ID: 954502200

View in Genome Browser
Species Human (GRCh38)
Location 3:51029335-51029357
Sequence TTGCTCACCCTCTGCGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954502196_954502200 7 Left 954502196 3:51029305-51029327 CCAGCAGGTAGGCTTTTACTTAG 0: 1
1: 1
2: 1
3: 19
4: 123
Right 954502200 3:51029335-51029357 TTGCTCACCCTCTGCGGGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954502200 Original CRISPR TTGCTCACCCTCTGCGGGGC TGG Intronic
901033230 1:6320654-6320676 TTTCACACCCGCTGCAGGGCAGG + Intronic
901380553 1:8870883-8870905 TTCTTCATCCTCTGCTGGGCAGG - Intronic
902711456 1:18242868-18242890 TGGCTCACACTCTGCTGGGGGGG + Intronic
906615676 1:47231444-47231466 TTGCTGCCCTTCTGTGGGGCTGG - Intronic
912254130 1:108041851-108041873 TTGCTCACCATCCTCGAGGCAGG - Intergenic
915118224 1:153613251-153613273 CTGCTCAGCCCCTGCGGGGCTGG - Intergenic
916485529 1:165255041-165255063 TTGATCACTCTCTGTGGGGAAGG + Intronic
916819768 1:168387000-168387022 TTGCGCTCACTCTGTGGGGCAGG - Intergenic
917790247 1:178494792-178494814 CTGCTCACCAGCTGCAGGGCTGG + Intergenic
919822409 1:201481581-201481603 TGGCTCAGCCTCTGAGTGGCTGG - Intergenic
921904976 1:220486675-220486697 TTTCTCAACCTCAGCCGGGCTGG + Intergenic
1067159068 10:43807543-43807565 TTGCCCTCCCTTTGCAGGGCAGG - Intergenic
1070958944 10:80485632-80485654 GTCCTGACCCTCTGTGGGGCTGG - Intronic
1071276028 10:84055975-84055997 TTGCTAACCCTGTGCAGGTCAGG - Intergenic
1072763981 10:98081258-98081280 CTGCCCACCCTCTGTGGTGCGGG - Intergenic
1076160429 10:128240136-128240158 ATGCTCCCTCTCTGAGGGGCAGG + Intergenic
1077473589 11:2776197-2776219 CTGCCCTCCCTCTGCAGGGCTGG - Intronic
1078107067 11:8365214-8365236 TTGCTCCCCAGCTGTGGGGCTGG + Intergenic
1078651128 11:13193903-13193925 TTGCTCACTCTTTGAGGAGCTGG + Intergenic
1079321586 11:19455989-19456011 TCCCTCCCCCTCTGCAGGGCTGG - Intronic
1081976615 11:47239426-47239448 CTGCTCTCCCTCAGCTGGGCTGG - Exonic
1083173962 11:60938020-60938042 CTGCTCCCCCTCTGCAGGCCTGG - Exonic
1084118543 11:67055949-67055971 AGCCTCACCCTCTGCGGGGGCGG + Intergenic
1084191835 11:67502892-67502914 TTGCAGACCCCATGCGGGGCTGG - Intronic
1084637798 11:70404380-70404402 TTGGCCACCCTCTGGGGAGCTGG + Intronic
1084895336 11:72263214-72263236 ATGCTCACCATCAGTGGGGCAGG - Intergenic
1088173179 11:107019146-107019168 TTGCTGAGCCTCAGCCGGGCGGG + Intergenic
1089680579 11:120116908-120116930 TTTCTCTCCCACAGCGGGGCAGG - Intronic
1090631584 11:128653838-128653860 CTGCTCTCCCTCTGCAGTGCAGG + Intergenic
1097698894 12:62800848-62800870 TTGCTGCCCCTCTGCCTGGCAGG - Intronic
1104922260 12:132296726-132296748 TTTCTCACACTCTGGGAGGCTGG + Intronic
1109220321 13:59635058-59635080 TTGCTCACTCTCTGAGGGGTGGG - Intergenic
1113820278 13:113208730-113208752 CTGCGCACCCGCGGCGGGGCCGG - Intronic
1114683953 14:24510135-24510157 TTCCTCACCCTCAGCCAGGCAGG - Intergenic
1117424049 14:55577485-55577507 TTGTTCTCCATCTGCAGGGCAGG + Intronic
1118733398 14:68685018-68685040 TGGCTCACCATCTGAGGAGCTGG - Intronic
1118907605 14:70033889-70033911 ATGCTCAGCCTCTGTGGGGCAGG + Intergenic
1119134097 14:72201054-72201076 TTGCTCACCCTCTGAGGATTAGG + Intronic
1119319889 14:73724246-73724268 TTGCTCAGCCACCGCTGGGCTGG + Intronic
1122599986 14:102916475-102916497 TTCCTCAGCCTCTGCGGCGCCGG + Intergenic
1125003623 15:34795498-34795520 TGACTCACCGTCGGCGGGGCGGG + Exonic
1129117935 15:73375632-73375654 GTGCTCACCCACTCCAGGGCAGG - Intergenic
1132864336 16:2086123-2086145 ACCCCCACCCTCTGCGGGGCAGG + Intronic
1133240222 16:4409744-4409766 TTGCTCACCCTCTGCTCCCCTGG + Intronic
1135149817 16:19995629-19995651 GTGCTCACCCCCTGGGTGGCGGG - Intergenic
1135939736 16:26810604-26810626 TACCACACCCTCTGAGGGGCTGG - Intergenic
1139869801 16:70097804-70097826 TTGCTCAACGTCAGCGGAGCCGG + Intergenic
1140143532 16:72283924-72283946 TTGCTCAGCCTCTGAGTGACAGG - Intergenic
1140385640 16:74534749-74534771 TTGCTCAACGTCAGCGGAGCCGG - Intronic
1140427884 16:74875808-74875830 TTGCTCAGCCTCTTGTGGGCAGG - Intronic
1140862030 16:79026301-79026323 TTGCACATCCTCTGCCGGGGAGG + Intronic
1143266856 17:5644447-5644469 TTCATCAGCCTCTGCAGGGCCGG + Intergenic
1144425030 17:15133591-15133613 TTGCTCATCCACTGTGAGGCGGG - Intergenic
1148942246 17:51225093-51225115 TTCCTCACTCTCTTCGGAGCTGG + Exonic
1149596765 17:57868774-57868796 TTGCTAAGCCTCTGTGGGGGTGG - Intronic
1151956095 17:77380937-77380959 GTGCTGCCCCTCTGAGGGGCTGG + Intronic
1152207184 17:78980548-78980570 TGTCTCCCCCTCAGCGGGGCGGG + Intergenic
1152212452 17:79009656-79009678 TCACTCACCCGCTGCGGGGCTGG + Exonic
1152475063 17:80512543-80512565 TTTCTCACCATTTGAGGGGCCGG + Intergenic
1152794923 17:82302068-82302090 TCCCACACCCTCAGCGGGGCAGG - Intergenic
1153940235 18:9970450-9970472 TTTCTCACCCTCTGAGGAGTTGG + Intergenic
1155060469 18:22223831-22223853 TTGCTCACCGCCAGCAGGGCCGG - Intergenic
1157550117 18:48575617-48575639 TCCCTCACCCTCTGAGGGGATGG + Intronic
1157555836 18:48612428-48612450 TTGCTCCCACTCTGTGGGGATGG + Intronic
1158619776 18:59022888-59022910 TTGCTCTCCCTCTGCAGTACTGG - Intergenic
1160414678 18:78700179-78700201 TTATTCACTCTCTGGGGGGCTGG - Intergenic
1163329779 19:16628708-16628730 TCCCACACCCTCTGAGGGGCGGG - Intronic
1163534686 19:17870342-17870364 TTGCTCCCTCTCTGCTGTGCAGG - Intergenic
1164493348 19:28735293-28735315 GTGCTCACCCTCAGCAGGGGTGG + Intergenic
1164720960 19:30431247-30431269 TGGCCCAGCCTCTGCCGGGCTGG - Intronic
1164853454 19:31502924-31502946 TAGATCACCCTCTGCGGGTCCGG + Intergenic
1166364532 19:42271944-42271966 TTCCTCAGCCTCTTCGGGCCCGG - Intronic
1168507755 19:56950692-56950714 ATGCTCACACTCTGAGGTGCTGG - Intergenic
925186415 2:1849664-1849686 TTCCTCAGCCTCTGCAGTGCTGG - Intronic
925265606 2:2564395-2564417 TCCCTCCCCCTCTTCGGGGCTGG + Intergenic
926169640 2:10544407-10544429 TTGCTCACGTTCTGCGGGTCAGG - Intergenic
926735826 2:16072676-16072698 TTGCGAAGCCTCTGCGGGGAAGG - Intergenic
927154661 2:20214517-20214539 TTGCCCTCCCTCTGATGGGCTGG + Intronic
927906472 2:26862162-26862184 TTCCTCACACTCTGTGGGTCAGG - Intronic
928595751 2:32857430-32857452 GTGCTCACCCTCTGGGGGGGTGG - Intergenic
932418761 2:71589092-71589114 TTGCTCACCCTCAGCAGAGTGGG + Intronic
936502078 2:113074481-113074503 CTGCTGACCCTCTGCTGGGGAGG - Intronic
938737549 2:134200165-134200187 TTTCTCAGCCTTGGCGGGGCAGG - Intronic
945169137 2:206977901-206977923 TAACTCAACCTCTGTGGGGCGGG + Intergenic
948219596 2:236259257-236259279 TTGCTCACCTTCAGCTGGGTGGG - Intronic
948662193 2:239514498-239514520 TTGCTCACCGTCTCCTGGCCAGG + Intergenic
948712485 2:239833669-239833691 TTGCTGCCCCTCTGCCGGCCAGG - Intergenic
948916832 2:241038794-241038816 GTGCTCTCCCTGTGCGGTGCTGG + Intronic
1168759897 20:343015-343037 TTGCTCACCCTTTGGGTGGCTGG - Intergenic
1169144684 20:3244636-3244658 TTGTTGACCCTCTGCAGGGCAGG - Intergenic
1176235505 20:64051775-64051797 CTCCTCTCCCTCTGCGTGGCAGG + Intronic
1179411981 21:41168819-41168841 GAGCTCCCCCTCCGCGGGGCTGG + Intronic
1179903097 21:44405301-44405323 GTGCTCATCCCCTGCAGGGCTGG - Intronic
1180184074 21:46130972-46130994 TTGCTCACTGCCTGCGGGGCTGG + Intronic
1180997424 22:19972401-19972423 TTTCTCGCCCTCTGCAAGGCAGG + Exonic
1181089756 22:20464594-20464616 TTGCTCAGCCTCTTTGGGGTAGG - Intronic
1181853994 22:25769378-25769400 TTGCCCTCCTCCTGCGGGGCTGG - Exonic
1182722217 22:32412264-32412286 TTGCTCATCTGCTGCGGCGCTGG - Intergenic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183064614 22:35354394-35354416 TCGCCCACCTCCTGCGGGGCAGG - Intergenic
1183464548 22:37973161-37973183 CTGCTCACCCTCCTCGGGGAGGG - Exonic
1183833474 22:40432757-40432779 TTGCTCAGCCTCCCCTGGGCTGG - Intronic
1184298377 22:43540442-43540464 GTGCTCACCTCCTGCGAGGCCGG - Intronic
1184452526 22:44591516-44591538 CTGCTCACCCTCAGCAGCGCTGG + Intergenic
950119225 3:10470771-10470793 TTGCTGACTCTCTTGGGGGCTGG - Intronic
950420876 3:12898676-12898698 TTTCTCACCCTCTTCTGTGCTGG - Exonic
951588758 3:24241283-24241305 TTGCTCACCGTCTCCAGGCCTGG + Intronic
953369145 3:42372608-42372630 TTCCTCACCCTTTGCTGGGGGGG - Intergenic
954502200 3:51029335-51029357 TTGCTCACCCTCTGCGGGGCTGG + Intronic
956640937 3:71414640-71414662 TTACTCCCCCTCTGCGGGCTGGG - Intronic
956792451 3:72690633-72690655 TCCCTCACCCTCTGCGAGACAGG - Intergenic
960992674 3:123322084-123322106 GAGCTCTCCCTCTGGGGGGCAGG + Intronic
961500034 3:127325863-127325885 TAGCTCACTCTCTGGTGGGCAGG + Intergenic
968512749 4:1002720-1002742 CTGCTCCTCATCTGCGGGGCGGG - Exonic
969592046 4:8127607-8127629 CGGCTCTCCCTCTGCGTGGCTGG + Intronic
969647586 4:8441309-8441331 TTCCTCACCAGCTCCGGGGCGGG + Exonic
973627905 4:52791107-52791129 TTGCTCACACCATGGGGGGCAGG + Intergenic
978709163 4:111756617-111756639 CTGATCACCCACTGTGGGGCAGG + Intergenic
985909982 5:2871758-2871780 TGGCTCACCCACTGCGTGACTGG + Intergenic
986258414 5:6121469-6121491 TTGCTCACCCTCTCTGAGTCTGG - Intergenic
986404384 5:7411288-7411310 TGGCTCACCCTCTGAGGTGGGGG + Intronic
987066822 5:14297874-14297896 GTGCTCACCCTCCGCAGGGATGG + Intronic
995841434 5:116446803-116446825 GAGTCCACCCTCTGCGGGGCGGG + Exonic
1001928648 5:175657726-175657748 GGGCTCACAATCTGCGGGGCGGG + Intergenic
1005658334 6:27966927-27966949 TGGCTCACCCTCGGCGGGCATGG - Intergenic
1006134880 6:31889163-31889185 GTGCACACACTCTGGGGGGCCGG + Intronic
1006647235 6:35523034-35523056 ATCCTCACCTTCCGCGGGGCCGG - Intergenic
1015887024 6:137927980-137928002 TTGCTGACCCTGTGGGTGGCAGG - Intergenic
1019357834 7:590204-590226 TTTCACACCCTTTGCTGGGCCGG - Intronic
1019588897 7:1819293-1819315 TTCCTCTCCCTCTGCCTGGCCGG + Intronic
1019842510 7:3462335-3462357 ATACTCAACCTCGGCGGGGCAGG - Intronic
1020131406 7:5560758-5560780 ATGCTCAGTCTCTGCAGGGCTGG - Intronic
1022127645 7:27373592-27373614 TTGCTCATCCTCAGCAGGTCAGG + Intergenic
1024059457 7:45687003-45687025 GGGCTCAGCCTCTGCAGGGCTGG + Intronic
1026890136 7:73977060-73977082 TTGCACACGCACTGCGGGGGTGG - Intergenic
1033226774 7:139568887-139568909 TTGCTGAGCGTCTGTGGGGCTGG + Exonic
1035454827 7:159001232-159001254 TGGCTCACCCGCCGCGGAGCTGG + Intergenic
1036554883 8:9850280-9850302 TTACTCACCCTCTGTGGGGAGGG + Intergenic
1037177838 8:15967647-15967669 TTGTTCTCCATCTTCGGGGCTGG + Intergenic
1037656254 8:20886813-20886835 TGGCTCACTCTCTTCAGGGCTGG - Intergenic
1037717271 8:21411080-21411102 CTGCCCAGCCTCTGCGGGTCTGG - Intergenic
1037922466 8:22817049-22817071 TGGCTCACCCTCTTCAGGGAGGG - Intronic
1038616623 8:29101637-29101659 TTTGTCACGCTCTGCAGGGCTGG - Intronic
1045111398 8:98941425-98941447 TTCCACTGCCTCTGCGGGGCGGG - Intronic
1048723763 8:137358460-137358482 CTGCTCACCTTCTGCTGTGCGGG - Intergenic
1049387903 8:142353601-142353623 CTGCTCCCTCTCTGCAGGGCTGG + Intronic
1053685204 9:40514588-40514610 TTGCTAGCCCTCTGCAGGGTTGG - Intergenic
1053935165 9:43142878-43142900 TTGCTAGCCCTCTGCAGGGTTGG - Intergenic
1054278525 9:63110375-63110397 TTGCTAGCCCTCTGCAGGGTTGG + Intergenic
1054298296 9:63350045-63350067 TTGCTAGCCCTCTGCAGGGTTGG - Intergenic
1054396313 9:64654562-64654584 TTGCTAGCCCTCTGCAGGGTTGG - Intergenic
1054430956 9:65159757-65159779 TTGCTAGCCCTCTGCAGGGTTGG - Intergenic
1054499425 9:65861764-65861786 TTGCTAGCCCTCTGCAGGGTTGG + Intergenic
1054812332 9:69444841-69444863 AAGCGCACCCTCTCCGGGGCTGG + Intronic
1057015566 9:91647785-91647807 TTGTTCACCTACTGCAGGGCAGG - Intronic
1057193443 9:93100053-93100075 ACGCTCGCCCTGTGCGGGGCTGG - Intronic
1057438345 9:95062975-95062997 TTGCCACCCCTCTGCAGGGCGGG + Intronic
1057716957 9:97502603-97502625 CTGTTCACCCTCTCCGGGCCTGG + Intronic
1058032679 9:100216793-100216815 TTGCTCACCTTCCTCTGGGCAGG - Intronic
1058061163 9:100497553-100497575 TAGCTCACCCTCCGAGGAGCTGG - Intronic
1059354825 9:113690499-113690521 TTGCTGAGCCACTGCGGGGCAGG + Intergenic
1060283564 9:122229122-122229144 TTGCTCTCCCTTGGCGGGGAGGG - Intronic
1062017392 9:134297669-134297691 TTGCTGCCCCTCTGAGGGGCTGG - Intergenic
1186565478 X:10657461-10657483 TTGCTCACCATCTAAGTGGCTGG - Intronic
1189246723 X:39569008-39569030 CTGCTCTGCCTCTGTGGGGCAGG - Intergenic
1190248299 X:48705146-48705168 TTGCTCACCCTCATGTGGGCCGG - Intronic
1193551609 X:82899882-82899904 GTGCTCTACCTCTGAGGGGCTGG - Intergenic
1195460255 X:105115890-105115912 TAGCTGCCTCTCTGCGGGGCAGG - Intronic
1198115647 X:133542438-133542460 ATGCTCACCCTCTGAGGGTGTGG + Intronic
1200816563 Y:7539419-7539441 TTGCTCACCTCCTGCTGTGCAGG + Intergenic