955 TTGTATGTTTTAGTAGAGACGGG - Intergenic
1029354668 7:100042971-100042993 TTGTATGTTTTAGTAGAGACGGG + Intergenic
1029541592 7:101186157-101186179 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1029798837 7:102924812-102924834 TTCTATTTTTTAGTAGAGACGGG + Intronic
1030112022 7:106034904-106034926 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1030285450 7:107822019-107822041 TTGTATGTTTTAGTAGAGACAGG - Intergenic
1030302392 7:107987671-107987693 TTCTATTTTTTAGTAGAGATGGG + Intronic
1030332284 7:108284016-108284038 TTCTATTTTTTAGTAGAGACGGG + Intronic
1030368356 7:108671513-108671535 TTGTATATGTTAGTAGAGACAGG - Intergenic
1030413790 7:109214269-109214291 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1030810813 7:113970251-113970273 TTGTATGTTTTAGTAGAGACGGG - Intronic
1030955105 7:115842960-115842982 TTCTATATGATAGTTGAAACAGG - Intergenic
1031012034 7:116534571-116534593 TTCTATTTTTTAGTAGAGACAGG + Intronic
1031054229 7:116976087-116976109 TTGTATGTTTTAGTAGAGAAGGG - Intronic
1031133483 7:117860514-117860536 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1031835731 7:126679856-126679878 TTCTATTTTTTAGTAGAGATGGG - Intronic
1032171715 7:129590022-129590044 TTGTATGTTTTAGTAGAGACGGG + Intergenic
1032294741 7:130626420-130626442 TTCTATTTTTTAGTAGAGACAGG + Intronic
1032433499 7:131881867-131881889 TTTTATGTGATAGTCTAGATGGG - Intergenic
1032444001 7:131964877-131964899 AACTATGTGAAACTAGAGAAAGG + Intergenic
1032599850 7:133281872-133281894 TTCTATTTTTTAGTAGAGATGGG + Intronic
1032760820 7:134939789-134939811 TTGTATTTTTTAGTAGAGAATGG - Intronic
1032900191 7:136298434-136298456 TAGTATTTGATAGTAGAGTAGGG + Intergenic
1032911953 7:136442701-136442723 TTGTATGTTTTAGTAGAGACAGG - Intergenic
1032949294 7:136888871-136888893 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1033083035 7:138315586-138315608 TTGTATGTTTTAGTAGAGACGGG + Intergenic
1033646777 7:143310978-143311000 TTGTATGTTTTAGTAGAGATGGG - Intergenic
1033668472 7:143466298-143466320 TTGTATGTTTTAGTAGAGATGGG + Intergenic
1034184864 7:149167782-149167804 TTCTATTTTTTAGTAGAGATGGG + Intronic
1034186874 7:149184938-149184960 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1034213142 7:149382617-149382639 TTTTGTGGGATAGTAGAGCAAGG - Intergenic
1034291474 7:149935825-149935847 TTCTATTTGAGAAAAGAGAAAGG + Intergenic
1035753777 8:2015110-2015132 TTCTATTTTTTAGTAGAGATGGG + Intergenic
1037084440 8:14829982-14830004 TTCTATTTTTTAGTAGAGACGGG + Intronic
1037111249 8:15166419-15166441 TTCTATTTTTTAGTAGAGATGGG + Intronic
1037181637 8:16013795-16013817 TTCTATGTGGTATGAGATAATGG + Intergenic
1037229934 8:16645802-16645824 TGCTGTGTGATAGAAGAGACAGG + Intergenic
1037405628 8:18539717-18539739 TTTTTTGTGTTAGTAGAGACAGG + Intronic
1037445490 8:18961515-18961537 TTCTATTTTTTAGTAGAGATGGG - Intronic
1037559547 8:20060508-20060530 TTGTATGTTTTAGTAGAGATGGG - Intergenic
1037697959 8:21243879-21243901 TTGTATGTTTTAGTAGAGATGGG - Intergenic
1038664442 8:29525723-29525745 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1039259904 8:35760213-35760235 TTCTATTTTTTAGTAGAGACGGG + Intronic
1040804932 8:51384181-51384203 TTCTGTGTGAGAGTACACAAGGG - Intronic
1040927342 8:52698484-52698506 TTGTATGTTTTAGTAGAGACGGG + Intronic
1041033380 8:53761161-53761183 TTCTATTTTTTAGTAGAGACAGG - Intronic
1041198235 8:55423264-55423286 TTTTGTGTTTTAGTAGAGAAGGG + Intronic
1041266674 8:56072378-56072400 TTTTATTTTATAGTAGAGATGGG - Intronic
1042099540 8:65259995-65260017 TACTATTTGATAGTACAGTAGGG - Intergenic
1042137756 8:65648188-65648210 TTCTATTTTTTAGTAGAGACGGG + Intronic
1042251067 8:66756752-66756774 TTGTATGTTTTAGTAGAGACGGG + Intronic
1042469197 8:69163775-69163797 GTCCATGTGATAGCAGAGGATGG + Intergenic
1042812300 8:72839784-72839806 TTCTATTTTTTAGTAGAGACGGG + Intronic
1043091966 8:75915700-75915722 TTATATTTGACAGCAGAGAAGGG - Intergenic
1043372036 8:79606200-79606222 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1043509790 8:80938577-80938599 TGCTATGTTATATGAGAGAAAGG - Intergenic
1043973320 8:86557305-86557327 TTCTATTTTTTAGTAGAGACAGG + Intronic
1044147954 8:88741133-88741155 TTCTACTTGCTAGTAGAAAAGGG - Intergenic
1044203798 8:89467878-89467900 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1044586471 8:93873456-93873478 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1045209714 8:100084008-100084030 TTCTATTTTTTAGTAGAGACGGG + Intronic
1045592968 8:103618911-103618933 TTCTATGTGGTAGTCAAGATGGG - Intronic
1045602829 8:103737356-103737378 TTCTATTTTTTAGTAGAGATAGG + Intronic
1045810474 8:106215202-106215224 TTCTCTGAGATGGGAGAGAAGGG - Intergenic
1046269179 8:111870833-111870855 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1046308704 8:112404354-112404376 TTCTATCTTTTAGTAGAGACGGG - Intronic
1046529137 8:115421154-115421176 TTCTATTTTTTAGTAGAGATGGG + Intronic
1046646676 8:116793360-116793382 TTGTATGTTTTAGTAGAGACGGG + Intronic
1046950844 8:120018404-120018426 TTGTATTTGTTAGTAGAGATGGG - Intronic
1047284770 8:123478576-123478598 TTGTATGGGGTAGTAAAGAAAGG + Intergenic
1047286263 8:123489788-123489810 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1047759565 8:127944267-127944289 TTCTGCTTGATTGTAGAGAAGGG + Intergenic
1047969154 8:130070208-130070230 TTCTATTTTTTAGTAGAGACGGG + Intronic
1048401718 8:134077443-134077465 TTCTTTGTGGGAGTGGAGAAAGG - Intergenic
1048571483 8:135660592-135660614 TCCAATGTGATAGTATTGAAAGG - Intergenic
1048739388 8:137537768-137537790 TTGTATGTTTTAGTAGAGACGGG - Intergenic
1048887462 8:138919810-138919832 TTGTATTTTTTAGTAGAGAATGG + Intergenic
1049164658 8:141118538-141118560 TTCTATATTTTAGTAGAGACAGG + Intronic
1049537971 8:143191123-143191145 TTGTATGTTTTAGTAGAGACAGG - Intergenic
1049764022 8:144344656-144344678 TTGTATGTTTTAGTAGAGACAGG - Intergenic
1049943516 9:572375-572397 TTCTATTTTTTAGTAGAGACGGG - Intronic
1050376075 9:4974604-4974626 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1050515172 9:6435778-6435800 TTCTATTTTTTAGTAGAGACAGG + Intronic
1050798302 9:9575545-9575567 TTCTATTTTTTAGTAGAGACAGG - Intronic
1050842310 9:10167760-10167782 TACTGTGTGATAGAAGATAAAGG + Intronic
1051263367 9:15287771-15287793 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1051302311 9:15664868-15664890 TTGTATGTTTTAGTAGAGACGGG + Intronic
1051529077 9:18079507-18079529 TTCTGTGTTTTAGTAGAGACGGG - Intergenic
1051624729 9:19088241-19088263 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1052725530 9:32224185-32224207 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1052960653 9:34293600-34293622 TTCTATTTTTTAGTAGAGACGGG - Intronic
1052976738 9:34416590-34416612 TTATATTTTTTAGTAGAGAAGGG - Intronic
1054929688 9:70623191-70623213 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1055335856 9:75232788-75232810 TTCTATGTGTTTTGAGAGAAGGG + Intergenic
1055443455 9:76359234-76359256 TTCTATGTGATTTTAAAAAAAGG + Exonic
1055724019 9:79208143-79208165 TTCTATGTGGCAGTGAAGAAAGG - Intergenic
1056018981 9:82422301-82422323 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1056374614 9:85994807-85994829 TATTATTTGATAGTACAGAAGGG + Intronic
1057159011 9:92872057-92872079 TTGTATGTTTTAGTAGAGACGGG - Intronic
1057201961 9:93145612-93145634 TTGTATTTTTTAGTAGAGAACGG + Intergenic
1057242636 9:93425338-93425360 TTGCATGTAATAGTAGATAAGGG + Intergenic
1057775427 9:98004753-98004775 TTCTCTGGGAGAGTAGATAAAGG + Intronic
1058063151 9:100520729-100520751 TTCTGTTTGGTAGTAGAGCAAGG + Intronic
1058150454 9:101458065-101458087 TTGTATGTTTTAGTAGAGACAGG + Intergenic
1058288112 9:103205485-103205507 TTTTATGTTTTAGTAGAGACAGG + Intergenic
1058357330 9:104097917-104097939 TTAAGTGTGATAGTAGAGTATGG + Intronic
1058809475 9:108625694-108625716 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1059601877 9:115787620-115787642 TTCTTTGTGACTCTAGAGAATGG + Intergenic
1059735079 9:117092652-117092674 TTCCCTGTGCTAGTTGAGAATGG - Intronic
1060365940 9:123013501-123013523 TTGTATGTTTTAGTAGAGATGGG + Intronic
1060388828 9:123260307-123260329 CTCTTTGTGATACTAAAGAAGGG + Intronic
1060469105 9:123932550-123932572 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1060588864 9:124803434-124803456 TTCTATTTTTTAGTAGAGACAGG + Intronic
1060604564 9:124902283-124902305 TTCTATTTTTTAGTAGAGACGGG + Intronic
1060615214 9:125006945-125006967 TTGTATTTGTTAGTAGAGATGGG - Intronic
1061089441 9:128418769-128418791 TTCTATTTTTTAGTAGAGACAGG + Intronic
1061551237 9:131335919-131335941 TTGTATTTGTTAGTAGAGATGGG + Intergenic
1061655146 9:132083696-132083718 TTGTATGTTTTAGTAGAGACGGG - Intergenic
1185622167 X:1456788-1456810 TTCTATTTTTTAGTAGAGACAGG + Intergenic
1185849180 X:3469377-3469399 TGCAATGTGATAGTATGGAAAGG + Intergenic
1186060589 X:5701276-5701298 TTCTTTGTTTTTGTAGAGAAGGG - Intergenic
1186351211 X:8741791-8741813 TTCCATGTGATAGAATCGAAGGG + Intergenic
1186544642 X:10435946-10435968 TTCTATTTTTTAGTAGAGATGGG + Intergenic
1186678802 X:11849746-11849768 TTATATGTGATATAAGATAAAGG - Intergenic
1186736390 X:12469421-12469443 TTGTATGTTTTAGTAGAGATAGG + Intronic
1186841928 X:13493141-13493163 TTCTATTTTTTAGTAGAGAAGGG + Intergenic
1187030154 X:15478565-15478587 TTCAACGTGTTAGCAGAGAAGGG + Intronic
1187057796 X:15757341-15757363 TTCTATTTTTTAGTAGAGACGGG - Intronic
1187194327 X:17068138-17068160 TTGTATTTTTTAGTAGAGAAGGG - Intronic
1187239602 X:17500621-17500643 TTCTATGTGAAGCTAGGGAAAGG + Intronic
1187501541 X:19843189-19843211 TTGTATTTTTTAGTAGAGAAGGG + Intronic
1187556403 X:20356472-20356494 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1188124848 X:26354438-26354460 TTCTAAGCCATAGTACAGAAAGG - Intergenic
1188179661 X:27038918-27038940 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1188349748 X:29113412-29113434 TTCTTTGTGATACTTGAAAAGGG - Intronic
1188704862 X:33314988-33315010 TTGTATTTTGTAGTAGAGAAGGG + Intronic
1189390601 X:40573129-40573151 TTGTATGTTTTAGTAGAGACAGG - Intergenic
1189450485 X:41124270-41124292 TTCTATTTTTTAGTAGAGATGGG - Intronic
1189791145 X:44606644-44606666 TTGTATGTTTTAGTAGAGATGGG - Intergenic
1190271028 X:48863749-48863771 TTGTATGTGTTTGTAGAGACGGG - Intergenic
1190619155 X:52267782-52267804 TTCTATTTGATAGCACAGTAGGG + Intergenic
1190637023 X:52445353-52445375 TTCTATTTGATAGCACAGTAGGG - Intergenic
1190796518 X:53748945-53748967 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1191160972 X:57329592-57329614 TTATGTGTGCTGGTAGAGAAGGG + Intronic
1191182406 X:57577680-57577702 TACTAAGTGGTAGTAGAGAGAGG + Intergenic
1191215182 X:57925991-57926013 TACTAAGTGGTAGTAGAGAGAGG - Intergenic
1191757901 X:64614213-64614235 TTGTATGTGATATGAGATAAGGG + Intergenic
1192108678 X:68342140-68342162 TTCTATTTTTTTGTAGAGAAGGG + Intronic
1192113527 X:68389394-68389416 TTTTATGTTTTAGTAGAGATGGG - Intronic
1192121080 X:68456381-68456403 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1192320551 X:70087073-70087095 TTCTATTTTTTTGTAGAGAAGGG - Intergenic
1192463178 X:71335420-71335442 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1192627919 X:72749430-72749452 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1192653789 X:72971379-72971401 TTCTATTTTTTAGTAGAGACGGG - Intergenic
1192712786 X:73608980-73609002 TTGTATTTTATAGTAGAGATGGG - Intronic
1192745155 X:73931171-73931193 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1192993740 X:76490069-76490091 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1193065086 X:77250771-77250793 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1193782579 X:85721817-85721839 CTATATGTGATAATAGAGCATGG + Intergenic
1193799711 X:85920267-85920289 TTCTATTTTTTAGTAGAGACGGG + Intronic
1193992281 X:88322862-88322884 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1194167540 X:90538051-90538073 TTCTCTGTAATAGTATAAAATGG + Intergenic
1194335498 X:92641157-92641179 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1194362140 X:92964919-92964941 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1194823670 X:98534629-98534651 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1194840127 X:98729866-98729888 TTCTATTTAATAGGATAGAATGG + Intergenic
1195025873 X:100877015-100877037 TTCTATTTTTTAGTAGAGACGGG + Intergenic
1195478703 X:105318144-105318166 TTCTATTTTTTAGTAGAGACGGG + Intronic
1195762136 X:108257947-108257969 TTCTATATGAAAATAGGGAAGGG + Intronic
1195922279 X:109995620-109995642 TTGTATTTTCTAGTAGAGAAGGG - Intergenic
1196099521 X:111832919-111832941 TTCCTTGTGACAGTAGAAAAGGG - Intronic
1196111685 X:111953404-111953426 TTCTATGTGATTGAAGACAAAGG - Intronic
1196134972 X:112199113-112199135 TTCTATTTTTTAGTAGAGACAGG - Intergenic
1196217858 X:113075598-113075620 TTCAATATGATAGTCCAGAAGGG - Intergenic
1196922758 X:120601617-120601639 TTCTATGTGATAGCAAAATAGGG + Intronic
1197291169 X:124660199-124660221 TTCTATTTTTTAGTAGAGACGGG - Intronic
1197438141 X:126457515-126457537 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1197697821 X:129569689-129569711 TTTTATCAGATAGTAAAGAAGGG + Intronic
1197779668 X:130146986-130147008 TTGTATTTTATAGTAGAGATGGG - Intronic
1198209134 X:134499629-134499651 TTCTATTTTTTAGTAGAGACGGG - Intronic
1198323559 X:135543694-135543716 TTCTTTGGGGTAGAAGAGAAAGG - Intronic
1198763546 X:140058591-140058613 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1198800919 X:140446878-140446900 TTGTATTTGTTAGTAGAGATGGG + Intergenic
1199052390 X:143252191-143252213 TGCAATGGGATAGTAGAAAATGG - Intergenic
1199450928 X:147978308-147978330 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1200513799 Y:4115830-4115852 TTCTCTGTAATAGTATAAAATGG + Intergenic
1200814477 Y:7517433-7517455 TGCAATATGATAGTACAGAAAGG - Intergenic
1201369532 Y:13246707-13246729 TTGTATTTTTTAGTAGAGAAGGG - Intergenic
1201978352 Y:19878858-19878880 TTCTATTTTTTAGTAGAGATGGG - Intergenic
1201991266 Y:20029640-20029662 TTCTATGTTTTACTAGAGATGGG - Intergenic
1202090956 Y:21188944-21188966 TTGTATTTTTTAGTAGAGAAGGG + Intergenic
1202576211 Y:26328645-26328667 TTTTTTGTATTAGTAGAGAAGGG - Intergenic