ID: 954493367

View in Genome Browser
Species Human (GRCh38)
Location 3:50929402-50929424
Sequence TATGGTTTTTAGCAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954493367_954493368 -10 Left 954493367 3:50929402-50929424 CCTGCAGCTTGCTAAAAACCATA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 954493368 3:50929415-50929437 AAAAACCATAGTCCCAAATGAGG 0: 1
1: 0
2: 1
3: 21
4: 308
954493367_954493372 5 Left 954493367 3:50929402-50929424 CCTGCAGCTTGCTAAAAACCATA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 954493372 3:50929430-50929452 AAATGAGGTTTAATAGCAATTGG 0: 1
1: 0
2: 0
3: 20
4: 216
954493367_954493373 23 Left 954493367 3:50929402-50929424 CCTGCAGCTTGCTAAAAACCATA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 954493373 3:50929448-50929470 ATTGGTGTTGTGTCTCATGTTGG 0: 2
1: 0
2: 1
3: 61
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954493367 Original CRISPR TATGGTTTTTAGCAAGCTGC AGG (reversed) Intronic
909235470 1:73147756-73147778 TATGGCTTCTATCAAGCTACTGG + Intergenic
909425701 1:75522226-75522248 TAATGTTTTGAGCAAACTGCTGG + Intronic
909682020 1:78302317-78302339 AATGGTGATTAGAAAGCTGCTGG - Intergenic
912648814 1:111420235-111420257 TATAGTTTTTAGCACAATGCTGG - Intronic
919288445 1:195597278-195597300 TATCATTTTTGGAAAGCTGCTGG + Intergenic
921300530 1:213747300-213747322 TATTGTTTTTAGCAATATGGAGG + Intergenic
921498106 1:215865732-215865754 TCTGGTTTTTATAAGGCTGCAGG - Intronic
921601403 1:217110370-217110392 TATGGTTGTGAGCAAGCTGAAGG - Intronic
924139580 1:241008436-241008458 TCTGCTTTTTAACAAGCTCCCGG + Intronic
1063860737 10:10305177-10305199 TATGTATTTTTGCAAGTTGCAGG - Intergenic
1064287346 10:14003302-14003324 TTTGGGTTTTAGGAAGCTGGGGG + Intronic
1066155989 10:32678578-32678600 TTTGGTTTTTAGCTACCTTCAGG + Intronic
1071741430 10:88362917-88362939 AATTGTTTTTATCAAGCTGAAGG + Intronic
1072090909 10:92126230-92126252 TAGGGTGTGTGGCAAGCTGCAGG - Intronic
1073121502 10:101124971-101124993 GATGGTTCTTAGAAAGCAGCGGG + Intronic
1073323253 10:102628237-102628259 TCTGGTGTTTAGGAAGCTGAGGG + Intronic
1076218919 10:128717617-128717639 TTTGGTTTTTACCCAGCTGTTGG + Intergenic
1081113213 11:39162372-39162394 TATAGTATTTAGCATGCTGCTGG - Intergenic
1083529839 11:63409679-63409701 TATGGTTTTTACCAAACTAATGG + Intronic
1084097486 11:66921221-66921243 AAGTGTTTTTAGCAAGCAGCTGG - Intronic
1084257482 11:67952919-67952941 GATGGTTTTTACCAAGCTAATGG + Intergenic
1085699906 11:78736623-78736645 TATGGTTTTTCGTAAGGTACGGG + Intronic
1088288187 11:108208424-108208446 TATGGTTTTTAGAAATTAGCTGG + Intronic
1088986390 11:114913070-114913092 ATTGGTTTTTACCAAGCAGCTGG + Intergenic
1089209388 11:116790205-116790227 CAAGGTTCTGAGCAAGCTGCAGG - Exonic
1089951314 11:122530261-122530283 TATGGTTTTTTGGAAGGTGGAGG + Intergenic
1089981982 11:122780192-122780214 AATGGTTTTCAGCAAGTTGAAGG - Intronic
1090311969 11:125748973-125748995 AAGGGTTTGTAGCAACCTGCAGG - Exonic
1092719533 12:11427104-11427126 CATTGATTTTAGCAAGCTGGAGG - Intronic
1094341255 12:29413977-29413999 TATGTTTTTTAACCAGCAGCTGG + Intronic
1097575978 12:61393111-61393133 TATGGTTTACAGAAAACTGCTGG - Intergenic
1100195792 12:92242888-92242910 TAAAGTTCTTAGCAAACTGCAGG + Intergenic
1102847171 12:116197805-116197827 CATGATTTTTAGCTAGCAGCTGG - Intronic
1106189984 13:27443191-27443213 TATGGTTATTACCCAGCTGGTGG + Intronic
1107067789 13:36234268-36234290 TGTGATTTTTAGCAAACTTCAGG + Intronic
1108966858 13:56318099-56318121 CATGGTTCTTGGCAAGCTTCAGG - Intergenic
1113218904 13:108075324-108075346 TATGTTTTATAGCAAGTTCCTGG - Intergenic
1114926382 14:27405049-27405071 TATGGTTTTTAGTAATTTTCAGG - Intergenic
1117014338 14:51503586-51503608 TAAGCTTTTTAACATGCTGCTGG + Intronic
1121826934 14:97017801-97017823 GATGGTATTCAGCAAGCAGCTGG - Intergenic
1125113533 15:36062266-36062288 TATGGCTTTTAACAAGTTGTAGG + Intergenic
1129525431 15:76210762-76210784 TGTGGTATTTAGCACGGTGCAGG - Intronic
1130728370 15:86464808-86464830 TAAGCTTTTTAACATGCTGCTGG + Intronic
1134126106 16:11617252-11617274 GATGGATTTTAGCAATGTGCTGG - Intronic
1144433011 17:15212498-15212520 TACAGTTTTCAGCAAGCTGCAGG + Intergenic
1145769418 17:27482058-27482080 TATGCTTTTTACTAAGCAGCTGG - Intronic
1147456338 17:40540526-40540548 TCTGGTTTTTCACAAGCTCCTGG + Intergenic
1152512626 17:80800759-80800781 TAGGGTTTTCAGAAAGCTCCGGG + Intronic
1153475365 18:5493485-5493507 GATGGTTTTTAGCAGACTGGTGG - Intronic
1157885870 18:51365755-51365777 TATGGCTTTTGGAGAGCTGCTGG + Intergenic
1159902113 18:74056996-74057018 TAAGGTTTTTAATGAGCTGCTGG - Intergenic
1160286012 18:77544146-77544168 TATGGGTTTTAGATTGCTGCTGG + Intergenic
1162500316 19:11049731-11049753 GGTGGTCTTTAGCAGGCTGCTGG - Intronic
1163608247 19:18287527-18287549 TATTGTTTAAAGCAACCTGCAGG + Intergenic
1167585284 19:50371217-50371239 AATGGTTTTTAGCAAGTTCACGG - Intronic
927384700 2:22519981-22520003 TATGTTTTGTAGCAAGTAGCAGG - Intergenic
931549855 2:63430929-63430951 TATGGATATTAGAAAACTGCTGG - Intronic
932140774 2:69275723-69275745 TATGGTTTTGTGCAAAATGCTGG - Intergenic
932965051 2:76463933-76463955 TATGCTTTTTTCCAAGCTGAAGG - Intergenic
932969099 2:76516848-76516870 TCTGCTTTTTAGCAGGCTCCTGG + Intergenic
932981721 2:76676757-76676779 TTTGATTTTTAGCAAGATGTTGG - Intergenic
933738960 2:85517869-85517891 CATGGTCTTTCGCCAGCTGCAGG + Intergenic
934035490 2:88085525-88085547 GATGATTTTTAGGAACCTGCAGG + Intronic
936921336 2:117691768-117691790 TATGGCCCTTAGAAAGCTGCTGG + Intergenic
943111998 2:183618349-183618371 TATGCTTTTTAATATGCTGCTGG + Intergenic
944410200 2:199433392-199433414 TGTGCTTTTTAGCCAGCTGGTGG - Exonic
1174597237 20:51693785-51693807 TATGGTTTTTAGCTTCCCGCAGG + Intronic
1175394101 20:58646942-58646964 GGTGGTTGTTAGCAGGCTGCTGG + Intergenic
1178376744 21:32073745-32073767 AATGGTTTTATTCAAGCTGCTGG - Intergenic
949269597 3:2199165-2199187 TATGTATTTCAGCAAACTGCAGG - Intronic
954493367 3:50929402-50929424 TATGGTTTTTAGCAAGCTGCAGG - Intronic
956677496 3:71749857-71749879 TACTGTTTCTAGGAAGCTGCAGG - Intronic
957015176 3:75055016-75055038 TATGATTTTTTGCAAACTTCTGG - Intergenic
957027368 3:75197994-75198016 TATGGCTTTGAGCAAGTTACTGG - Intergenic
957994802 3:87675838-87675860 TAAGGTTTTGAGCAAGCAGGTGG - Intergenic
959096732 3:101964601-101964623 GATGGTTTTTAGCAACCAGCAGG - Intergenic
959974604 3:112444604-112444626 TCTGGGATGTAGCAAGCTGCGGG + Intergenic
963990730 3:151650389-151650411 TATGGATTTTAGCAGGTTGGTGG + Intergenic
965049467 3:163626911-163626933 TGTGGCTTTTGGCAAGCTGTTGG - Intergenic
968495577 4:913774-913796 TATGTTTTGTAGAAAACTGCTGG - Intronic
971200903 4:24508286-24508308 TATGGTTTTAAAAAAGCTGTTGG + Intergenic
971565645 4:28137241-28137263 TATGGTTTTTATCAGTCTGATGG + Intergenic
972026866 4:34390737-34390759 CATGGTCTTTAGCAACCTGAAGG - Intergenic
975808057 4:78133914-78133936 TATGGTTTTAAGAAAGGTGAGGG + Intronic
975956307 4:79844414-79844436 TATTGTTTTCAGCAATGTGCTGG + Intergenic
978641843 4:110879956-110879978 TATGGTTTTTTGTAAGCTTTAGG - Intergenic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
979747964 4:124241003-124241025 TAAGCTTTTTAACATGCTGCTGG - Intergenic
979784188 4:124694633-124694655 TATGGCTTTTAAGAAGCAGCAGG + Intronic
981099622 4:140815816-140815838 TGTGTATTTTAGAAAGCTGCTGG - Intergenic
981426187 4:144606163-144606185 TATGGTGGTTTGCAAACTGCTGG + Intergenic
984117842 4:175704438-175704460 CATTGTTTTTAGCCATCTGCTGG - Intronic
990505126 5:56436286-56436308 TAATGTTTTTAGCAAACTGTGGG + Intergenic
993042067 5:82825390-82825412 TATTATTTTTTGCTAGCTGCTGG - Intergenic
994262108 5:97671873-97671895 GCTGGTTTTTAGAGAGCTGCAGG + Intergenic
994884602 5:105543447-105543469 TGTGGTTTTTGGCTATCTGCTGG + Intergenic
995106602 5:108382298-108382320 TAAGGTTTTTCCGAAGCTGCTGG + Intergenic
998784029 5:145689656-145689678 CATGGATTTAAGCAAGCTCCAGG + Intronic
1002590602 5:180289563-180289585 TCTGTTTCTTAGCAAGCAGCTGG - Intronic
1003135606 6:3432805-3432827 TAAGGTTTTTAGCAAGGAGCAGG + Intronic
1003869960 6:10393864-10393886 TATTGTTTGTAGCATCCTGCTGG - Intronic
1003904671 6:10688424-10688446 CTTAGTTATTAGCAAGCTGCAGG - Intronic
1009884293 6:69606013-69606035 TATGGTGTTTAGCAAACTGTAGG - Intergenic
1018167978 6:161117283-161117305 TGTTGTTGTTGGCAAGCTGCAGG + Exonic
1022942725 7:35255346-35255368 AATAGTTTTTAACAAGGTGCTGG + Intergenic
1028559932 7:92163570-92163592 TTTGGTTTTTACCAAGATCCAGG + Exonic
1030187210 7:106775952-106775974 TATAGTTTCTGGCATGCTGCAGG - Intergenic
1032723686 7:134571507-134571529 TGTGGTATTTAGCAAGCATCAGG + Intronic
1038550239 8:28461219-28461241 TATGGCTTTTACCATGTTGCAGG + Intronic
1039604503 8:38869288-38869310 TAGTGTTTTTAACAAGCTCCAGG + Intergenic
1041596088 8:59654732-59654754 TATTGGTATTATCAAGCTGCAGG - Intergenic
1045028550 8:98113723-98113745 TATGCTCTTTAGCAGGCTCCAGG + Intronic
1048599152 8:135900464-135900486 TTTGGTTCTTAGGAACCTGCTGG + Intergenic
1050897038 9:10896503-10896525 TATGGTTTTTAGGATGAGGCAGG + Intergenic
1052900405 9:33789145-33789167 TCTGGTTTTTAGTAGTCTGCTGG + Intronic
1055059547 9:72054552-72054574 TATGTTTTTTACCAATCTGATGG + Intronic
1057512287 9:95690626-95690648 TCTGGCTTTTTTCAAGCTGCAGG - Intergenic
1061797973 9:133099255-133099277 TCTGGTTTATAGCAGGCTGTGGG - Intronic
1186099265 X:6137875-6137897 TATAGTTTTGAGAAAGCAGCTGG - Intronic
1186250457 X:7660409-7660431 GATGCTTTTTATCAAGCTGGAGG + Intergenic
1186906684 X:14118761-14118783 CATGTTTTTTAGAAAGCTGATGG + Intergenic
1187308100 X:18115347-18115369 TCTGATTTTTAGCAACTTGCAGG - Intergenic
1187967259 X:24624367-24624389 TTTGATTTTTAGCAAATTGCTGG + Intronic
1188324266 X:28781262-28781284 TATGGTTTTTTGCAAACTTGAGG + Intronic
1193231339 X:79050333-79050355 TATGGTCTTCAGGAAGCTGAAGG - Intergenic
1199768136 X:150955180-150955202 TCTGGGTTTTAGCAAGCCTCTGG + Intergenic
1201967141 Y:19750531-19750553 TATGTTTTTTGCCATGCTGCTGG + Intergenic