ID: 954491478

View in Genome Browser
Species Human (GRCh38)
Location 3:50910709-50910731
Sequence AGGGAGAACAAAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 5, 2: 29, 3: 111, 4: 395}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954491478_954491486 15 Left 954491478 3:50910709-50910731 CCCACAGTCACTTTGTTCTCCCT 0: 1
1: 5
2: 29
3: 111
4: 395
Right 954491486 3:50910747-50910769 ATTGTCTCTCCATGTGCTGATGG 0: 1
1: 0
2: 2
3: 13
4: 174
954491478_954491489 23 Left 954491478 3:50910709-50910731 CCCACAGTCACTTTGTTCTCCCT 0: 1
1: 5
2: 29
3: 111
4: 395
Right 954491489 3:50910755-50910777 TCCATGTGCTGATGGTGGATGGG 0: 1
1: 0
2: 0
3: 13
4: 149
954491478_954491492 29 Left 954491478 3:50910709-50910731 CCCACAGTCACTTTGTTCTCCCT 0: 1
1: 5
2: 29
3: 111
4: 395
Right 954491492 3:50910761-50910783 TGCTGATGGTGGATGGGGATTGG 0: 1
1: 0
2: 4
3: 45
4: 452
954491478_954491488 22 Left 954491478 3:50910709-50910731 CCCACAGTCACTTTGTTCTCCCT 0: 1
1: 5
2: 29
3: 111
4: 395
Right 954491488 3:50910754-50910776 CTCCATGTGCTGATGGTGGATGG 0: 1
1: 1
2: 1
3: 24
4: 243
954491478_954491487 18 Left 954491478 3:50910709-50910731 CCCACAGTCACTTTGTTCTCCCT 0: 1
1: 5
2: 29
3: 111
4: 395
Right 954491487 3:50910750-50910772 GTCTCTCCATGTGCTGATGGTGG 0: 1
1: 0
2: 0
3: 23
4: 158
954491478_954491491 24 Left 954491478 3:50910709-50910731 CCCACAGTCACTTTGTTCTCCCT 0: 1
1: 5
2: 29
3: 111
4: 395
Right 954491491 3:50910756-50910778 CCATGTGCTGATGGTGGATGGGG 0: 1
1: 0
2: 0
3: 29
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954491478 Original CRISPR AGGGAGAACAAAGTGACTGT GGG (reversed) Intronic
900912641 1:5612465-5612487 AGGGAGATGAAAGAGGCTGTGGG + Intergenic
901354901 1:8636827-8636849 TGGGAGAACAAAGAGAATGGAGG + Intronic
905507305 1:38490130-38490152 AGGGAGATCAGAGTGACTAGAGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906101626 1:43267587-43267609 GGGGAGAACACAGAGGCTGTGGG - Intronic
907803165 1:57791743-57791765 GGGGAGGACAAGGTGAGTGTGGG - Intronic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908478865 1:64517418-64517440 AAGGAGAATTAAGTGAGTGTGGG + Intronic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909231344 1:73094051-73094073 AGGTAGAGCAAAGTGCCTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910633947 1:89386297-89386319 GGGAAGAACCAAGTGAATGTAGG + Exonic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
915611422 1:156996441-156996463 AGGGAGGACACAGGGACTCTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918009936 1:180577325-180577347 AGAGAGAAAAAAATGACAGTAGG - Intergenic
918047053 1:180947974-180947996 AGGGAGCAAAAAGGGACTCTGGG - Exonic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919122293 1:193356347-193356369 AGCCAGAACATAGTGACTGGTGG - Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920736473 1:208537471-208537493 AAGGAGAACTAAGTGACTCCTGG - Intergenic
920953768 1:210598630-210598652 AGAAAGATCACAGTGACTGTGGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923065082 1:230510133-230510155 AGGGAGAAGAAGGTGGCTGGAGG - Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1062996049 10:1868662-1868684 TGGGAGAACAAAGTCCCTCTTGG + Intergenic
1063224483 10:4002924-4002946 GCGGAGAAGAAATTGACTGTGGG + Intergenic
1064318234 10:14277689-14277711 AGGGAGGGGAAAGTAACTGTGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1066194728 10:33088175-33088197 AGGTAGAATAGAGTGACTCTAGG - Intergenic
1066228368 10:33407190-33407212 AAGGAGAACTGAGTGAGTGTGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067412331 10:46076099-46076121 AGGGAGAACAAACAGACCGAGGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070635164 10:78119711-78119733 AGGGAAAACAAAGTTAGAGTGGG + Intergenic
1071579700 10:86757307-86757329 GGGGAGAACAAAATGAGTTTCGG + Intronic
1073281585 10:102358457-102358479 AAGGAGAAGAAAGAGGCTGTGGG - Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073872314 10:107879655-107879677 AGGGAGAGCAAAGTGTCTATGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078355730 11:10630142-10630164 GGGGTGAACAATGTGACTGGAGG - Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081522161 11:43892885-43892907 AGGGAGAAAACATTGACTGAGGG + Intronic
1082631442 11:55546858-55546880 AGGAGGAAGAAAGTGATTGTTGG + Intergenic
1083477445 11:62923359-62923381 AGGGAGACCAAGGAGACTGGGGG - Intergenic
1083538973 11:63498464-63498486 AGGGAGAGCATGGTGACTGAAGG - Intergenic
1084346310 11:68551904-68551926 AAGTATAACAAAGTTACTGTAGG - Intronic
1084661543 11:70549358-70549380 AGGGGGACCAGTGTGACTGTGGG - Intronic
1085310214 11:75511834-75511856 AGTGAGCACAAAGTCACAGTTGG - Intronic
1085405569 11:76259817-76259839 AGGCAGCACAAAGTAACTGCTGG + Intergenic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086902486 11:92383474-92383496 AGGGAAAACAAATACACTGTGGG - Intronic
1088109865 11:106248723-106248745 AGGTAGAAAAAAGTGAATTTGGG + Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089156903 11:116409595-116409617 CGGGAGGACAAAGTAACTGAGGG + Intergenic
1089722577 11:120441603-120441625 AGGGAGATCAAAGTGAAATTTGG + Intronic
1090076326 11:123582093-123582115 AGGAAGCACAAGGAGACTGTGGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093699331 12:22201195-22201217 AGGTAGAACAAAGAAAATGTTGG - Exonic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094795742 12:33970272-33970294 AAGGAAAACAAAGTGATTGAGGG - Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095791273 12:46170182-46170204 ATGGAGGACAAAGTCACTGAAGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1098739322 12:74151869-74151891 AGGGAGAAAAAAGTCATTGTGGG + Intergenic
1099024395 12:77447602-77447624 AGGGAGAACAAAGCAATTGCAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100388637 12:94127733-94127755 AAGGAGAACACAGTTTCTGTGGG - Intergenic
1101239139 12:102820688-102820710 AGGGAGACCAAAGTTGATGTAGG + Intergenic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1104216565 12:126739697-126739719 CTGGAGAAAAAAGTTACTGTTGG - Intergenic
1104286985 12:127432563-127432585 AGGGAGCACAGAGAGACTGCAGG + Intergenic
1104619233 12:130298370-130298392 AGGGAGTAGAAAGTGACAGGGGG - Intergenic
1106358561 13:29008365-29008387 AGCGAGAAAAATGTGACTGATGG - Intronic
1106705112 13:32271647-32271669 AAAGAGAACAAAGTGGCTATAGG + Intronic
1109554629 13:63955819-63955841 AGGGAGAGCAAAGGGAGTATGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111568677 13:90049014-90049036 AGGGAGAGCAAAATGAATATGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111800077 13:92970341-92970363 AGGAAGAATTAAGTGAGTGTGGG + Intergenic
1112129007 13:96500558-96500580 TGGGAGAACAGGGTGACTGCAGG + Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1112949663 13:104976764-104976786 TGGAAGAACAAAATGAATGTTGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113648180 13:112013480-112013502 AGGGAAAACATCGTGTCTGTAGG - Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115990903 14:39148485-39148507 AGGGAGAACGAAATGGCTGATGG + Exonic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116440142 14:44941669-44941691 ATGGAGAACATAATGACTTTTGG - Intronic
1116765844 14:49069923-49069945 GGGGAAAACACAGTGACTGTGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1117976066 14:61298078-61298100 AAGGGGAACAAAGAGATTGTTGG - Intronic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118090111 14:62465302-62465324 ATGGAGAACAGCATGACTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118509348 14:66453939-66453961 AGAGAGAACAGGGTGACTGGAGG + Intergenic
1118819456 14:69335482-69335504 AGGCAGAGCAAGGAGACTGTGGG - Intronic
1120246939 14:82018259-82018281 ATGGAGAAAAAAGTGACTTCAGG + Intergenic
1120869509 14:89324508-89324530 AGGGAAAACAAAGCGGCAGTAGG + Intronic
1122543839 14:102511540-102511562 GGGGAGAGCAAAGTGAGTGAAGG + Intergenic
1122676453 14:103418568-103418590 GGGGAGGACTAAGTGACTGAGGG - Intronic
1123453748 15:20396194-20396216 AGGGAGAAAAGAGTGAGTGAGGG - Intergenic
1124393148 15:29278049-29278071 AGAGAGAAACAGGTGACTGTAGG + Intronic
1125287998 15:38114929-38114951 ATGGAGAACAGATTGCCTGTAGG - Intergenic
1127550972 15:60038076-60038098 AAAGAGACCAAAGAGACTGTGGG + Intronic
1129477594 15:75796541-75796563 AGGGAGAATACAGCAACTGTGGG - Intergenic
1130371250 15:83286281-83286303 AGGCAGAAAAAAGTGCCTGGGGG - Intergenic
1130704861 15:86223653-86223675 AGGGAGACCAAAATGACCATAGG - Intronic
1132257106 15:100385173-100385195 AGGGACTACAAAGTGACATTTGG - Intergenic
1132293341 15:100718372-100718394 AGGGAGAAAAAAGTGTCTACTGG + Intergenic
1133307956 16:4822973-4822995 AGGGAGAAGGAAGTGACCTTTGG - Intronic
1136605196 16:31329201-31329223 AGGGAGAAAAAAGGGACAGGAGG - Intronic
1137807710 16:51323000-51323022 AGGGAGAAAAAAAAGAGTGTGGG + Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140211716 16:72975735-72975757 CCAGAGAACCAAGTGACTGTGGG + Intronic
1141013333 16:80423951-80423973 AAGGAGAACGTAGAGACTGTGGG - Intergenic
1141029472 16:80575122-80575144 AGGGAGGACAAAGGGACATTGGG - Intergenic
1141951017 16:87339435-87339457 AAGATGAACGAAGTGACTGTGGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144065839 17:11623344-11623366 AAGGAGAACAAAGTGAAAGGGGG - Intronic
1144327597 17:14196790-14196812 AGGGAGGGCAAAGAGAGTGTGGG - Intronic
1144458266 17:15436712-15436734 AGGGCAAACAAAGTGGCAGTGGG - Exonic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146543090 17:33714661-33714683 AGGGAGAACAATGAGACTGAAGG + Intronic
1147322764 17:39656253-39656275 AGGGAGGACACAGGGACTCTGGG - Intronic
1148415038 17:47499826-47499848 TCAGAGAACAAAGTGACTTTGGG - Intergenic
1148813708 17:50311773-50311795 AGTGATATTAAAGTGACTGTTGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149286714 17:55173189-55173211 ATGCAGAAAAAAGTGACTTTTGG + Intergenic
1149965063 17:61154075-61154097 CAGGAGAACAAAGTGGCAGTGGG - Intronic
1150336976 17:64337440-64337462 AGGGATAATACAGTGACTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1151112208 17:71691417-71691439 TGTGAGAACAAAGCCACTGTTGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153367191 18:4270296-4270318 AGGAAGAACAAAGTGAGGCTTGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153865103 18:9260393-9260415 AGGAAAAACAAACTGACTCTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1156159689 18:34344582-34344604 AAGGTGAACAGAGTGACTGTGGG - Intergenic
1156436271 18:37133338-37133360 ATGGAGAAAATAGTGGCTGTAGG + Intronic
1156860732 18:41833427-41833449 ATGGAAAAAGAAGTGACTGTTGG + Intergenic
1156977356 18:43238629-43238651 AGGGGCAACACAGTGACTGGAGG - Intergenic
1157169924 18:45393802-45393824 AGTGAGAACTCAGTGAGTGTTGG - Intronic
1157492064 18:48130387-48130409 AGGGAGAAGAAAGTGATGCTAGG + Intronic
1158225113 18:55192745-55192767 AAGGAGATTAAAGTGACTGAGGG + Intergenic
1159900460 18:74040147-74040169 AGGGAGAACAAAGGGGCTCAAGG - Intergenic
1160615202 18:80121132-80121154 AAGGAGAAAAAAGTAAGTGTTGG - Intronic
1162115864 19:8429037-8429059 ACGGAGACCAAAGTGGGTGTGGG - Intronic
1162239823 19:9341504-9341526 AAGTGGAACAAAGTGACTGCAGG - Intronic
1164588273 19:29491275-29491297 AGTGAGAACAAAGTGATTCTGGG + Intergenic
1165132901 19:33644296-33644318 ATGGAGAACAAAGTGTGTGCTGG + Intronic
1165645267 19:37430885-37430907 AGGGAGACCAGAGTGATTGCAGG + Intronic
1167007823 19:46787147-46787169 AGGGAGAAGAAAGTGATTTGGGG - Intronic
1167423030 19:49414925-49414947 AGGGCCAACAAAGTCACTGCTGG - Intronic
1167496158 19:49819670-49819692 AGGGAGTACAAGGTGGCTGCTGG - Intronic
1167613111 19:50516860-50516882 AGAGAAAACAAAGTGAATGTGGG - Intergenic
1168081284 19:54012272-54012294 AGGGAGAACACAGTTTCTCTAGG - Exonic
1168570751 19:57466856-57466878 AGAGAGCACGAAGTGAGTGTGGG - Intronic
1168683001 19:58329537-58329559 AGAGAAAACAAATTCACTGTGGG + Intronic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
926318041 2:11725803-11725825 AGGGAGAAAAAAGTGATTCCGGG - Intronic
926357306 2:12052912-12052934 AGGGAGAGGAGAGTGACTCTTGG + Intergenic
926481547 2:13403050-13403072 AGGGAGAAAAGAGTGAGTGAGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929430418 2:41881772-41881794 AGGAAGAACCAAGTGGGTGTGGG - Intergenic
929807860 2:45162741-45162763 AGGGATGACTAAGAGACTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930317554 2:49816229-49816251 GGGGAGAACAAAGCAACAGTGGG + Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
934663329 2:96154538-96154560 GAGGAGAACAAAGAGACAGTGGG - Intergenic
935263310 2:101373729-101373751 AGGGAGAAAGAAGTGACTGCAGG + Intronic
937040956 2:118820291-118820313 AGGCAGAGGAAAGTGAGTGTGGG + Intergenic
937379708 2:121365523-121365545 AGGGTGAAGACATTGACTGTTGG - Intronic
937583161 2:123513812-123513834 AGTGGTGACAAAGTGACTGTGGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941094871 2:161227674-161227696 AAGGAGAACAAGGTGAATGCTGG - Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944135809 2:196398073-196398095 AAGGGGAAAAAAGTGAGTGTAGG + Intronic
944974299 2:205030423-205030445 ATGGTGAACTAAGTGACTGGTGG - Intronic
945188114 2:207160271-207160293 TGGGAGAACAAAGGGACTACTGG + Intronic
945802365 2:214449442-214449464 TGGGAGAAAAAATTGATTGTAGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
948586244 2:239021560-239021582 AGAGAGAACAAAGGGACAGCAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169314136 20:4574127-4574149 GGGGAGAACCAAGTGACAGATGG + Intergenic
1169597185 20:7213871-7213893 AGGGAGCACAAAGGGATTGTGGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1171979510 20:31617645-31617667 AAGGAAACCAAAGTGACTGGAGG - Intergenic
1172102294 20:32492430-32492452 AGGGAGCACAAAGGGTCTTTAGG + Intronic
1172778443 20:37421713-37421735 AGGGAGACAAAAGTGAGTGGAGG - Intergenic
1173020260 20:39261277-39261299 AAGGAAAACAAGGAGACTGTGGG - Intergenic
1173713456 20:45180466-45180488 AAGGACAACAAAATGACTGTGGG + Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1179477771 21:41658916-41658938 AGGAAGAACAAAGTTGCTTTAGG + Intergenic
1179606270 21:42517515-42517537 AGGGAGGCAAAAGTGAATGTGGG + Intronic
1180253398 21:46605279-46605301 AGGAAGAAAAAAGGGCCTGTAGG + Intergenic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180625227 22:17189835-17189857 AGGGAGCGCAATGTGCCTGTTGG - Intronic
1180741708 22:18057626-18057648 ATAGAGACCAAAGTGACTATGGG + Intergenic
1183010524 22:34943065-34943087 GGGGAGAACACTGTGACTTTGGG + Intergenic
1183247989 22:36708753-36708775 AGGATGAACACAGGGACTGTGGG - Intergenic
1183777644 22:39977417-39977439 AGGGAGAACAAGGTTACTACAGG - Intergenic
1184350696 22:43941892-43941914 AGGGAGAACGAAGAGCCTGAAGG + Intronic
1184834596 22:47013862-47013884 AGGGAGGCCTAGGTGACTGTGGG - Intronic
950938952 3:16873980-16874002 AGGGAGTACACAGGGACTCTGGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951325161 3:21293313-21293335 TTGGAGAACAAAATTACTGTTGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952350445 3:32531236-32531258 AGGCAGAAGTAAGTTACTGTGGG - Intronic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
954570698 3:51638410-51638432 AGGGAGAATAAAGTGAGAGGGGG + Intronic
954823663 3:53352574-53352596 GGCGATTACAAAGTGACTGTAGG - Intergenic
955594630 3:60575160-60575182 AGGAAAAAGAAAGCGACTGTTGG + Intronic
956595856 3:70966266-70966288 AGGGGGGACCAAGTGCCTGTGGG + Intronic
957210257 3:77249425-77249447 AGTAAGAACAAAGTTTCTGTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
962587001 3:136851798-136851820 AGGAAGAGCAATGTGACAGTGGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963493626 3:146032700-146032722 AGGGATAACAAAGTAGATGTGGG - Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
963575125 3:147051131-147051153 AGAGAGAAAAAAGTAACTGCAGG + Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
965571108 3:170174508-170174530 AGTGAGCACAATGTGACTTTCGG - Intronic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
965853942 3:173065698-173065720 AGGGAAAGTAAAGTGAGTGTGGG + Intronic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
966489471 3:180511332-180511354 AAAGAAAACAAAGTGAGTGTGGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
968788726 4:2644221-2644243 AGGGAGAGCAAAGTGGGTGGGGG - Intronic
969468881 4:7374781-7374803 AGGGAGCACAAGATGGCTGTGGG - Intronic
971185037 4:24366938-24366960 AGGGAGAAATAAGTGACTTCAGG + Intergenic
971795052 4:31216475-31216497 AGGGAAAACAAATTGTCAGTGGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
975240617 4:72053295-72053317 GTGGAGAACAAAGTGAATCTGGG + Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975696480 4:77019086-77019108 AGGGAGAAGATAGAGACTGGTGG + Intronic
975880593 4:78901630-78901652 GGGGAGAAGAAAGGGAATGTGGG - Intronic
976109188 4:81652780-81652802 AGTTAAAACAAAGTGTCTGTGGG + Intronic
977725983 4:100297581-100297603 AGGCAGAACAGAATGAATGTAGG - Intergenic
978319500 4:107478496-107478518 AGTAAGAAGAAAGTGAGTGTAGG + Intergenic
978387864 4:108193797-108193819 AGTAAGAATGAAGTGACTGTGGG + Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979663104 4:123281375-123281397 AGGGGGAAAAAAGTGACATTTGG + Intronic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983522383 4:168723256-168723278 AGGGAAGACAGAATGACTGTAGG + Intronic
983665697 4:170179861-170179883 ACAGAGAGCAAAGTGAATGTTGG - Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
985487367 5:158980-159002 AGGGAAACTAAAGTGACTGCTGG - Intronic
986600598 5:9468874-9468896 ATGGAGAACAATGTGACGGTAGG - Intronic
987469908 5:18315263-18315285 AGGGAGAAGAAACTACCTGTTGG - Intergenic
987580189 5:19780444-19780466 ATGTAGAAGAAAGTGACAGTAGG - Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987946950 5:24622359-24622381 AGGGAGAAGAAAGGGCCTGAGGG + Intronic
988616898 5:32783578-32783600 AGGGAGAACAAAGTGAATATAGG + Intronic
988885542 5:35553618-35553640 TGGGAGAACAAAATCATTGTTGG - Intergenic
988930201 5:36029672-36029694 AGGATGAACACAGTGACTGAAGG + Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
990251430 5:53919524-53919546 AGTGAGAAGAAAGTGATTGAGGG + Intronic
991199762 5:63978451-63978473 AGGCAGATCAAAGTGACAGAAGG - Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991943009 5:71872942-71872964 GGGGAGAAGAAAGGGACTCTAGG + Intergenic
992176070 5:74149807-74149829 TGGGATCACAAAGTGACTTTAGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
994849282 5:105034135-105034157 ATATAGAACAAAGTGACAGTGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995421632 5:111974105-111974127 AGGGAAAACACAGTCACGGTAGG - Intronic
995632894 5:114153294-114153316 AGTGAGAACAAAGTGGAGGTGGG - Intergenic
996582245 5:125044422-125044444 AAGGAGAACGAAGTGGATGTTGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
997253469 5:132409592-132409614 AGGTAAACCAAAGTGACTCTGGG + Intergenic
997267736 5:132505915-132505937 AGGGAGAGAAAACTGTCTGTTGG + Intergenic
998228194 5:140342797-140342819 TTGGAGGATAAAGTGACTGTAGG + Exonic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999279465 5:150355488-150355510 AGGGAGAAGACAGTGTATGTGGG - Intergenic
999363560 5:151006450-151006472 AAGGAGAAGAAAGTGAGTATGGG - Intergenic
1000608718 5:163352108-163352130 AGGGAGAACCCAGAGAATGTAGG + Intergenic
1000706850 5:164523233-164523255 TGGGAGAAAAAAGTGCATGTTGG + Intergenic
1000808281 5:165825983-165826005 AGGGAAAACAAAGAGAATTTTGG - Intergenic
1001284420 5:170412115-170412137 AGGCATAACAAACGGACTGTGGG + Intronic
1003173121 6:3735640-3735662 AGTGAGCACGAAGTGACAGTGGG + Intronic
1004412238 6:15391468-15391490 AGAGGGGAGAAAGTGACTGTGGG + Intronic
1004762498 6:18684129-18684151 AGGGAGAAGAAAGTGAGTGAAGG - Intergenic
1006935853 6:37717122-37717144 AGGGAGATCATAGTGTCGGTTGG - Intergenic
1007703797 6:43779423-43779445 AGGGAGAAAAAGTTGAATGTTGG + Intronic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1009371053 6:62904564-62904586 AGAAAGAACAAAGTGACTAGAGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012827233 6:104162173-104162195 AGGGAGAACGCAGTGACCATGGG + Intergenic
1013666943 6:112358948-112358970 ATGGAGATGAAAGTCACTGTTGG - Intergenic
1014524532 6:122486267-122486289 AGGGGGAATAAAATGACTGGAGG - Intronic
1014538650 6:122648128-122648150 GGGGAGCCCAAAGTGACTGGTGG + Intronic
1015105048 6:129526829-129526851 TGGGAGAACAAAGTTATTGAAGG + Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015890822 6:137968050-137968072 TGGGAGATCAAAGTGATGGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016927462 6:149365803-149365825 ATGAATAAAAAAGTGACTGTGGG - Intronic
1018737492 6:166698442-166698464 AGTGAGAGCAAAGTGAGTATAGG + Intronic
1019844638 7:3485433-3485455 AGGGAAAGCAAAGTGAGTGTGGG - Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021249939 7:18312047-18312069 GGAGAGGACAAAGTGATTGTAGG + Intronic
1021289759 7:18828792-18828814 AGGGAGAAGAAATTCACTCTTGG - Intronic
1021501540 7:21337160-21337182 AGGAAGAACAGAGTGAGGGTAGG - Intergenic
1021514010 7:21463188-21463210 AGGGAGAATAAAGATACTTTTGG + Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022588298 7:31636671-31636693 AGGGAGAACTAACAGGCTGTGGG + Intronic
1022753375 7:33256459-33256481 AGAGAGAACAAACTGAGTTTTGG - Intronic
1022975491 7:35551935-35551957 ACAGAGAACAAAGTAACTTTTGG - Intergenic
1023752708 7:43387171-43387193 AGGGAGAACAATGGGATTGGTGG - Intronic
1024210946 7:47203406-47203428 ATGGAAAAAAAAGTGACTGAGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026510717 7:71025222-71025244 AGGGGGAAAAAAGGGAATGTGGG + Intergenic
1027501413 7:78956461-78956483 CTGGAGAACAATGTTACTGTGGG + Intronic
1027526263 7:79272971-79272993 AGAGAGACCAAAATTACTGTAGG - Intronic
1027562591 7:79751042-79751064 CGGGAGAACAGGGTGACAGTGGG + Intergenic
1027570928 7:79865674-79865696 AGGGCGAAGAAAGTGAATGAGGG - Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028068369 7:86417159-86417181 AGAGAGAACAAAATGAATCTTGG - Intergenic
1028134488 7:87211225-87211247 AGGAAGAACAAAGTGCCTGGAGG - Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1029543922 7:101200500-101200522 AGGGAGAAGAAAGGGCCTGGGGG + Exonic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031698842 7:124897959-124897981 AAGTAGAACAAAGTGCCTGATGG + Intronic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032999300 7:137485394-137485416 AGCCAGAAGAAACTGACTGTAGG + Exonic
1033410131 7:141109772-141109794 AGGAATAAAAAACTGACTGTTGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033542884 7:142373282-142373304 AGGGAGAAGAAAGTGAGATTTGG + Intergenic
1033754269 7:144385001-144385023 AGGGAGAACATTCAGACTGTTGG + Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034487117 7:151372978-151373000 AGGCAGAACAGAGTGGCTGCTGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034883689 7:154781373-154781395 AGGGAGAACGAAGTGAGAGGGGG - Intronic
1037913221 8:22756720-22756742 AGGGAGAAGAAAGTGGTTGCTGG + Intronic
1039126467 8:34207847-34207869 AAGGAAAATAAAGTAACTGTTGG + Intergenic
1039846986 8:41332473-41332495 AGGAAGAACATAGCCACTGTGGG - Intergenic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044698627 8:94948016-94948038 AGGGGGAACAATGTGACCCTTGG - Intronic
1044787292 8:95808235-95808257 AGGGAGTACAAAGTGGCTTCAGG - Intergenic
1044869389 8:96603651-96603673 AGGAAGAACAAAGGTACTCTGGG - Intronic
1045397718 8:101777508-101777530 AAGGAGAACAAAGTGAAAATAGG - Intronic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046261928 8:111780009-111780031 AGGGAGCAAAAATTGATTGTTGG + Intergenic
1046442638 8:114278559-114278581 AGGGAGGAAAAAATGAATGTGGG - Intergenic
1046442778 8:114281155-114281177 AGGGAGGAAAAAATGAATGTGGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047059615 8:121209961-121209983 AGGATGAAAAAAGTGAATGTTGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048966540 8:139618895-139618917 ATGGAGAACATGGTGACTGTGGG - Exonic
1050644410 9:7703295-7703317 AGGGAGAATACAGTCACTGAGGG - Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1052477440 9:28978268-28978290 AGGGAGAAGAAAATTAATGTGGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055461780 9:76526621-76526643 TGGGACAAAAAAGTGAATGTAGG + Intergenic
1055977051 9:81965779-81965801 AGGGAGCAAGATGTGACTGTTGG + Intergenic
1056006147 9:82273460-82273482 AGGCAGAACAACATGACTGAAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057643625 9:96853079-96853101 GTGGAGAACAAAGCGACTGGGGG + Intronic
1058282653 9:103135375-103135397 AAGAAGAATAAAGTTACTGTAGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1061080330 9:128365891-128365913 AGGGAGAACACGGGGCCTGTGGG - Intergenic
1061114986 9:128604444-128604466 AGGGAGAAACAGGTGACTGCTGG + Intronic
1061233410 9:129328124-129328146 AGGGACAACTCAGTGGCTGTGGG + Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061669027 9:132178198-132178220 AGGGAGAAGAAAATGAGGGTGGG - Intronic
1062347456 9:136121921-136121943 AGGGAGAAGCACGTGACTGCGGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186663851 X:11698673-11698695 AGGGAGATCAAAGTCCCGGTGGG + Intergenic
1186936173 X:14452033-14452055 AGGGAAAACTAAATGACCGTTGG + Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187636677 X:21237417-21237439 AGGGAGAACATAGTGACTGTGGG + Intergenic
1188609004 X:32072475-32072497 AGAAAGAACACAATGACTGTGGG - Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188962767 X:36512919-36512941 AGGGAGAAGAATGTGACGGCAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1191786943 X:64926100-64926122 AGGGACAACAATGTCACTGCAGG + Intronic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1193521957 X:82541442-82541464 AGGGAAAAAAAATTGCCTGTGGG + Intergenic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193750513 X:85337271-85337293 AGGGAGAGCAAGGTGAGTGTGGG - Intronic
1193847439 X:86491714-86491736 AGAGAAAACAAAATGACAGTCGG + Intronic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194690195 X:96974922-96974944 AGGAAGAACAAAGATAGTGTGGG + Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196290125 X:113930070-113930092 GGGGACAGCAAAGTGAGTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197657597 X:129133937-129133959 AGGGAGAAAGTACTGACTGTAGG + Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198447129 X:136728352-136728374 AGTGTGACCAAAGTGGCTGTGGG - Intronic
1198724785 X:139665474-139665496 AGGGAGATCACAGAAACTGTGGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199685826 X:150264337-150264359 AGTGAGAACCCAGTGTCTGTGGG - Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199921131 X:152405166-152405188 AGGGAGAGCAAGGTGAGTATGGG + Intronic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200920260 Y:8606866-8606888 AGGGAGAAAAAAGGGACTGGGGG + Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201513169 Y:14787791-14787813 TGGGAGAAAAATGTAACTGTGGG - Intronic