ID: 954502200

View in Genome Browser
Species Human (GRCh38)
Location 3:51029335-51029357
Sequence TTGCTCACCCTCTGCGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954502196_954502200 7 Left 954502196 3:51029305-51029327 CCAGCAGGTAGGCTTTTACTTAG 0: 1
1: 1
2: 1
3: 19
4: 123
Right 954502200 3:51029335-51029357 TTGCTCACCCTCTGCGGGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954502200 Original CRISPR TTGCTCACCCTCTGCGGGGC TGG Intronic