ID: 954493424

View in Genome Browser
Species Human (GRCh38)
Location 3:50930339-50930361
Sequence CAGATCCACAGCCCCCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954493422_954493424 -1 Left 954493422 3:50930317-50930339 CCTTGTAGTGAGTGCAGAGGTCC 0: 1
1: 0
2: 1
3: 7
4: 114
Right 954493424 3:50930339-50930361 CAGATCCACAGCCCCCGCCTTGG 0: 1
1: 0
2: 0
3: 22
4: 256
954493420_954493424 27 Left 954493420 3:50930289-50930311 CCATAGTGTCAAATTTAAAATCT 0: 1
1: 0
2: 0
3: 33
4: 360
Right 954493424 3:50930339-50930361 CAGATCCACAGCCCCCGCCTTGG 0: 1
1: 0
2: 0
3: 22
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954493424 Original CRISPR CAGATCCACAGCCCCCGCCT TGG Intronic
900361220 1:2289971-2289993 CACCTCCACAGCCCCCTCCTTGG + Intronic
900513799 1:3072032-3072054 CTGAGCCACAGCCCCGGCTTGGG - Intronic
900563341 1:3319548-3319570 TTGATCCACAGCCTCAGCCTGGG - Intronic
900652044 1:3734521-3734543 CAGCTCCACACCCCCTGCCTAGG + Exonic
902371071 1:16007082-16007104 CAGATCCCCAGGTCCCACCTGGG - Exonic
902675321 1:18004765-18004787 CTGATCCACAGCCCCCACATAGG + Intergenic
902841027 1:19073941-19073963 CAACTCCACAGCCCCTGGCTGGG + Intergenic
903651581 1:24925811-24925833 CAGAGCCACAGTCCCAGCCTCGG + Intronic
905886493 1:41494729-41494751 GAGATCCACAGCCCCAGCCCTGG - Intergenic
908227593 1:62071718-62071740 GTGATCCACCGCCCCCACCTTGG + Intronic
908259448 1:62327945-62327967 CAGATCCACAGCCGCAGTTTGGG + Intergenic
909564913 1:77043459-77043481 CAGAGCCACAGACCCCAGCTAGG - Intronic
913231185 1:116741984-116742006 CAGTTCCACGCCCGCCGCCTCGG + Intergenic
915703425 1:157820009-157820031 CAGATCAACAGCAACAGCCTCGG + Exonic
915798701 1:158765703-158765725 CATATCCTCAGGCCCGGCCTTGG + Intergenic
916791874 1:168132303-168132325 GAGAGCCACAGCGCCCGGCTTGG - Intronic
917176841 1:172245067-172245089 CATATGAACAGCCCCCTCCTGGG - Intronic
917494950 1:175531891-175531913 CAGATCCTCAGCTCTTGCCTAGG - Intronic
920056321 1:203195131-203195153 CAGATGCACAGCCCCCTGCCTGG + Intergenic
920074333 1:203325695-203325717 CTGATCCCCAGCCCCTGGCTGGG - Intergenic
921065823 1:211621300-211621322 CAGGGCCACAGCCCTAGCCTCGG + Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
923765560 1:236889772-236889794 CACATCCACAGTCCCAGCCACGG - Intronic
924230504 1:241958356-241958378 CAGCTCCGCAGCCTCTGCCTGGG - Intergenic
1065046658 10:21752212-21752234 CAGAACCACAGCCCTCTCCATGG + Intergenic
1065323611 10:24531402-24531424 CAAATCCATAGCCCCTGGCTTGG - Intronic
1066182948 10:32981117-32981139 CAGAACCCCAGGCCCCTCCTGGG - Intronic
1067833377 10:49622945-49622967 CAGACCCACAGCCCCTTCCAGGG + Intronic
1069750228 10:70740820-70740842 GAGCTCCACAGCCCCCACCCTGG + Intronic
1070531189 10:77338817-77338839 CAGATCTAAAGCCCCTGTCTTGG + Intronic
1070604543 10:77889517-77889539 CAGGACCACAGTCCCCGACTGGG - Intronic
1072003620 10:91220984-91221006 CAGCTCCGAAGCCCCCGCCCGGG - Intronic
1074346460 10:112690943-112690965 CATATGCACAGGCCCAGCCTGGG - Intronic
1075328305 10:121552914-121552936 CAGAGACAAAGCCCCTGCCTAGG - Intronic
1076364167 10:129911327-129911349 CAGAGCCACAGCCCAAGCCTTGG + Intronic
1077135059 11:994349-994371 CAGAGCCACAGCCAGAGCCTGGG - Intronic
1077184563 11:1230391-1230413 CAGAGCCACATCCCCCACATGGG + Intronic
1077466617 11:2736534-2736556 CAGCTCCAAAGCCCCCTCCTAGG - Intronic
1079125300 11:17714460-17714482 CAGAGCCACAGGCCCAGCCTGGG + Intergenic
1079184245 11:18221716-18221738 CAGGTCCACAGCCACAGCTTGGG + Intronic
1081072843 11:38631604-38631626 CAGCACCACAGCCCCTTCCTAGG + Intergenic
1081645020 11:44784183-44784205 CAGATCCAGAGTCCCCTTCTGGG + Intronic
1081899799 11:46617934-46617956 CAGATCCACAGCCTCCCACCCGG - Intronic
1084516135 11:69638917-69638939 CAGCTGCCCAGCCCCCACCTGGG - Intergenic
1086887940 11:92225443-92225465 CAGATCCTCAGCCCCAAACTTGG - Intergenic
1088933900 11:114379467-114379489 CACATCCCCCGCCCCTGCCTTGG + Intergenic
1091455273 12:602303-602325 CTTATCCCCAGCCCCAGCCTAGG + Intronic
1091975680 12:4822792-4822814 CAGATGCACAGCCCGTGGCTGGG - Intronic
1092191854 12:6526939-6526961 CAGAGCCACATCCCCAGCCAGGG - Exonic
1092507985 12:9124397-9124419 CAGATCCACAGCCGCAGTTTGGG - Intergenic
1093758542 12:22879974-22879996 CAAATCCCCAGCCCACTCCTAGG + Intergenic
1094155397 12:27332975-27332997 CTGCTCCAGAGCCGCCGCCTGGG + Intronic
1098426052 12:70366509-70366531 CAGCCCCCCAGCCGCCGCCTGGG - Exonic
1104898613 12:132176120-132176142 CAGAGCCAAAGCCCTCACCTTGG + Intergenic
1104918445 12:132278409-132278431 TACATCCACAGCCCCCGCCCGGG + Intronic
1104927632 12:132321926-132321948 CCTCTCCCCAGCCCCCGCCTCGG + Intronic
1104927645 12:132321956-132321978 CACCACCCCAGCCCCCGCCTCGG + Intronic
1104995087 12:132649269-132649291 CAGAGCCACTGCCCTCCCCTTGG + Intronic
1105281560 13:18965540-18965562 CAGGGCCACAGCCAGCGCCTGGG - Intergenic
1105290757 13:19051518-19051540 CAGGGCCACAGCCAGCGCCTGGG - Intergenic
1105699899 13:22927711-22927733 CAGAACTACAGCCCCTTCCTGGG - Intergenic
1105800177 13:23896292-23896314 CAGATCCCCAGACCCTGCCTAGG + Intronic
1105852709 13:24349895-24349917 CAGAACTACAGCCCCTCCCTGGG - Intergenic
1106208579 13:27621109-27621131 CAGGCGCCCAGCCCCCGCCTCGG - Exonic
1108592878 13:51926346-51926368 CAGCTCCACAGCCCCCGTTCTGG + Intergenic
1110860542 13:80341154-80341176 CGCACCCACCGCCCCCGCCTCGG - Intergenic
1110892470 13:80707747-80707769 CAGGTTCTCAGTCCCCGCCTCGG - Intergenic
1113578583 13:111412056-111412078 CAGATCCACAGCCCTGGGCCGGG + Intergenic
1117197592 14:53355950-53355972 CAGGCCCACAGCCCTTGCCTGGG + Intergenic
1117735635 14:58765755-58765777 CAGAGACACAGCCCGCTCCTCGG - Intergenic
1118768662 14:68927337-68927359 CAGCTCCACACCCCCAGCCTGGG + Intronic
1118810728 14:69271256-69271278 CAGTTCCAGAGCCCCGGCCCCGG - Intronic
1119908525 14:78327845-78327867 CAGATCCTGAGCCCAGGCCTAGG - Intronic
1122409993 14:101520974-101520996 CAGCTCCACAGCTCCCCGCTAGG - Intergenic
1122605408 14:102944689-102944711 CACATCCACAGCGCGCTCCTGGG + Intronic
1122609752 14:102973823-102973845 CTGCTGCACAGCCCCCGCGTCGG - Intronic
1122883818 14:104701781-104701803 CAGGTCCCCAGCGTCCGCCTGGG - Intronic
1122903057 14:104789835-104789857 CAGACCCAGAGGCCTCGCCTGGG + Intronic
1125752248 15:42036807-42036829 CAGGCCCACAGCCCCAACCTGGG - Intronic
1127731585 15:61807046-61807068 AAGAACCACAGCCCCAGACTTGG + Intergenic
1128778833 15:70344667-70344689 CCCATCCCCAGCCCCCACCTTGG + Intergenic
1129290498 15:74563261-74563283 CAGGTCCACACCCCCATCCTGGG - Intronic
1129928342 15:79385689-79385711 CAGATCCACAGCCACAGTTTGGG + Intronic
1130407030 15:83611533-83611555 GAGATCCACAGCAGCCACCTGGG + Intronic
1132468895 16:90726-90748 CAGTTCCCCAGCCCCCTCCCAGG - Intronic
1132727320 16:1344602-1344624 CAGGACCACAGCGCCTGCCTGGG + Exonic
1132892110 16:2209599-2209621 CTGCACCAAAGCCCCCGCCTGGG + Exonic
1132939564 16:2500129-2500151 CAGCTCCCCAGCCCCTGGCTCGG + Intronic
1133439323 16:5807247-5807269 CATATCCACAGCCCCCGTGAAGG - Intergenic
1136351524 16:29711672-29711694 CTGAGCCACTGCCCCCGGCTGGG + Intergenic
1137573801 16:49584953-49584975 CAGATCCAGAGCCTCCTCCCCGG + Intronic
1140665981 16:77227972-77227994 CAGAGCCTCAGCCCCCTCATGGG - Intergenic
1143102396 17:4511649-4511671 CAAAGCCACAGCCTCTGCCTTGG + Intronic
1143845099 17:9767878-9767900 CATAGCCACAGCCAGCGCCTGGG - Intergenic
1151139114 17:71975109-71975131 CAGATCCAGAACCCCCTCCTAGG + Intergenic
1151547151 17:74800157-74800179 CAGTTCCATAGGCCCTGCCTTGG + Intronic
1151627378 17:75285590-75285612 CAGAGCCACGACCCCCACCTAGG - Intronic
1152158365 17:78650121-78650143 CAGATGCGCAGGCCCTGCCTTGG + Intergenic
1152583483 17:81179163-81179185 GAGACCCACACCCCCCTCCTTGG - Intergenic
1154277777 18:12977012-12977034 CAGAATCTCAGCCCCCTCCTGGG - Intronic
1156498744 18:37543505-37543527 CAGAGCCACAGCCCCTGCCCAGG - Intronic
1157311919 18:46559404-46559426 CAAACCCACAGCCCCCACCCAGG + Intronic
1158082147 18:53605328-53605350 CATAGCCACAGCCACAGCCTGGG + Intergenic
1159917178 18:74198122-74198144 CTGAACCACTGCCCCCGCCCCGG - Intergenic
1160823907 19:1070764-1070786 CTGATCCACCGCGCCCGGCTGGG + Intronic
1161293771 19:3509150-3509172 CAGAGCCAGAGCCCCTTCCTGGG + Intronic
1161327845 19:3672008-3672030 CAGCGGCAGAGCCCCCGCCTCGG - Intronic
1162302146 19:9850102-9850124 CACATCCACAGCCCCCACACTGG - Intergenic
1162398359 19:10430804-10430826 CAGCTCCCCAGCGCCCGCCGAGG + Intronic
1162462908 19:10823922-10823944 CAGGCCCAGAGCCCCCACCTGGG + Intronic
1163148975 19:15400083-15400105 ACCATCCACAGCCTCCGCCTGGG + Intronic
1163695691 19:18762199-18762221 CAGGTCCCCAGCGCCCGCCCGGG + Intronic
1163710641 19:18844749-18844771 AAGTTCCACAGCCCACGCCAGGG - Intronic
1164506482 19:28865414-28865436 CAGATGCACAGCCCTGGCATGGG - Intergenic
1165074795 19:33274848-33274870 CAGCTCCAGAGCCCCCACCCCGG - Intergenic
1165248687 19:34513178-34513200 CAGAGCCACAGGCCCAGCCCTGG - Intergenic
1165266328 19:34665777-34665799 CAGAGCCACAGGCCCAGCCCTGG + Intronic
1165476803 19:36035343-36035365 CAGCCCCACCGCCCACGCCTGGG - Exonic
1165846439 19:38820892-38820914 CAGTGCCAGAGCCCCCTCCTGGG - Intronic
1166110755 19:40621633-40621655 CCCTTCCACAGCCCCTGCCTTGG - Intronic
1166217915 19:41348215-41348237 CCGACCCACAGCCACCCCCTTGG + Intronic
1166556028 19:43700345-43700367 CGGATCCTCAAGCCCCGCCTTGG - Intergenic
1166695562 19:44849493-44849515 CAGCTCCCCCGCCCCTGCCTGGG + Intronic
1166752106 19:45169188-45169210 CAGGTGCAGAGCCACCGCCTGGG + Intronic
1167017366 19:46849954-46849976 TAGATCCAAAGCCCCAACCTGGG + Intronic
1167239506 19:48334869-48334891 CAGATCCCCAGCCGGTGCCTTGG - Intronic
1167849541 19:52190894-52190916 CTGCTCCCCAGCCCCAGCCTGGG - Intronic
1168098079 19:54126725-54126747 CAGAAGCACTGCCTCCGCCTTGG - Intronic
1168303286 19:55419342-55419364 CAGATCCACAGCCACAGTTTGGG - Intergenic
925701717 2:6645631-6645653 CAGATCCACACACCCATCCTGGG - Intergenic
926296245 2:11571021-11571043 TATATCCAGAGCCCCTGCCTTGG - Intronic
926889764 2:17629115-17629137 CAGCTCCAGAGCCCCAGGCTGGG - Intronic
927110745 2:19862225-19862247 CAAATCCAGTGCCCACGCCTGGG - Intergenic
927464958 2:23329864-23329886 CAGAGCCACACCCCCTGCCGTGG + Intergenic
927863450 2:26574573-26574595 CCAGTCCACAGCTCCCGCCTGGG - Intronic
931276242 2:60746210-60746232 CAGTTCCACAGCCCATGCCACGG + Intergenic
931806753 2:65814574-65814596 CAGATGCACATCACCCTCCTCGG - Intergenic
931882092 2:66578160-66578182 CTGCTCCTCAGCCCCCGCCTTGG + Intergenic
932131278 2:69189615-69189637 CACCTCCACAGCTCCTGCCTGGG - Intronic
932719972 2:74131594-74131616 CTGCTCCACAGCCCTCCCCTGGG - Intronic
932725721 2:74178547-74178569 CAGCTACCCCGCCCCCGCCTCGG + Intronic
936370517 2:111898718-111898740 CAGATCCGCAGCCCCGGGATGGG + Exonic
937239938 2:120453409-120453431 TGATTCCACAGCCCCCGCCTGGG - Intergenic
937985648 2:127637026-127637048 CAGATCTGCTGGCCCCGCCTGGG - Intronic
943526194 2:189020546-189020568 CAGATCCACAGCCACAGCTTTGG - Intergenic
944513260 2:200485153-200485175 CTGATCCACAGCCCCCAGTTAGG + Intergenic
944586479 2:201178077-201178099 CAGATCCACAGCCGCAGTCTGGG - Intergenic
946369107 2:219269811-219269833 CAGATCCACAAACACCGCCTGGG - Intronic
946379225 2:219333163-219333185 CACATCCACTGCCATCGCCTTGG + Exonic
946392619 2:219425772-219425794 CACATCCATAGCCCCCACCAAGG - Intronic
946392732 2:219426263-219426285 CAGGGCCACCGCTCCCGCCTGGG - Exonic
947625625 2:231616444-231616466 CAGAGGCACAGCCCCTGGCTGGG + Intergenic
949060935 2:241956902-241956924 CAGAGCCACAGCCTCCACCAGGG - Intergenic
1169074537 20:2752678-2752700 CAGGCCCACCGTCCCCGCCTGGG + Intronic
1171364742 20:24616261-24616283 TAGAGCCACAGCCCCTGTCTCGG - Intronic
1171411309 20:24950361-24950383 CTGCTGCACAGCCCCCACCTGGG - Intronic
1172799456 20:37565775-37565797 CACCTCCACAGCCACCACCTTGG - Intergenic
1172873911 20:38152774-38152796 CAGCTCCACAGTTCCCGCCCCGG + Intronic
1173231383 20:41201710-41201732 CAGATCCACAGCCACTGGGTAGG - Intronic
1174105850 20:48161673-48161695 CAGGGCCACAGCCCCAGGCTGGG + Intergenic
1174402377 20:50282962-50282984 CACCTCCACGGCCCCCGCTTCGG + Intergenic
1175439855 20:58982608-58982630 CAGAAACACATCGCCCGCCTTGG - Intronic
1176063490 20:63182429-63182451 CACATCCCCAGCCCCGGGCTGGG - Intergenic
1176098261 20:63353847-63353869 CAGAACCACAGCCCCCCCGAGGG - Intronic
1177262417 21:18748493-18748515 CAGTTCCACAGCCACAGCTTCGG + Intergenic
1178523268 21:33303771-33303793 CAGACCTACAGCCCCCGCTCTGG + Intergenic
1178909905 21:36666110-36666132 CAGACCCTCAGGCCCCTCCTGGG + Intergenic
1180179082 21:46109940-46109962 CAGATCCACAGCCACGACTTGGG + Intronic
1180762402 22:18220169-18220191 CAGAGCCACGACACCCGCCTGGG - Intergenic
1180773266 22:18404439-18404461 CAGAGCCACGACACCCGCCTGGG + Intergenic
1180804619 22:18653988-18654010 CAGAGCCACGACACCCGCCTGGG + Intergenic
1180806129 22:18715422-18715444 CAGAGCCACGACACCCGCCTGGG - Intergenic
1181043225 22:20202757-20202779 CAGTCCCACAGCCCCTGCCAAGG - Intergenic
1181192362 22:21151372-21151394 CAGAGCCACGACACCCGCCTGGG + Intergenic
1181217077 22:21341203-21341225 CAGAGCCACGACACCCGCCTGGG - Intergenic
1183096024 22:35552824-35552846 CAGATCCACGGCCTCCACCCGGG + Exonic
1183952460 22:41359156-41359178 CATGGCCACAGCCCCCACCTTGG - Exonic
1184046064 22:41972905-41972927 CAGATCCACAGACCTAGCCCTGG + Intergenic
1184270355 22:43377708-43377730 AAGATCCACAGGCCCAGCTTTGG + Intergenic
1184489082 22:44799053-44799075 CCCATCCCCAGCCCCCACCTGGG + Intronic
1184651536 22:45921455-45921477 CAGGTCCAGAGCCCCAGGCTGGG + Exonic
1184656367 22:45944027-45944049 CAGAGTCCCAGCCCCCACCTCGG + Intronic
1185149707 22:49157143-49157165 CAGCTCCACAGCATCCGCCCAGG + Intergenic
1203235096 22_KI270731v1_random:145421-145443 CAGAGCCACGACACCCGCCTGGG + Intergenic
949157634 3:848135-848157 CAGACCCACAAACCCCACCTGGG + Intergenic
949201231 3:1381907-1381929 CAGAACCACAGGCACCGTCTTGG - Intronic
950135693 3:10579341-10579363 CAGCTGCACAGACCCCACCTTGG - Intronic
950345361 3:12287941-12287963 CCGAGCCGCAGCCGCCGCCTGGG + Intronic
952774503 3:37031759-37031781 GACATCCAAAGCCCCAGCCTGGG + Intronic
953366705 3:42351561-42351583 CAGCTCCACAGCCCAGGCCCAGG - Intergenic
953607121 3:44419441-44419463 GAGACCCACAGCCCCTGCCCTGG + Intergenic
954493424 3:50930339-50930361 CAGATCCACAGCCCCCGCCTTGG + Intronic
955224373 3:57049043-57049065 CAGATTCCCAGACCCAGCCTTGG - Intronic
956332336 3:68125515-68125537 GAGAGACACAGCCCCTGCCTGGG + Intronic
960296139 3:115946366-115946388 CAGGATCACAGCCCACGCCTTGG - Intronic
961142752 3:124569096-124569118 CAGACCCTCAGCCCCAGCCAGGG - Intronic
962105376 3:132383539-132383561 CAGTTCCACAGCCACAGCTTGGG + Intergenic
968986756 4:3879852-3879874 GAGAGCCACAGCCCCGGCGTGGG + Intergenic
969320354 4:6408671-6408693 CAGATTCCCAGGCCCCGCCCAGG - Intronic
969427747 4:7135621-7135643 CAGGTCTGCAGCCCCAGCCTGGG - Intergenic
969855578 4:9996527-9996549 CAGAGCCACAGCACCCACATGGG - Intronic
971365363 4:25972590-25972612 CAGATCACCAGCCCCAGCCCTGG - Intergenic
973214018 4:47648844-47648866 CACATCCACAGCCACTTCCTGGG - Intronic
975469358 4:74747420-74747442 CACAACCACAGCTCCTGCCTAGG + Intronic
975670834 4:76779071-76779093 CAGAGCCAGGGCCCCAGCCTTGG - Exonic
977487432 4:97666120-97666142 CAGATCCACAGCCATAGCTTAGG + Intronic
982350104 4:154406161-154406183 CATATGCACAGCCCAGGCCTAGG + Intronic
982817813 4:159908150-159908172 CATAGCCACAGCTCCAGCCTTGG - Intergenic
984600410 4:181719879-181719901 CTGATTCACAGCCACCTCCTTGG + Intergenic
985495577 5:202997-203019 GTGATCCACCGCCCCCACCTCGG - Exonic
985541224 5:488630-488652 CAGACCCCCAGCCCCCTCCAGGG + Intronic
985644521 5:1078754-1078776 GAGATCCACAGCCCTCGTCAAGG + Exonic
985793566 5:1945829-1945851 CAGAACCCCAGCCCCCCACTGGG - Intergenic
986710612 5:10485815-10485837 CAGACCCTCAGGCCCAGCCTTGG - Intergenic
992614157 5:78533838-78533860 CAAATCTACAGGCCCTGCCTCGG + Intronic
996736986 5:126767172-126767194 GTGATCCACACCCCCCCCCTTGG + Intergenic
998170679 5:139870495-139870517 TAGATCCACAGCCCCCTTCCTGG - Intronic
998790997 5:145766267-145766289 CAGATCCCCAGGCCCCTCCCAGG + Intronic
1000973206 5:167737375-167737397 AAGAGCCACTGCCCCAGCCTGGG + Intronic
1001050261 5:168408448-168408470 CAGACCCAGAGCTCCCTCCTGGG + Intronic
1001299034 5:170520481-170520503 CAGCTCCACAGTCCCTCCCTGGG + Intronic
1002029207 5:176415978-176416000 CAGATCCACAGCCCCAGGCGAGG + Intronic
1003058166 6:2841596-2841618 CTGATCCCCCGCCCCCGCCTGGG - Intronic
1006153012 6:31999236-31999258 CAGAAGCCCAGCCCCAGCCTGGG - Intronic
1006159320 6:32031973-32031995 CAGAAGCCCAGCCCCAGCCTGGG - Intronic
1006238821 6:32660053-32660075 CAGAGTCACAGCCAGCGCCTTGG + Exonic
1007112698 6:39322237-39322259 CAGATCCACAGTCCTCACCCAGG - Intronic
1007683214 6:43648747-43648769 CACTTCCACAGCTCCCACCTTGG - Intronic
1012122282 6:95384022-95384044 CAGGTCCACAGCCACAGCTTGGG - Intergenic
1015378517 6:132538306-132538328 CAGCTCCACAGCCTCAGCTTGGG - Exonic
1018034413 6:159869197-159869219 GTGATCCACAGCCTCGGCCTCGG + Intergenic
1019295470 7:271882-271904 CACATCCTCAGCCTCTGCCTGGG - Intergenic
1019412414 7:912080-912102 CACAGCCCCAGCCCCCTCCTGGG + Intronic
1019423558 7:962890-962912 CAGAGCCACAGACCCTCCCTGGG - Intronic
1019685527 7:2379911-2379933 CTGCTCCCCAGCCCCCGACTTGG - Intronic
1020014114 7:4821017-4821039 CACAGCCACAGCCCCCTCCCAGG + Intronic
1020467602 7:8498470-8498492 CAGTTCCATAGACCCAGCCTTGG + Intronic
1021446469 7:20739057-20739079 CAGATGCGCAGCCCCCGATTTGG - Exonic
1022896095 7:34751650-34751672 CAGAGCCACATCCCCAGCCAGGG + Intronic
1024766666 7:52668568-52668590 CGACCCCACAGCCCCCGCCTTGG - Intergenic
1024961549 7:54981735-54981757 CAGGCCCACAGCCCCTGCCAGGG + Intergenic
1026875340 7:73876199-73876221 GAGACCCCCAGCCCCAGCCTTGG - Intergenic
1029479218 7:100802738-100802760 CACATCCCCGGACCCCGCCTGGG - Exonic
1029570244 7:101363766-101363788 CAGAGCCCCAGCCCCAGCCACGG - Intronic
1029993044 7:104979516-104979538 CAGAACCACAGGCACTGCCTTGG - Intergenic
1032821263 7:135526477-135526499 CTTATCCACAGCCCTCACCTTGG - Intergenic
1033284466 7:140028401-140028423 CAGAGCCACAGCCAACTCCTGGG + Intronic
1034569542 7:151944291-151944313 CAGCCCCACAGCCCCAGCCCCGG + Intergenic
1035155444 7:156908533-156908555 CAGGTGATCAGCCCCCGCCTCGG - Intergenic
1035312700 7:157979886-157979908 CAGAGCCAGAGCCCCCGACTGGG + Intronic
1035574927 8:698102-698124 CAGATCCACAACCCCTGCACGGG - Intronic
1035734862 8:1880910-1880932 CACAGCCACAGCCGCCCCCTGGG + Intronic
1036784541 8:11677221-11677243 CCTCTCCACAGCCTCCGCCTCGG - Intronic
1037980057 8:23246876-23246898 CTGAGCCACAGCCGCCGCCAGGG + Exonic
1039212827 8:35235839-35235861 CAGAAGCACAGCCCCAGCCACGG - Exonic
1039468160 8:37797922-37797944 TAGGACCACAGCCCCCTCCTGGG - Intronic
1044874990 8:96656657-96656679 CATCTCCACATCTCCCGCCTGGG + Intronic
1047315693 8:123731010-123731032 CTGAGGCACAGCCCCAGCCTGGG + Intronic
1048369476 8:133765088-133765110 CAGGTCCACAGCCAGCCCCTAGG - Intergenic
1049189475 8:141278959-141278981 CAAAGCCCCAGCCCCCACCTTGG + Intronic
1049201982 8:141344852-141344874 CAGATACACTGCCCACCCCTAGG - Intergenic
1052855150 9:33402388-33402410 CTGATTCTCAGCCTCCGCCTTGG + Exonic
1053163487 9:35829317-35829339 CAGGTCCCCGGCCCCCGCCCCGG + Intronic
1053435088 9:38069008-38069030 CGGAGCCGCAGCCTCCGCCTTGG + Exonic
1053507090 9:38652242-38652264 CAGATTCACAGGCCCCACCCAGG - Intergenic
1057271269 9:93652983-93653005 CAGGGCCACAGCCAGCGCCTGGG + Intronic
1057386770 9:94611813-94611835 CAGATTCTCAGGCCCCGCCATGG - Intronic
1058554807 9:106155753-106155775 CAGATCCATAGCCTCTTCCTTGG - Intergenic
1059384502 9:113953815-113953837 CAGAGGCACAGCCCCTGCCTGGG + Intronic
1059765311 9:117378567-117378589 CATATCCACTGCCCCCTTCTTGG + Intronic
1060200936 9:121651558-121651580 CGGGTCCCCAGCCCCCGCCGCGG + Intronic
1061419044 9:130463447-130463469 CAGCACCACAGCCACCCCCTCGG - Intronic
1061568321 9:131459298-131459320 CAGACCCTCAGCCACCGCCCAGG + Exonic
1188084903 X:25892361-25892383 CAGATCCAAAGCCCGTGCTTAGG - Intergenic
1191603934 X:63041436-63041458 TAGCTCCACAGCTCCTGCCTTGG - Intergenic
1192182394 X:68924367-68924389 CAGCTCCACAGCCTCCACCGTGG + Intergenic
1193467781 X:81868829-81868851 CAGGTCTACAGCCCCCACTTGGG + Intergenic
1199248112 X:145630691-145630713 GAGATCCACAGCCCCCGCAGAGG - Intergenic
1199252734 X:145682705-145682727 GAGATGCACAGCCCAGGCCTTGG - Intergenic