ID: 954488116

View in Genome Browser
Species Human (GRCh38)
Location 3:50873525-50873547
Sequence TAGGGTAGCTAAGAAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 9, 3: 46, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954488116_954488120 23 Left 954488116 3:50873525-50873547 CCAGCACTTTCTTAGCTACCCTA 0: 1
1: 0
2: 9
3: 46
4: 200
Right 954488120 3:50873571-50873593 GTTCCCTAATCCACTGGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 126
954488116_954488121 24 Left 954488116 3:50873525-50873547 CCAGCACTTTCTTAGCTACCCTA 0: 1
1: 0
2: 9
3: 46
4: 200
Right 954488121 3:50873572-50873594 TTCCCTAATCCACTGGCTCAGGG 0: 1
1: 0
2: 2
3: 10
4: 173
954488116_954488124 29 Left 954488116 3:50873525-50873547 CCAGCACTTTCTTAGCTACCCTA 0: 1
1: 0
2: 9
3: 46
4: 200
Right 954488124 3:50873577-50873599 TAATCCACTGGCTCAGGGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 176
954488116_954488119 17 Left 954488116 3:50873525-50873547 CCAGCACTTTCTTAGCTACCCTA 0: 1
1: 0
2: 9
3: 46
4: 200
Right 954488119 3:50873565-50873587 TTGTGTGTTCCCTAATCCACTGG 0: 1
1: 0
2: 1
3: 4
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954488116 Original CRISPR TAGGGTAGCTAAGAAAGTGC TGG (reversed) Intronic
901450620 1:9334607-9334629 TGGGGAAGATAAGAAAGTTCTGG - Intronic
901607011 1:10467113-10467135 TATGGAAGCTAAGAAGGTGCTGG + Intronic
902812498 1:18896554-18896576 TAGGTGAGCAGAGAAAGTGCAGG + Intronic
903407223 1:23107985-23108007 TAGGGTAGCTCAGAATGAGTGGG - Intronic
904563578 1:31414031-31414053 GAGGGCAGCTAAGAAAGTCCGGG - Intronic
904787837 1:32995899-32995921 TAGGGTAGGTAGGAAAGAGCTGG + Intergenic
904882847 1:33713862-33713884 TAAGTCAGCTTAGAAAGTGCTGG - Intronic
906140169 1:43529644-43529666 TGGGGTAGATAGGAAAGAGCTGG + Intronic
906683744 1:47749124-47749146 TAGGGTAGTTGAGAAAGCACAGG + Intergenic
906903272 1:49861293-49861315 TGGGGCAGCCAAGGAAGTGCTGG + Intronic
909182372 1:72440260-72440282 TGGGGCAGCTAAGGGAGTGCTGG - Intergenic
910066034 1:83151694-83151716 TAGGATGGCTAGGAAAGTTCTGG + Intergenic
910739919 1:90503982-90504004 GAGGGCAGCCAAAAAAGTGCTGG - Intergenic
911181352 1:94863268-94863290 TAGGGAAGCTGAGGCAGTGCAGG + Intronic
911373594 1:97024144-97024166 TGGGGCAGCTAAGGGAGTGCAGG + Intergenic
912598477 1:110903289-110903311 TGGGGTGGCTAAGAGAGTGCTGG + Intergenic
915964948 1:160298335-160298357 TAAGGTAGCTAAGCAAGAACTGG - Intronic
916643453 1:166757487-166757509 TGGGGAAGATAAGAAAGTTCTGG - Intergenic
916822766 1:168415915-168415937 CAGGGGAGCTAAGAAAGGACAGG - Intergenic
917226471 1:172788952-172788974 TGGGGCAGCTAAGGGAGTGCAGG - Intergenic
918918852 1:190678448-190678470 TATGGTAGCTAAGAATGTGGTGG + Intergenic
921042529 1:211447783-211447805 TAGGGCAGCTAAGGGAGGGCTGG + Intergenic
1066281381 10:33921596-33921618 TTGGGTAGCCAAGATAGTCCTGG + Intergenic
1068411437 10:56660712-56660734 TAGGGTAGCTAAGAGGGTGCTGG - Intergenic
1069631607 10:69900449-69900471 CAGGGTAGCACAGAAAGTTCTGG - Intronic
1074006514 10:109430610-109430632 TATGGCAGGAAAGAAAGTGCAGG + Intergenic
1079823449 11:25160590-25160612 TGGGGAAGCTAAGAAAGTGCTGG - Intergenic
1081643866 11:44776777-44776799 GAAGGTAGCTGAGGAAGTGCTGG + Intronic
1081856043 11:46304643-46304665 TAGGGTGGCTAAGGAGTTGCTGG - Intronic
1086258489 11:84909185-84909207 TAGCTTAGCTAAGGAAGAGCAGG - Intronic
1089624587 11:119743046-119743068 TAGGGAACCTAGGAAAGTCCTGG - Intergenic
1090136436 11:124204109-124204131 CAGGGCAGCCAAGAGAGTGCTGG - Intergenic
1090221008 11:125026067-125026089 TGGGGCAGCTAAGGGAGTGCAGG - Intronic
1090726600 11:129532652-129532674 TAGGGTCCGTAAGAAAGGGCTGG + Intergenic
1093135624 12:15446875-15446897 TAGGGAAGCTTGGAAAGAGCTGG + Intronic
1101226601 12:102694056-102694078 TGGGGTGGTTAAGGAAGTGCTGG + Intergenic
1107279452 13:38716806-38716828 TTGGGAAGATAAGAAAGAGCAGG - Intronic
1107807948 13:44172399-44172421 TGGGGCAGCTAAAAGAGTGCTGG - Intergenic
1109826516 13:67728507-67728529 TGGGGCAGCCAAGGAAGTGCTGG - Intergenic
1111042686 13:82770588-82770610 GAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1111365288 13:87235003-87235025 TAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1112004084 13:95239125-95239147 TAGGGTAGATAATAATGTGCAGG - Intronic
1116176160 14:41473144-41473166 CTGGGTGGCTAAGGAAGTGCTGG - Intergenic
1116937785 14:50759842-50759864 GAGGGAAGGTAAGAAAGTGAAGG - Exonic
1117208225 14:53467424-53467446 AAGGGTAGCCAAAAAAGAGCAGG - Intergenic
1117290530 14:54327796-54327818 TGGGGTAGATGAGAAAGTTCTGG - Intergenic
1117629122 14:57671259-57671281 TGGGGCAGCTAAGGGAGTGCTGG + Intronic
1117732945 14:58742282-58742304 AAGGGTAGCTAAGGCATTGCAGG - Intergenic
1118817369 14:69323013-69323035 TAGGGAAGCAAAGGACGTGCTGG + Intronic
1123107019 14:105846399-105846421 CAGGGCAGCTGAGCAAGTGCAGG + Intergenic
1123201651 14:106671704-106671726 CAGGGGAGCTCAGAAAGAGCAGG - Intergenic
1124081444 15:26501790-26501812 CAGGGTAGCTAAGAGAGTGCTGG - Intergenic
1126943999 15:53797751-53797773 TGGGGCAGCCAAGAGAGTGCTGG + Intergenic
1128243655 15:66118449-66118471 TAGAGCAGCTCAGAAAATGCAGG - Intronic
1130421017 15:83747149-83747171 TAGGTTAGATAAGGAAGTGTTGG + Intronic
1130750148 15:86702798-86702820 AAGGGAAGCTAAGAAACTCCTGG - Intronic
1132928874 16:2448376-2448398 AAGGGGAGGTCAGAAAGTGCTGG - Intronic
1133227772 16:4350703-4350725 TAGGGTAGCTTTAAAAGTGCAGG - Intronic
1137817996 16:51417458-51417480 TAGGCAAGATAAGAAAGTGGTGG - Intergenic
1140028575 16:71314839-71314861 TATAGTAGCTAAGAGAATGCAGG + Intergenic
1141037399 16:80640133-80640155 TGGGGTGGCTAAGGGAGTGCTGG + Intronic
1144885954 17:18461889-18461911 TAGGGTAGCAAAGGCACTGCAGG - Intergenic
1145146257 17:20482483-20482505 TAGGGTAGCAAAGACACTGCAGG + Intergenic
1149489183 17:57069792-57069814 AAGGGGAGCCAAGAAAGTGAAGG - Intergenic
1149628093 17:58094362-58094384 TAGGGTATCTAATAAAGTTGGGG + Exonic
1150541431 17:66104151-66104173 CAGGGTAGCCAAGAGAGTGCTGG + Intronic
1151649949 17:75460916-75460938 TTGGGAAACTAAGAAAGTTCTGG - Intronic
1152350001 17:79778901-79778923 AGGGGTAGCGAAGAAAGAGCGGG - Intronic
1152465156 17:80462131-80462153 CAGGGTAGCTGAGAAACTTCTGG + Intergenic
1153075381 18:1156487-1156509 TAGGGTGGCTACGGGAGTGCTGG - Intergenic
1153626000 18:7022980-7023002 TAGGGTAGCTAGGGAAGAACTGG + Intronic
1154062775 18:11078986-11079008 TACGGTAGTTAAAAAATTGCTGG + Intronic
1154386514 18:13897531-13897553 TGGGGTGGCTAAGGGAGTGCTGG + Intronic
1155533720 18:26794495-26794517 TGGGGTGGCTAAGGAAGTGCTGG + Intergenic
1156943633 18:42799796-42799818 AAGAAAAGCTAAGAAAGTGCAGG - Intronic
1157285457 18:46374360-46374382 TGGGGTAGGTGAGAAAGTTCTGG - Intronic
1158321749 18:56270818-56270840 TAGGGGAGGGAAGAAAGAGCAGG + Intergenic
1161491345 19:4563604-4563626 TTGGGAAGCTGAGAAAGTTCTGG - Intergenic
925249782 2:2422369-2422391 CAGGGTGGCTAAGAAAGTGCTGG - Intergenic
928084266 2:28335937-28335959 TTGAGAAGCTAAGAAAGTGAAGG - Intronic
928862526 2:35875501-35875523 TGGGGCAGCCAAGAAAGTGCTGG - Intergenic
929388719 2:41442843-41442865 TGGGGCAGCTAAGGGAGTGCTGG - Intergenic
929926619 2:46217547-46217569 TGGGGCAGCTAAGGGAGTGCTGG - Intergenic
930492573 2:52093672-52093694 TGGGGCAGCCAAGGAAGTGCGGG - Intergenic
935844827 2:107154313-107154335 GAGGGAAGCTAGGAAAGTTCTGG + Intergenic
936532335 2:113284858-113284880 TAGGGTAGTGAAGAGAATGCTGG - Intergenic
936831488 2:116653452-116653474 TGGGGAAGCTAGGAGAGTGCTGG + Intergenic
937275229 2:120679748-120679770 TAGGGTGGCTGAGAAGCTGCAGG + Intergenic
939459109 2:142476383-142476405 TAGAGTGGCTAGAAAAGTGCAGG + Intergenic
939596579 2:144131786-144131808 TTGGGTAGCTAAGCAATTTCAGG + Intronic
941724892 2:168850250-168850272 AAGGGTAAATAAGAAAGTGAGGG - Intronic
943226840 2:185188506-185188528 TGGGGCAGCTAAGGCAGTGCTGG - Intergenic
943348291 2:186767515-186767537 TACTATAGCTAACAAAGTGCAGG - Intergenic
948232751 2:236363896-236363918 TGGGGTAGGGAAGAAAATGCTGG - Exonic
948922622 2:241072871-241072893 GAGGGCAGCTCAGAAAGAGCAGG + Intronic
1168917366 20:1501075-1501097 CAGGGCAGCTAAGAAGGTGCTGG - Intergenic
1169586964 20:7096258-7096280 TAGGGCAGCCAAGGGAGTGCTGG + Intergenic
1170048674 20:12115118-12115140 TAGGGAAGCAAAGACAGAGCAGG + Intergenic
1172730411 20:37082337-37082359 TTGGGAAGATAAGAAAGTTCGGG + Intronic
1175275804 20:57769950-57769972 AAGGGTGGCTGACAAAGTGCAGG - Intergenic
1176899266 21:14419986-14420008 TGGGGCAGCTAAGGGAGTGCTGG + Intergenic
1177577872 21:22982405-22982427 TAGGGCAGCCAAGGGAGTGCTGG + Intergenic
1178246647 21:30959381-30959403 CAGTGTAGCCAAGAAAATGCTGG + Intergenic
951032309 3:17895881-17895903 TAGGGCAGCCAAGGGAGTGCCGG - Intronic
951794580 3:26524156-26524178 TGGGGAAGCCAAGAGAGTGCTGG - Intergenic
952438780 3:33300996-33301018 AAGGGTAGCTAGGAAAGGCCGGG - Intronic
953722504 3:45368766-45368788 TGGGGTAGCCAAGGGAGTGCTGG + Intergenic
954488116 3:50873525-50873547 TAGGGTAGCTAAGAAAGTGCTGG - Intronic
957035845 3:75292105-75292127 TGGGGTAGATAAAAAAGTTCTGG + Intergenic
957723778 3:84038188-84038210 TAAAGTAGATAAGAAAGTGTAGG - Intergenic
958617544 3:96514969-96514991 TGGGGCAACCAAGAAAGTGCTGG + Intergenic
958631266 3:96686274-96686296 CAGGGCAGCTAAGAGAGTGCTGG - Intergenic
958847128 3:99278452-99278474 TAAGGTAGCCAAGAGAGTGCTGG + Intergenic
958876607 3:99624348-99624370 CAGGCTGGCTAAGGAAGTGCTGG + Intergenic
961003085 3:123386970-123386992 TAGGATCCATAAGAAAGTGCTGG + Intronic
961304186 3:125944608-125944630 TGGGGTAGATAAAAAAGTTCTGG - Intergenic
962266782 3:133949481-133949503 TAGTATACCCAAGAAAGTGCAGG - Intronic
962862699 3:139419235-139419257 AGGGATAGCTAAGAAAGTGCTGG - Intergenic
963364976 3:144323348-144323370 TAGGGTGGCTAAGAGAGTGCTGG + Intergenic
963625307 3:147664444-147664466 AAGGCTAGCTAAAAAAGTACAGG + Intergenic
963628245 3:147701023-147701045 ATGGGTAATTAAGAAAGTGCCGG + Intergenic
963692210 3:148518998-148519020 TGGGGTAGCTAAGGGAATGCAGG + Intergenic
965086125 3:164100163-164100185 CAGGGAAGCTAAAAGAGTGCAGG - Intergenic
965996690 3:174891818-174891840 TATGGCAGCCAAGAGAGTGCTGG + Intronic
966348486 3:179004512-179004534 TAGGGCAACTAAGTCAGTGCTGG + Intergenic
968429241 4:545525-545547 TGGGGTAGCCAAGGAAGTGCTGG - Intergenic
971146463 4:23981849-23981871 TAGGGAAGCTAAGGAGATGCTGG + Intergenic
971486605 4:27166911-27166933 TGGGGTAGAGAAGAAAGTGTTGG + Intergenic
971558784 4:28047579-28047601 AAGGGTGGCTAAGGGAGTGCTGG - Intergenic
973333500 4:48933349-48933371 GAGGGCAACTATGAAAGTGCTGG - Intergenic
974848045 4:67375336-67375358 TAGGGTAGCTATAAAAATGTTGG + Intergenic
975503831 4:75116899-75116921 CAGGGTGGCTAAGGGAGTGCTGG + Intergenic
975654790 4:76630851-76630873 CACAATAGCTAAGAAAGTGCTGG - Intronic
977026858 4:91830837-91830859 TAGGGCAGCTAAGGTAGTGCTGG - Intergenic
978058968 4:104312140-104312162 CAGGGTAGCTAAGGAAGTGCTGG + Intergenic
979851354 4:125574248-125574270 CAGGGCAGCTAAGAGAGTGCTGG - Intergenic
980723599 4:136728277-136728299 TGGGGCAGCTAAGAGAGTACTGG - Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
981895584 4:149795588-149795610 TAGGGTGGCTAAATAAGTGCTGG + Intergenic
983750110 4:171257548-171257570 TAGTGTAATTAAGAATGTGCAGG - Intergenic
986657657 5:10031069-10031091 TGGGGTGGCTAAGGAAGTGCTGG - Intergenic
988169813 5:27639148-27639170 TGGGGTAGCTAAGGGAGTGCTGG - Intergenic
988914540 5:35879315-35879337 TAGAAGAGCTAAGAAAATGCAGG - Exonic
988956411 5:36324352-36324374 TGGGGTAGCTAAGGGAGTGCTGG - Intergenic
990271695 5:54148478-54148500 TAGGGTAATATAGAAAGTGCAGG - Intronic
991005489 5:61824081-61824103 TGGAGTAGTTAAGATAGTGCTGG + Intergenic
991507844 5:67343366-67343388 TAGAGTGCCTAAGAGAGTGCTGG - Intergenic
992454314 5:76902194-76902216 TGGGGCAGCCAAGGAAGTGCTGG - Intronic
994616243 5:102107783-102107805 CAGGGTGGCTAAGGGAGTGCTGG - Intergenic
994865123 5:105258691-105258713 TGTGGTAGCTGTGAAAGTGCGGG + Intergenic
997524768 5:134545138-134545160 CAGGGTAGCAAAGGAACTGCTGG - Intronic
1000270139 5:159676639-159676661 TAGGGCAGCCAAGGGAGTGCTGG + Intergenic
1000270206 5:159677039-159677061 TAGGGCAGCCAAGGGAGTGCTGG - Intergenic
1000498780 5:162021383-162021405 TGGGGCAACTGAGAAAGTGCTGG + Intergenic
1000651399 5:163822516-163822538 TAGGGCAGCCAAGGGAGTGCTGG - Intergenic
1004917605 6:20346436-20346458 CAGAGTAGCTATGAAAATGCAGG - Intergenic
1007471264 6:42092103-42092125 TAGGGCAGCTAAGAGGGGGCAGG - Intergenic
1008177686 6:48288591-48288613 TGGGGCAGCTAAGGGAGTGCTGG - Intergenic
1008214979 6:48777826-48777848 TGGGGTGGCTAAGGGAGTGCTGG + Intergenic
1008312100 6:49989379-49989401 TAGGGCAGCTAAGGAAGGGCTGG + Intergenic
1008727816 6:54442598-54442620 TAGGATGGCTAAGAGAGTGCTGG - Intergenic
1010325006 6:74554398-74554420 TGGGGTGGCTAAGGAAGTACTGG + Intergenic
1010528823 6:76941699-76941721 TAAGGCAGCTAAGGGAGTGCTGG + Intergenic
1012187684 6:96240592-96240614 AAGGGCAGATGAGAAAGTGCTGG + Intergenic
1012189435 6:96261595-96261617 TAGGGCAGCTAAGGGAGTGCTGG + Intergenic
1012297726 6:97545929-97545951 CAGGGTAGCTAACAGAGTGCTGG - Intergenic
1012486323 6:99725685-99725707 TGGGGCAGCTAAGGGAGTGCTGG - Intergenic
1012977549 6:105796133-105796155 TAGGGCACCGAAGAAAGCGCAGG + Intergenic
1014666476 6:124243705-124243727 TTTGGTAGCAGAGAAAGTGCAGG - Intronic
1014732068 6:125043984-125044006 TAAGGTAGTTAAGAAGTTGCAGG - Intronic
1014865314 6:126521743-126521765 AAGGGCAGCTAAGAGAGTTCTGG - Intergenic
1016505344 6:144772862-144772884 TTGGGTAGCTAAGGAGATGCTGG + Intronic
1018535714 6:164817466-164817488 TGGGGTGGCTAAGAGAGTGCTGG + Intergenic
1020214590 7:6180010-6180032 TAGGGCAGGAAAGACAGTGCTGG + Intronic
1020354134 7:7258306-7258328 TAGGGTCCCTAAGAAAATACAGG - Intergenic
1021353679 7:19627939-19627961 TGGGGCATCTAAGAGAGTGCTGG + Intergenic
1022361697 7:29666056-29666078 TAGGGGAGATAAGGAAGAGCGGG - Intergenic
1024170225 7:46777650-46777672 CAGGGCAGCTAAGGGAGTGCTGG + Intergenic
1027278076 7:76583081-76583103 TAGGATGGCTAGGAAAGTTCTGG - Intergenic
1031231688 7:119114965-119114987 TGGGGTAGCAAAGCAAGCGCTGG - Intergenic
1031842233 7:126757838-126757860 TAGGATAGATAAGAAGGTGGAGG - Intronic
1033691251 7:143739940-143739962 TGGGGCAGCTAAGGGAGTGCTGG + Intergenic
1033887204 7:145963429-145963451 TGGGGCAGCTAGGGAAGTGCTGG + Intergenic
1034563126 7:151894438-151894460 GAGGGCAGCTAAGAAAGACCTGG - Intergenic
1038604953 8:28991848-28991870 AAGGTTAGCTAAGAGGGTGCAGG - Intronic
1039145869 8:34446380-34446402 TAGTGTAGCTAATAAAATGAGGG - Intergenic
1040511579 8:48100615-48100637 CAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1041243227 8:55866980-55867002 TCAGAGAGCTAAGAAAGTGCAGG - Intergenic
1042297867 8:67242232-67242254 TAGAGTGGCTAAGGGAGTGCTGG + Intronic
1045702914 8:104887235-104887257 TAGGGTAATGAAGCAAGTGCTGG + Intronic
1048757726 8:137756594-137756616 TGGGGCAGCTAAGGGAGTGCTGG + Intergenic
1050591263 9:7162783-7162805 TGTGGTGGGTAAGAAAGTGCAGG + Intergenic
1051916686 9:22217110-22217132 TGGGGCAGCTAAGGGAGTGCTGG + Intergenic
1051991144 9:23153923-23153945 TGGGGTAGCCAAGGGAGTGCTGG - Intergenic
1052667062 9:31508368-31508390 TAGGGCAGCTAAAGGAGTGCTGG - Intergenic
1053317990 9:37068847-37068869 TAGGGAGGCTAAGGAAGTGGGGG + Intergenic
1057082365 9:92182279-92182301 TAGGGCAGAGAGGAAAGTGCTGG - Intergenic
1057082531 9:92183725-92183747 TAGGTTAACTAAGAAAGTTCAGG + Intergenic
1057622701 9:96650509-96650531 TAGAGTATATAATAAAGTGCAGG + Intronic
1059372704 9:113855829-113855851 AAGGGTAGCTGAGAAAGGGAAGG + Intergenic
1060257545 9:122045939-122045961 TTGGGAAGATAAGAAAGTTCTGG + Intronic
1187610654 X:20939479-20939501 CAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1187618765 X:21027490-21027512 TGGGGTGGCTAAGAGAGTGCTGG - Intergenic
1187652138 X:21420859-21420881 CAGGGTGGCCAAGAGAGTGCTGG - Intronic
1188743030 X:33809528-33809550 TGGGGTGGCTAAGGAAGTGCTGG - Intergenic
1188924679 X:36024422-36024444 TGGGGGAGCTAAGTAAGTGCTGG - Intergenic
1189658077 X:43267714-43267736 TACGGTGGCTAAGAAAGTGCTGG - Intergenic
1189935904 X:46067777-46067799 TGGGGCAGCTAAGAAATTGCTGG - Intergenic
1190498673 X:51053728-51053750 TGTGGCAGCCAAGAAAGTGCTGG - Intergenic
1190919626 X:54839760-54839782 TAGGGTGGCTAAGGGAGTGCTGG - Intergenic
1191123739 X:56932638-56932660 TGGGGTGGCTAAGAGAGAGCTGG + Intergenic
1191149936 X:57209660-57209682 CATGGTAGCTAAAAAAGTGCTGG - Intergenic
1191207502 X:57850024-57850046 TGGGGTTGCTAAGGGAGTGCTGG - Intergenic
1191984291 X:66961812-66961834 TGGGGCAGCTAAGGTAGTGCTGG - Intergenic
1192077783 X:68017857-68017879 TGGGGTTGCTAAGAAAGTGCTGG + Intergenic
1192812488 X:74559621-74559643 TGGGGTAGCCAAGGGAGTGCTGG + Intergenic
1192863675 X:75107373-75107395 TGGGGTGGCTAAGGGAGTGCTGG + Intronic
1192978067 X:76307231-76307253 TGGGGCAGCTAAGAGAGTGCTGG - Intergenic
1193000662 X:76558863-76558885 TGTGGCAGCTAAGAAAGTGATGG - Intergenic
1193078590 X:77382315-77382337 CAGAGTAGCTAAGAGAGTGTTGG + Intergenic
1193167939 X:78302897-78302919 TGGGGTGGCTAAGAGAATGCTGG - Intronic
1193191642 X:78578440-78578462 TGGGGCAGCTAAGAGAGTGCTGG + Intergenic
1193815667 X:86102169-86102191 TGGGGCAGCCAAGAGAGTGCTGG + Intergenic
1193981585 X:88187535-88187557 CGGGGCAGCTCAGAAAGTGCTGG + Intergenic
1194115266 X:89888802-89888824 TAGGGTGGCTAAGAGAGTGCTGG - Intergenic
1194370784 X:93069240-93069262 CTGGGCAGCTGAGAAAGTGCTGG + Intergenic
1194393262 X:93347028-93347050 AAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1194522144 X:94932041-94932063 TAGGGCAGCCAAGGGAGTGCTGG - Intergenic
1194530677 X:95044911-95044933 TGAGGCAGCTAAGGAAGTGCTGG + Intergenic
1194558279 X:95389205-95389227 TAAGGTGGCTAAGGGAGTGCTGG - Intergenic
1194561500 X:95427612-95427634 TGGGCAAGCCAAGAAAGTGCTGG + Intergenic
1194646576 X:96465243-96465265 GAGGGCAGCTAGGAAAGGGCAGG + Intergenic
1194831756 X:98631860-98631882 CAGGGCAGCTAAGGAAGTGCTGG + Intergenic
1195807912 X:108796143-108796165 TAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1196214566 X:113035542-113035564 TAGGGTGTCTAAGGGAGTGCTGG - Intergenic
1196461446 X:115935885-115935907 TGGGGTGGCTAAGAAAGTGTGGG - Intergenic
1196467753 X:115990745-115990767 TGGGGCAGCCAAGGAAGTGCTGG + Intergenic
1196625226 X:117870607-117870629 TGGGGCAGCTAAGAGAGTGCTGG + Intergenic
1196660463 X:118263961-118263983 TGGTGTAGCTAAGGGAGTGCTGG + Intergenic
1196980656 X:121209740-121209762 CAGAGTAGCTAAGAAAGTGTTGG - Intergenic
1197139053 X:123096370-123096392 CAAGGCAGCTAAGGAAGTGCTGG + Intergenic
1197600300 X:128519921-128519943 TGGGGTGGCTAAGGAAGTGCTGG + Intergenic
1197876597 X:131115160-131115182 CAGGATGGCTAAGGAAGTGCTGG - Intergenic
1197953080 X:131918705-131918727 TGGGGTGGCTAAGGGAGTGCTGG + Intergenic
1198430888 X:136565202-136565224 TGGGGTGGCTAAGGTAGTGCTGG - Intergenic
1199115279 X:143985068-143985090 TAGGGCAGCTAAGGGAGTGCTGG - Intergenic
1199159992 X:144597445-144597467 CAGGGTATCTAAGGGAGTGCAGG - Intergenic
1199177627 X:144810428-144810450 CTGGGTAGCTAAGAGAGTTCTGG + Intergenic
1199210660 X:145206232-145206254 TGGGGTGGCTAAGGCAGTGCTGG + Intergenic
1199236341 X:145498450-145498472 TAGGGTGGCTAAGGGAGTGCTGG + Intergenic
1199415161 X:147573738-147573760 CAGGGTGGCTAAGGGAGTGCTGG + Intergenic
1199440899 X:147866808-147866830 CAGGGCAGCTAAAAGAGTGCTGG + Intergenic
1199908393 X:152259397-152259419 CAGGGCAGCTAAGGGAGTGCTGG + Intronic
1200297352 X:154934065-154934087 TAAGGTAGTGAAGAAAGGGCTGG + Intronic
1200468059 Y:3545941-3545963 TAGGGTGGTTAAGAGAGTGCTGG - Intergenic
1200678580 Y:6181132-6181154 CTGGGCAGCTGAGAAAGTGCTGG + Intergenic