ID: 954480272

View in Genome Browser
Species Human (GRCh38)
Location 3:50793468-50793490
Sequence CACCTACGGGAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10056
Summary {0: 1, 1: 29, 2: 165, 3: 1071, 4: 8790}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954480272 Original CRISPR CACCTACGGGAGGCTGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr