ID: 954497221

View in Genome Browser
Species Human (GRCh38)
Location 3:50976294-50976316
Sequence CATTGAAAGCAGTGTGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10476
Summary {0: 1, 1: 62, 2: 6847, 3: 2523, 4: 1043}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954497221_954497226 19 Left 954497221 3:50976294-50976316 CCCACTACACACTGCTTTCAATG 0: 1
1: 62
2: 6847
3: 2523
4: 1043
Right 954497226 3:50976336-50976358 TGTTGTGTCTTTGTTCTCGTTGG 0: 2746
1: 4268
2: 2263
3: 1688
4: 1362
954497221_954497223 -6 Left 954497221 3:50976294-50976316 CCCACTACACACTGCTTTCAATG 0: 1
1: 62
2: 6847
3: 2523
4: 1043
Right 954497223 3:50976311-50976333 TCAATGTGTCCCAGAGATTCTGG 0: 31
1: 5407
2: 3554
3: 2709
4: 1770
954497221_954497227 28 Left 954497221 3:50976294-50976316 CCCACTACACACTGCTTTCAATG 0: 1
1: 62
2: 6847
3: 2523
4: 1043
Right 954497227 3:50976345-50976367 TTTGTTCTCGTTGGTTTCAAAGG 0: 17
1: 55
2: 49
3: 38
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954497221 Original CRISPR CATTGAAAGCAGTGTGTAGT GGG (reversed) Intronic
Too many off-targets to display for this crispr