ID: 954493700

View in Genome Browser
Species Human (GRCh38)
Location 3:50931985-50932007
Sequence ATGGACAAGAGTACCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 2, 1: 1, 2: 12, 3: 40, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954493700_954493705 7 Left 954493700 3:50931985-50932007 CCCACAAAGGTACTCTTGTCCAT 0: 2
1: 1
2: 12
3: 40
4: 170
Right 954493705 3:50932015-50932037 GGTCAAAATTGATGCTTCTTGGG 0: 1
1: 0
2: 2
3: 16
4: 157
954493700_954493706 8 Left 954493700 3:50931985-50932007 CCCACAAAGGTACTCTTGTCCAT 0: 2
1: 1
2: 12
3: 40
4: 170
Right 954493706 3:50932016-50932038 GTCAAAATTGATGCTTCTTGGGG 0: 1
1: 0
2: 5
3: 22
4: 174
954493700_954493707 9 Left 954493700 3:50931985-50932007 CCCACAAAGGTACTCTTGTCCAT 0: 2
1: 1
2: 12
3: 40
4: 170
Right 954493707 3:50932017-50932039 TCAAAATTGATGCTTCTTGGGGG 0: 1
1: 0
2: 4
3: 19
4: 186
954493700_954493704 6 Left 954493700 3:50931985-50932007 CCCACAAAGGTACTCTTGTCCAT 0: 2
1: 1
2: 12
3: 40
4: 170
Right 954493704 3:50932014-50932036 TGGTCAAAATTGATGCTTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954493700 Original CRISPR ATGGACAAGAGTACCTTTGT GGG (reversed) Intronic
900888740 1:5433679-5433701 ATGGAGAAGAGTACCTGGCTGGG + Intergenic
903083912 1:20837650-20837672 AAGGACAATACTATCTTTGTAGG + Intronic
911934150 1:103945689-103945711 ATTGAAAAGAGCTCCTTTGTTGG + Intergenic
911941486 1:104052999-104053021 ATGGACATGAGAAACTTTTTGGG - Intergenic
914339855 1:146750793-146750815 ATGGACAAGAATACCTTATGAGG - Intergenic
918247077 1:182669868-182669890 AAGGACAAGTGGACATTTGTGGG - Intronic
919403134 1:197145625-197145647 ATTGACAGGAGTACCTTGGTTGG - Intronic
919651523 1:200154237-200154259 ATGATTAAGAGTACTTTTGTGGG + Intronic
922898132 1:229116320-229116342 ATGGAGACGAGTAACGTTGTTGG + Intergenic
923893196 1:238238609-238238631 ATGGAGGAGTGTACCTTTGTAGG + Intergenic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1066033365 10:31453296-31453318 ATGGAAAAGATTAACTTTGAGGG - Intronic
1066555868 10:36612446-36612468 AAGGCCCAGAGTACCTTTGGAGG + Intergenic
1067399836 10:45961249-45961271 ATGGAAAACAGTGCCTTTGCTGG - Intergenic
1067868165 10:49930540-49930562 ATGGAAAACAGTGCCTTTGCTGG - Intronic
1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG + Intronic
1069059634 10:63882128-63882150 ACAGACAAAAGTACCTTTATGGG - Intergenic
1071045274 10:81366303-81366325 ATTGACAAGAGTACTTTTGTGGG - Intergenic
1071233414 10:83615742-83615764 AGGAACAAGAGTACCTTGGCAGG - Intergenic
1072041995 10:91615652-91615674 ATGTACAAGAGTTTCTTTGTAGG + Intergenic
1074574871 10:114659171-114659193 CTGGACTAGATTACCTTTGATGG - Intronic
1077796201 11:5495079-5495101 ATAAACAAGAATACCTTTGTGGG + Intronic
1078393633 11:10958163-10958185 ATAGACAAGAATACTTTTGTGGG + Intergenic
1079613051 11:22456986-22457008 AGGGACTAGACTGCCTTTGTAGG + Intergenic
1083984524 11:66204122-66204144 ATGGACAAGGGATCCCTTGTTGG - Intronic
1087024213 11:93633865-93633887 AAGGACTAGATTGCCTTTGTAGG - Intergenic
1087247260 11:95853940-95853962 AGAGACAGGAGTACCTTTCTGGG - Intronic
1087619218 11:100523176-100523198 ATGAACACGAGTATCTTTGCAGG + Intergenic
1088017176 11:105075022-105075044 ATGGCCAAGAGTATTTTTGGAGG + Intronic
1088132536 11:106511292-106511314 ATGGAGATGAGTACCATGGTGGG + Intergenic
1090114661 11:123955833-123955855 ATGGATGAGAATATCTTTGTGGG + Intergenic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1097414213 12:59294686-59294708 ATGGGCATAAGTACCTTTGGAGG + Intergenic
1097849728 12:64399951-64399973 GGGGACTAGACTACCTTTGTAGG + Intergenic
1098659516 12:73074982-73075004 ATGGAAAAAAGTCTCTTTGTGGG + Intergenic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1099231222 12:80027616-80027638 ATGTTCAAAAGTGCCTTTGTGGG - Intergenic
1101156720 12:101934644-101934666 ATGGACAAGAGTTTCTGTTTGGG + Intronic
1101922043 12:108940980-108941002 GTGGACAAGGGTATCTCTGTGGG + Intronic
1102230905 12:111261568-111261590 ATGGACAAGAGTGAGTTTCTGGG - Intronic
1103670335 12:122609422-122609444 AAGGAAAAGAGTACCTTCGTAGG - Exonic
1107868534 13:44726809-44726831 GGGGACAAGACTACCCTTGTAGG + Intergenic
1110399119 13:75069070-75069092 ATGGACCAGAGTCCCCTGGTGGG - Intergenic
1111303902 13:86381948-86381970 AAGGACTAGACTGCCTTTGTAGG + Intergenic
1111590171 13:90336503-90336525 ACAGACAAGAGCACCTTTGTGGG + Intergenic
1112224093 13:97520648-97520670 ATGTACAAGAGTATCTGTTTTGG - Intergenic
1116229046 14:42192688-42192710 ATGGGCAAAAGTATCTTTGTGGG - Intergenic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1117804881 14:59481188-59481210 GTGGACAAGAGTAACTTTAAAGG - Intronic
1118379809 14:65208454-65208476 AGGGACTAGATTGCCTTTGTAGG - Intergenic
1120418881 14:84256725-84256747 ATTGACAAGATAACCTTTGAGGG - Intergenic
1120998250 14:90433180-90433202 AGGGACTAGATTGCCTTTGTAGG + Intergenic
1122440804 14:101730686-101730708 ATGGACAAGGGTACCCAGGTGGG + Intronic
1123501228 15:20882848-20882870 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123558480 15:21456553-21456575 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123594711 15:21893828-21893850 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1125151409 15:36536581-36536603 ATGTACAAGAGTAACACTGTTGG + Intergenic
1125411206 15:39407994-39408016 AAGGACAAGAGAACCTTACTGGG + Intergenic
1127906103 15:63377315-63377337 ATGGAAAAGCGTACCCTTGTGGG + Intronic
1127951734 15:63814423-63814445 ATAGACAACATTAGCTTTGTGGG + Intronic
1128719273 15:69934386-69934408 ATGGGCCAGAATACCTTTATGGG + Intergenic
1130833890 15:87630661-87630683 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1131606198 15:93905346-93905368 TTGGACAAAAGTACCCTTCTTGG + Intergenic
1202966830 15_KI270727v1_random:183703-183725 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1134911584 16:18031640-18031662 ATGGATAAGAATCCATTTGTAGG - Intergenic
1135776180 16:25258624-25258646 ACAGACAAGAGTTCCTTTGGGGG - Intergenic
1135835594 16:25822566-25822588 ATTGCCAAGTGTCCCTTTGTGGG + Intronic
1137880916 16:52047346-52047368 ATGAAAAAGAGCACATTTGTGGG - Intronic
1139097782 16:63726767-63726789 ATGGACAGCAGAAACTTTGTTGG - Intergenic
1139467738 16:67163200-67163222 CTGGACAACAGTACCCTAGTGGG + Exonic
1139994436 16:70966617-70966639 ATGGACAAGAATACCTTATGAGG + Intronic
1141789713 16:86226323-86226345 ATGGACAAGGGTCCCCTTGGGGG - Intergenic
1143865715 17:9921657-9921679 TGGGACAAGAATGCCTTTGTTGG + Intronic
1149922330 17:60671642-60671664 ATGGAAAAGAGTAACTTTAAGGG - Intergenic
1150296000 17:64007871-64007893 ATGGACGAGAGGACCTTCCTGGG + Intronic
1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG + Intronic
1151365354 17:73613243-73613265 ATGGACAAGCTGACCTTTGGAGG + Intronic
1154053201 18:10983255-10983277 ATGGACATGAATATTTTTGTGGG + Intronic
1155753706 18:29462767-29462789 ATGGTCAAGATAATCTTTGTGGG + Intergenic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1159715866 18:71821868-71821890 ATGCACATGAGTCCATTTGTAGG - Intergenic
1159943791 18:74428731-74428753 ATGGACCAGGGTACAGTTGTGGG - Intergenic
1161206654 19:3044863-3044885 GTGGACAAGAGAATATTTGTTGG + Intronic
1164947055 19:32304595-32304617 AAAGATAAGAGTACCTCTGTGGG - Intergenic
1166419883 19:42628413-42628435 AGGGACTAGAATGCCTTTGTAGG + Intronic
1166497980 19:43318567-43318589 GGGGACAAGACTGCCTTTGTGGG - Intergenic
925408436 2:3624753-3624775 ATGAACAAAAGTGTCTTTGTAGG - Intronic
926192755 2:10741081-10741103 AGTGACAAGAGTAACTTTGCTGG + Intronic
926526600 2:13989566-13989588 ACAGACAAGAATACTTTTGTAGG + Intergenic
927375394 2:22407398-22407420 ATGGACAAGACAGCGTTTGTCGG + Intergenic
927408699 2:22800790-22800812 CTGGGCTACAGTACCTTTGTTGG - Intergenic
928825150 2:35411712-35411734 ATGGTCAAGAGCTCTTTTGTAGG - Intergenic
929372445 2:41242224-41242246 ACGAACAAAAGTGCCTTTGTGGG - Intergenic
931605410 2:64047791-64047813 AAGGACAAGAATATTTTTGTTGG - Intergenic
933881014 2:86670056-86670078 GTGGAAAAGAGTACCTTAGGAGG + Intronic
934701065 2:96440537-96440559 AGGGACTAGACTGCCTTTGTAGG + Intergenic
935464412 2:103379430-103379452 ATGAACAACAGTACCTTTCTGGG - Intergenic
936897511 2:117445270-117445292 ATGGATATGAGTAACTTTTTGGG + Intergenic
937171451 2:119874642-119874664 AGGTACAAGATTACCTTTGAGGG + Intronic
937651018 2:124319156-124319178 CTGGGCAAGAGAACCTTTATAGG - Intronic
938394955 2:130938182-130938204 ATGCCCAAGAGTACAATTGTTGG + Intronic
939703096 2:145419165-145419187 ATGGACCAGAATACATTTGTAGG + Intergenic
939745549 2:145961740-145961762 ATGGACAAGAGTACATTTGTGGG - Intergenic
939983552 2:148808982-148809004 ATGGGCAAGAGTATCTCTGCTGG - Intergenic
940082809 2:149823691-149823713 ATGAACAAGAGTGCCTTTTTTGG - Intergenic
1169721055 20:8676826-8676848 AGGGAAAAAAGTAACTTTGTAGG + Intronic
1169824726 20:9754651-9754673 ATGAACCAGACTGCCTTTGTAGG - Intronic
1174189017 20:48726966-48726988 TTGCACAAGAGTACATTTTTGGG - Intronic
1175304965 20:57969534-57969556 ATGGGCAAGGGTAGCTTTGGAGG + Intergenic
1177420605 21:20852041-20852063 GGGGACAAGACTGCCTTTGTAGG - Intergenic
1179356336 21:40664122-40664144 ATGGATAAGAGGACATTTGCAGG - Intronic
1183392834 22:37555465-37555487 ATGAACAAGAATTCCTATGTTGG + Intergenic
951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG + Intergenic
952086774 3:29832401-29832423 ATGGATGAGAGTACCTTTGTGGG + Intronic
953220030 3:40961074-40961096 ATGGACAAATGTGCCTTTGTAGG - Intergenic
953448863 3:42990025-42990047 ATGGTCAAGAGTCCCTGTGCAGG + Intronic
954493700 3:50931985-50932007 ATGGACAAGAGTACCTTTGTGGG - Intronic
954618486 3:51982830-51982852 ATGGACAAGAGCACGTGTGACGG - Intronic
955545924 3:60030152-60030174 ATGTACAAGAGAACATTTGGTGG - Intronic
958528318 3:95291360-95291382 ATGGACAGGAGTAACTTGTTGGG + Intergenic
963890652 3:150632624-150632646 TTGGACCAGAGTACTTTTCTGGG - Intergenic
964366244 3:155953630-155953652 AGGGACTAGATTGCCTTTGTAGG - Intergenic
964642623 3:158926347-158926369 ATGAGCAACAGTGCCTTTGTGGG + Intergenic
965142969 3:164863328-164863350 AGGGACTCGACTACCTTTGTAGG + Intergenic
965482340 3:169234219-169234241 ATGGCACAGAGTACCTCTGTGGG - Intronic
966536076 3:181035661-181035683 ATAGATGAGAGTACCTTTGTGGG + Intergenic
966567259 3:181396902-181396924 ATGGAAAAAAGTGCCATTGTGGG - Intergenic
970497654 4:16643159-16643181 AGGGATAAAAGTATCTTTGTGGG + Intronic
970784966 4:19784447-19784469 ATGGAGATGAGTAACTTTTTGGG - Intergenic
971735476 4:30443893-30443915 ATGAACAAGAGTAGTTTTGTGGG - Intergenic
972743778 4:41913484-41913506 GGGGACAAGAATGCCTTTGTAGG + Intergenic
973711341 4:53632934-53632956 ATGTACAAGAATCCTTTTGTAGG + Intronic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
974569557 4:63627529-63627551 ATGGAGAAGAGTAACTTGTTGGG + Intergenic
976328662 4:83802735-83802757 ATAGACAACAGTACCTTGATGGG + Intergenic
977045503 4:92064370-92064392 ATGGAAAAAAGTACCTTTCTGGG + Intergenic
979115163 4:116814537-116814559 ATGGAGAACAGTGCCTGTGTGGG - Intergenic
979672496 4:123374749-123374771 ATGGCCAAGAATACAATTGTTGG + Intergenic
979801461 4:124914177-124914199 ATAGACAAAATTGCCTTTGTGGG - Intergenic
980707695 4:136520757-136520779 ATGGAGATGAGTACCTTCTTGGG - Intergenic
982778422 4:159465775-159465797 ATAGACAAAAGTTTCTTTGTGGG - Intergenic
982904420 4:161049691-161049713 GGGGACTAGATTACCTTTGTAGG + Intergenic
983460787 4:168023536-168023558 ATGGACATGAGCACCTTGTTGGG - Intergenic
988315865 5:29627341-29627363 ATTGACAAGAGTACCTCCATTGG - Intergenic
988698703 5:33650576-33650598 ATGGACAAGAGTACTGTGTTAGG - Intronic
989310324 5:40009213-40009235 ATGGATAAAAGTACCATTGTGGG - Intergenic
990208785 5:53458859-53458881 AGGGACTAGATTGCCTTTGTAGG + Intergenic
991310019 5:65228532-65228554 ATAGACAAGTGTACCTTTATGGG + Intronic
992824738 5:80537514-80537536 ATGGATAAAAGTACCTTTGTGGG - Intronic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
993459444 5:88165199-88165221 ATGGACAAGAGTATTGTTGTTGG + Intergenic
994764452 5:103899555-103899577 ATGGAGATGAGTAACTTTTTGGG + Intergenic
994793158 5:104258041-104258063 ATGGACAAGAATACCTTTATGGG - Intergenic
995074816 5:107970211-107970233 ATGAACAAGAGGACCTGTGATGG + Intronic
995882969 5:116863255-116863277 ATGGACAACTGGGCCTTTGTGGG - Intergenic
996816016 5:127573290-127573312 ACAGTTAAGAGTACCTTTGTTGG + Intergenic
997421365 5:133769520-133769542 ATGGACCAGAGTAGCTTTATGGG - Intergenic
997554553 5:134784007-134784029 ATGGACAAAAGTTTCTTTTTGGG - Intronic
998602760 5:143601863-143601885 AAAGAAAAGAGTACATTTGTTGG + Intergenic
1000138123 5:158373700-158373722 ATGGAAAAGAGTACATTTATAGG + Intergenic
1000249082 5:159476426-159476448 ATGGATCATACTACCTTTGTGGG - Intergenic
1000528861 5:162393287-162393309 ATAGACAAGAGTACATTCGTGGG + Intergenic
1001427661 5:171634345-171634367 AAGAAAAAGAGTATCTTTGTTGG - Intergenic
1002311534 5:178318156-178318178 ATGAACAAGAGGGCCTTTTTTGG - Intronic
1002676135 5:180914760-180914782 ATGAACAAAAGTATTTTTGTAGG + Intronic
1012158893 6:95857448-95857470 ATGGATGAGAGTACCTCTGTGGG - Intergenic
1013273530 6:108562098-108562120 ACGGACAGGAGTACATTTGCTGG + Intronic
1013857394 6:114590811-114590833 ATGTACAAGAGGATTTTTGTGGG - Intergenic
1014894013 6:126877789-126877811 ATGGACAAGAGTATCCTTGTAGG - Intergenic
1016793232 6:148089164-148089186 ATGAAAAAGATTAACTTTGTGGG + Intergenic
1018151176 6:160940728-160940750 ATGGACAAAAGTGCCTCTGTGGG - Intergenic
1018573657 6:165236085-165236107 ATGGAAATGAGTAACTTTTTGGG + Intergenic
1018573889 6:165237693-165237715 ATGGAAATGAGTAACTTTTTGGG + Intergenic
1021732507 7:23609501-23609523 GGGGACTAGAGTACCTTTGCAGG - Intronic
1024409283 7:49020745-49020767 ATTGACAAGAATACCTTTTGAGG + Intergenic
1024430141 7:49278919-49278941 ATGGAGAAGAGTGCCTTTCAAGG + Intergenic
1024661796 7:51502443-51502465 ATGGACAAGAATATTTTTATTGG + Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1025252932 7:57364016-57364038 ATGGACAAAAATTCCTTTGCTGG - Intergenic
1026367016 7:69658749-69658771 ATAGACATCAGTATCTTTGTAGG + Intronic
1026496378 7:70907217-70907239 GGGGACTAGATTACCTTTGTAGG + Intergenic
1027546261 7:79531041-79531063 AGGGACAAGAGCACCTTCTTTGG - Intergenic
1027870212 7:83696956-83696978 AGGGTCAAGAGTACAGTTGTTGG - Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031538427 7:122963001-122963023 ATGTATAAGAATACCTTTCTAGG + Intergenic
1033627557 7:143125405-143125427 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1035014341 7:155751695-155751717 ATTGACAAGATTAACTTTGATGG + Intronic
1036148057 8:6273363-6273385 ATACCCAATAGTACCTTTGTAGG + Intergenic
1036162196 8:6399578-6399600 AGGGACTAGACTGCCTTTGTAGG + Intergenic
1037406668 8:18549569-18549591 ACAGACAAGAGTACATTTGTGGG - Intronic
1037511198 8:19585229-19585251 TTGGAGGAGAGAACCTTTGTGGG - Intronic
1043706729 8:83359253-83359275 GGGGACTAGACTACCTTTGTAGG - Intergenic
1043885008 8:85588855-85588877 AGGGACAAAACTAGCTTTGTGGG - Intergenic
1044175055 8:89109654-89109676 ATGGGCAAGTGTACTTTTGTGGG + Intergenic
1044509658 8:93059819-93059841 ATGGACAAGAATACTTTTGTAGG + Intergenic
1045690869 8:104758585-104758607 AGGGACTAGATTGCCTTTGTAGG - Intronic
1046696306 8:117343759-117343781 ATGGATGAGAGTACCTTTGTGGG + Intergenic
1051631011 9:19140974-19140996 AGGGACTAGACTGCCTTTGTAGG + Intronic
1053855171 9:42331181-42331203 AGGGACTAGACTGCCTTTGTAGG - Intergenic
1054569114 9:66790770-66790792 AGGGACTAGACTGCCTTTGTAGG + Intergenic
1057863905 9:98664108-98664130 ATAGACAAGAGAACCAGTGTGGG - Intronic
1059069580 9:111121075-111121097 ATGGACAAGAGGAACTTTCTGGG - Intergenic
1059890540 9:118797104-118797126 AAGGAAAAGAGAAGCTTTGTGGG + Intergenic
1060311865 9:122469767-122469789 ATGGAGATGAGTAACTTTTTGGG + Intergenic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1186580710 X:10814908-10814930 ATGGTAAAGATTACCATTGTTGG + Intronic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1189043282 X:37565464-37565486 ATGGTGGATAGTACCTTTGTTGG + Intronic
1189631636 X:42960492-42960514 GGGGACTAGACTACCTTTGTAGG - Intergenic
1189738669 X:44096808-44096830 AAGGACAAGAGGAGCTTTCTGGG - Intergenic
1190409028 X:50116129-50116151 GGGGACCAGACTACCTTTGTAGG + Intergenic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1192195343 X:69024167-69024189 ATGGATAAGATGACCTTTGGAGG - Intergenic
1192332665 X:70190360-70190382 ATGGACCAAAGTACCTTTGTGGG + Intronic
1193672559 X:84407075-84407097 TAGGTCAAGAGTACCTGTGTAGG + Intronic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1194542499 X:95191363-95191385 ATAGACAAGAGTGCTTGTGTAGG + Intergenic
1198040923 X:132851658-132851680 ATGGACAATATCACCCTTGTTGG - Intronic
1198629413 X:138618133-138618155 AAGTATGAGAGTACCTTTGTGGG + Intergenic
1199261669 X:145781625-145781647 ATGGATGAGAGTACCTTTGCAGG + Intergenic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG + Intronic
1200938967 Y:8762880-8762902 AAGAACAAGAGTTTCTTTGTTGG + Intergenic
1201327124 Y:12773903-12773925 TTGGACTAGACTACCTTTGGAGG + Exonic
1201749024 Y:17412575-17412597 ATAGACTAGATTGCCTTTGTAGG + Intergenic