ID: 954497221 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:50976294-50976316 |
| Sequence | CATTGAAAGCAGTGTGTAGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 10476 | |||
| Summary | {0: 1, 1: 62, 2: 6847, 3: 2523, 4: 1043} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 954497221_954497226 | 19 | Left | 954497221 | 3:50976294-50976316 | CCCACTACACACTGCTTTCAATG | 0: 1 1: 62 2: 6847 3: 2523 4: 1043 |
||
| Right | 954497226 | 3:50976336-50976358 | TGTTGTGTCTTTGTTCTCGTTGG | 0: 2746 1: 4268 2: 2263 3: 1688 4: 1362 |
||||
| 954497221_954497223 | -6 | Left | 954497221 | 3:50976294-50976316 | CCCACTACACACTGCTTTCAATG | 0: 1 1: 62 2: 6847 3: 2523 4: 1043 |
||
| Right | 954497223 | 3:50976311-50976333 | TCAATGTGTCCCAGAGATTCTGG | 0: 31 1: 5407 2: 3554 3: 2709 4: 1770 |
||||
| 954497221_954497227 | 28 | Left | 954497221 | 3:50976294-50976316 | CCCACTACACACTGCTTTCAATG | 0: 1 1: 62 2: 6847 3: 2523 4: 1043 |
||
| Right | 954497227 | 3:50976345-50976367 | TTTGTTCTCGTTGGTTTCAAAGG | 0: 17 1: 55 2: 49 3: 38 4: 234 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 954497221 | Original CRISPR | CATTGAAAGCAGTGTGTAGT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||