ID: 954502554

View in Genome Browser
Species Human (GRCh38)
Location 3:51032486-51032508
Sequence CACAATAAGCATAAGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 337}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954502554 Original CRISPR CACAATAAGCATAAGAAGGC TGG (reversed) Intronic
900723080 1:4192168-4192190 AACAATAATCAAAAGAAAGCTGG - Intergenic
901197404 1:7447780-7447802 CACACTCAGCACAGGAAGGCAGG - Intronic
901285057 1:8071572-8071594 CAAAATAAACCTAAGTAGGCAGG - Intergenic
902543326 1:17169830-17169852 CATAATAACCAAAAGCAGGCCGG - Intergenic
902655776 1:17867039-17867061 CACAGGAGGCAGAAGAAGGCTGG - Intergenic
903195322 1:21682478-21682500 CATAGGAAGCATAAGAAAGCTGG - Intronic
903799183 1:25953871-25953893 CACATTAAGAAGTAGAAGGCAGG + Intergenic
904414607 1:30350692-30350714 TATAATAAGCATAAGAAAGCTGG - Intergenic
904945446 1:34195819-34195841 CACAATAAGCATTACCAGGAAGG + Intronic
906304058 1:44705193-44705215 CAAAATAACCATAAGAGGCCAGG + Intronic
906327064 1:44853312-44853334 CACAACAAGCAGAACTAGGCCGG + Intronic
906862670 1:49378613-49378635 CACATTAAGAATAAGAAGGAAGG + Intronic
907229311 1:52980816-52980838 AAGAATAAGCATAAGAAAGATGG - Intronic
907395750 1:54188853-54188875 CACCAAAAGCATGAGAGGGCTGG + Intronic
907656690 1:56350267-56350289 AAACATAAGCATAAGAAAGCTGG - Intergenic
908198504 1:61769889-61769911 GACAATAAGCATAATAAATCAGG - Intronic
908565300 1:65348584-65348606 TACAGTAAGCAAAAGAAAGCAGG - Intronic
909242955 1:73238324-73238346 AAAAATTAGCATAAGAATGCTGG + Intergenic
910276902 1:85459273-85459295 CATTATAAGACTAAGAAGGCAGG - Intronic
910462737 1:87466268-87466290 CACAAAAAACATAATAAAGCTGG + Intergenic
910900639 1:92116639-92116661 AACACTAATCATAAGAAAGCTGG - Intronic
913656313 1:120963586-120963608 CACAATCAGAATTAGAAGGTGGG - Intergenic
914520865 1:148414815-148414837 CACAATCAGAATTAGAAGGTGGG - Intergenic
915314840 1:155022585-155022607 CAAAATAATAATAATAAGGCAGG + Intronic
915971919 1:160361080-160361102 CACAATAGGCAGAGGCAGGCTGG - Intergenic
916158566 1:161884775-161884797 CAAAATCAGAGTAAGAAGGCAGG + Intronic
916452258 1:164932147-164932169 CACTAGAAGCAAAAAAAGGCTGG - Intergenic
916493690 1:165326137-165326159 TCCAATAGGCATGAGAAGGCTGG + Intronic
918132096 1:181638516-181638538 CACAATAAGCATGTGAAGCTGGG - Intronic
918280245 1:182997404-182997426 CCCATTAAACATTAGAAGGCTGG + Intergenic
918485400 1:185024104-185024126 CACAATAGGCAGAAAAAGGGTGG - Intergenic
918901066 1:190418343-190418365 CATAAAAAGAATAAGAAGGCTGG - Intronic
919173249 1:193985586-193985608 AACAGTAAGCATAAGAAGACTGG - Intergenic
921067801 1:211634902-211634924 AATAATAACTATAAGAAGGCTGG + Intergenic
921134395 1:212247313-212247335 CACAATACACAGAAGAATGCTGG - Intergenic
921388297 1:214593273-214593295 AACAATAAACAAAAGAAAGCTGG + Intergenic
921390811 1:214611660-214611682 TACAATAAGAATTAGAAGGCTGG - Intronic
921801596 1:219409099-219409121 GACAATAAGAATAAAAAGGAAGG + Intergenic
922059691 1:222076300-222076322 TAGAATAAGAATAAGATGGCTGG - Intergenic
922207574 1:223461771-223461793 CACAATGAACATTAGAAGACCGG + Intergenic
924398738 1:243653856-243653878 AACAGTAAGCATAAGAAGAATGG - Intronic
1062775699 10:145346-145368 CACAATAAACATATGCACGCAGG + Intronic
1064864379 10:19862776-19862798 TACAATAAGTTTAAGAAGGCTGG - Intronic
1065196322 10:23269705-23269727 CAACACAAACATAAGAAGGCTGG + Intronic
1065477099 10:26151483-26151505 CTCACTAATCATAAGAAAGCTGG - Intronic
1065555445 10:26910894-26910916 CCTAATAAGCTTAAAAAGGCCGG - Intergenic
1065657992 10:27972596-27972618 AACAATAATCAAAAGAAAGCAGG + Intronic
1066131303 10:32396924-32396946 TACAAAAAGAAAAAGAAGGCTGG + Intergenic
1066258068 10:33700960-33700982 AACAATAATCAAAAGAAAGCTGG - Intergenic
1067320169 10:45211528-45211550 AACACTAAGCAAAAGAAAGCTGG + Intergenic
1068183423 10:53552538-53552560 AACAATAATCAAAAGAAAGCTGG + Intergenic
1068315657 10:55338338-55338360 TACAATAAGCATAGGAGTGCAGG - Intronic
1069256817 10:66343266-66343288 CACAATAAACATGAGAGTGCAGG - Intronic
1070057265 10:72947534-72947556 CTCAATAAGAAAAAGAAGGCTGG - Intronic
1070381112 10:75881332-75881354 CACAATAGGGATAATGAGGCAGG + Intronic
1071122625 10:82297231-82297253 TACAATAAACATAAAAATGCAGG + Intronic
1071441174 10:85697432-85697454 AACAGTAAGCATAAGAAAGCTGG - Intronic
1071824886 10:89315759-89315781 CACACTAAACATACGAAGCCAGG - Intronic
1071944525 10:90627696-90627718 AACAGTAAGCATAAAAAAGCAGG + Intergenic
1072030503 10:91516965-91516987 CACAATAAGAATTAGAATACAGG - Intergenic
1073411010 10:103341794-103341816 CATACTAATCAAAAGAAGGCTGG - Intronic
1073501623 10:103943588-103943610 TACACAAAGCATAAGAAGACTGG - Intergenic
1075234814 10:120717753-120717775 AACACTAAGCATTAGAAAGCTGG + Intergenic
1076044355 10:127279312-127279334 CTCAATAGCCATAAGAGGGCAGG + Intronic
1076610741 10:131724528-131724550 CATCATAAGCATCAGATGGCGGG - Intergenic
1077808715 11:5615892-5615914 AACAATAATCAAAAGAAAGCTGG - Intronic
1078310741 11:10238440-10238462 AACACTAACCAAAAGAAGGCTGG + Intronic
1079449410 11:20586593-20586615 TAAAATAAGCTTAAGAGGGCCGG + Intergenic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1079482266 11:20893883-20893905 CAAACTAAACATGAGAAGGCTGG + Intronic
1079491666 11:20995683-20995705 CACAATAAGGCAAAGAAAGCTGG - Intronic
1081439571 11:43065362-43065384 CACTACAAGCAAAAAAAGGCAGG + Intergenic
1081681136 11:45004157-45004179 AACATTAAGCATTAGAAAGCTGG - Intergenic
1081791659 11:45792177-45792199 CACCATAAGAATAAGCCGGCCGG + Intergenic
1083191493 11:61055624-61055646 ACAAAGAAGCATAAGAAGGCTGG + Intergenic
1084450928 11:69237258-69237280 AACGATAAGCATAAGAAGGTTGG + Intergenic
1088404138 11:109453623-109453645 AACCATAAGCATAAAAAGACTGG - Intergenic
1088415000 11:109578800-109578822 CAAAATAAGCAAATGATGGCTGG - Intergenic
1089685783 11:120145913-120145935 CACCATCAGAATAACAAGGCTGG + Intronic
1090481736 11:127074949-127074971 CACAACAAGCTGAAGAGGGCAGG - Intergenic
1090871301 11:130751652-130751674 AACAGTAATCATAAGAAAGCTGG + Intergenic
1091179213 11:133588425-133588447 CACCATGTGCATCAGAAGGCTGG - Intergenic
1092371027 12:7916551-7916573 CACAATAAGTGTTAGATGGCTGG - Intergenic
1092902164 12:13070112-13070134 CACAATAATCCTATGAAGGCAGG - Intronic
1093015920 12:14154658-14154680 CACAATAAGCAAAAAAAGAAGGG + Intergenic
1093053204 12:14527860-14527882 AACAGTAAGCATAAGAAAGCTGG + Intronic
1094391471 12:29955580-29955602 CAAAATAATCATAAGCAGGAAGG + Intergenic
1096004232 12:48156071-48156093 CACAAAAAGCAAAAATAGGCCGG - Intronic
1096217693 12:49807496-49807518 AACAATAAGCATTAGAGGCCAGG - Intronic
1096844888 12:54401011-54401033 CACAATCATCATGAGAAGGAAGG + Intronic
1097270501 12:57771273-57771295 CATAAGAAGCATGAGAAGGTTGG + Intronic
1097827552 12:64189693-64189715 GACAGTAAGCATAAGAAAGCTGG + Intronic
1098222210 12:68282246-68282268 CACAATAACCATAAGAAATAAGG - Intronic
1098620411 12:72590641-72590663 AAAAATAAGATTAAGAAGGCTGG - Intronic
1100648424 12:96557318-96557340 GACAATAAGCAAAAGAAAGAAGG + Intronic
1102293521 12:111720606-111720628 ATCACTAAGCATAAGAAAGCTGG - Intronic
1102877717 12:116460715-116460737 AAAAATAAAAATAAGAAGGCTGG + Intergenic
1103070209 12:117935122-117935144 AAGAAGAAGAATAAGAAGGCAGG - Intronic
1103490123 12:121311323-121311345 AACAATAACCAAAAGAAAGCTGG + Intronic
1103550885 12:121736548-121736570 CTCAAAAAGAAAAAGAAGGCCGG - Intronic
1105567189 13:21561626-21561648 AACACTAATCAAAAGAAGGCTGG - Intronic
1106637868 13:31550104-31550126 AACAATAATCAAAAGAAAGCTGG - Intergenic
1107937325 13:45356130-45356152 AACAATAATCATAATAAGGCCGG - Intergenic
1108144531 13:47463165-47463187 CAGAAAAGGCATAAGAAGGATGG + Intergenic
1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG + Intergenic
1110607979 13:77455457-77455479 TACAAACAGCATAAGAATGCTGG + Intergenic
1111019956 13:82436816-82436838 CAAAATAAACCTTAGAAGGCTGG + Intergenic
1111826067 13:93269560-93269582 CAGAAAAAGCAAAAGAAGGTGGG - Intronic
1112165344 13:96912647-96912669 TACAATAAACATGAGAATGCAGG - Intergenic
1112543639 13:100342649-100342671 CACCACAAGCAAAAGGAGGCAGG - Intronic
1114360291 14:21964676-21964698 TACAATAAACATGAGGAGGCAGG + Intergenic
1116290999 14:43040405-43040427 CAAAATTAGCCTAAGAATGCAGG - Intergenic
1117163674 14:53013277-53013299 CAAAATAAAAATATGAAGGCCGG - Intergenic
1118021220 14:61716714-61716736 CACAAGAAGCTTAATAAGACGGG + Intronic
1119002377 14:70894196-70894218 CACAATAAGCATATGTAAGAGGG - Intergenic
1120827517 14:88969093-88969115 CACAGTAAGCGAAAGAAGGTGGG - Intergenic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1122146882 14:99695937-99695959 AACACTAAGCATAAGAAAGCTGG - Intronic
1122168247 14:99847816-99847838 AATAATAAGTATAAAAAGGCTGG - Intronic
1124184165 15:27507978-27508000 AACATTAAGCAAAAGAAAGCTGG - Intronic
1124653670 15:31490259-31490281 CAAAATGAGCCTAAAAAGGCCGG + Intronic
1126812181 15:52418223-52418245 CACAATAATCCTAAATAGGCTGG + Intronic
1126937929 15:53731906-53731928 CACTATAAGCTTAAGAAATCTGG - Intronic
1127105836 15:55614044-55614066 CCGAGTAAGCATAAGAAAGCTGG - Exonic
1129000883 15:72332817-72332839 AACACTAATCAAAAGAAGGCTGG - Intronic
1129076822 15:73004158-73004180 CACATTAAGCATTTGAGGGCAGG + Intergenic
1129139753 15:73586762-73586784 CAAAATTATCATGAGAAGGCAGG - Intronic
1131974187 15:97926417-97926439 AACAGTAAGCATAAGAAGATTGG - Intergenic
1132612955 16:826604-826626 CACAAAAAGAATAAGAGGGTCGG + Intergenic
1132979234 16:2727252-2727274 CAAAACAAGCAGAACAAGGCCGG + Intergenic
1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG + Intergenic
1134731542 16:16466299-16466321 CAACATAAGGAAAAGAAGGCTGG - Intergenic
1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG + Intergenic
1135176345 16:20233142-20233164 CACAATATGCATAAGAAGTTGGG - Intergenic
1135492859 16:22924955-22924977 CAGAATAACCATGAGAAGGGAGG + Intergenic
1138052224 16:53791313-53791335 CACAGTAACCTTAAGTAGGCAGG + Intronic
1138463325 16:57167207-57167229 CACAATAACCTCAAGAAGGTTGG - Exonic
1138506759 16:57482158-57482180 CAAAAGAAGAAAAAGAAGGCCGG - Intronic
1138610193 16:58117273-58117295 CACAATAAAAACAACAAGGCAGG + Intronic
1140170867 16:72602965-72602987 CACAGCAACCATAAGAAAGCTGG + Intergenic
1140436014 16:74947772-74947794 CAAAATAATCACAAGAGGGCCGG + Intronic
1143643863 17:8216866-8216888 CAAAATAATAATAATAAGGCCGG - Intergenic
1144231751 17:13212771-13212793 AACACTAATCAAAAGAAGGCTGG + Intergenic
1147606214 17:41775234-41775256 CACAACAGACAGAAGAAGGCTGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149586870 17:57795020-57795042 AACACTAAGCAAAAGAAAGCAGG + Intergenic
1150545317 17:66151007-66151029 AACAATAAGCATAAAAAAGCTGG - Intronic
1150666767 17:67147467-67147489 AAAAATAAGAATAAAAAGGCAGG - Intronic
1150883236 17:69055323-69055345 AACAATAATCAGAAGAAAGCTGG + Intronic
1151552946 17:74832355-74832377 CACCATGAGGATATGAAGGCGGG - Intronic
1151708017 17:75781885-75781907 CACGTTAAGATTAAGAAGGCTGG - Intronic
1153358086 18:4160521-4160543 CACAATAAGCCTAATGAGGTAGG + Intronic
1153543936 18:6186559-6186581 CACAGTAAGCATGGGAAAGCAGG + Intronic
1153899131 18:9600568-9600590 AATAGTAAGCATAAGAAAGCTGG + Intronic
1154284937 18:13045578-13045600 CACAATAATTTTAAGAATGCAGG - Intronic
1154344935 18:13534038-13534060 CATAGGAAGCATCAGAAGGCAGG - Intronic
1155057578 18:22198365-22198387 AACAAGAAGCATAAGCAGGCTGG - Intronic
1155915328 18:31551765-31551787 AGCACTAACCATAAGAAGGCTGG - Intergenic
1156201377 18:34835919-34835941 ACAAAGAAGCATAAGAAGGCAGG + Intronic
1156843997 18:41642158-41642180 AAAAATAAGCATAAGAAAGCTGG + Intergenic
1157058338 18:44256644-44256666 CCCAAAAAGCATAATAAGGCTGG + Intergenic
1157978046 18:52348884-52348906 CACAATAAACAGGATAAGGCAGG - Intronic
1159812201 18:73029654-73029676 AACAATAAACAAAAGAAAGCAGG + Intergenic
1164819739 19:31238707-31238729 AACAATAAGAGTAAGAAAGCTGG - Intergenic
1165416718 19:35698776-35698798 CTCAATAAGCAACTGAAGGCAGG + Intergenic
1165550452 19:36579280-36579302 CACATTAAGTATAAGAAAGTTGG + Intronic
1166063908 19:40345400-40345422 CACAATAAGAATGGTAAGGCCGG + Intronic
1168080532 19:54006829-54006851 CAAAATAAAAAAAAGAAGGCCGG - Intronic
925561122 2:5196822-5196844 GACAATAAACGTAAGAAGACAGG - Intergenic
926987780 2:18642466-18642488 AATGATAAACATAAGAAGGCTGG + Intergenic
927160204 2:20250241-20250263 CACAATAATAAAAAGAAAGCTGG + Exonic
928325533 2:30316626-30316648 CACCATGAGCAGAAGTAGGCAGG - Intronic
929149929 2:38738410-38738432 TAAAATAAGCATAAGAAGCTGGG + Intronic
930596990 2:53401251-53401273 CTCAGTATGCATAAGAAGTCTGG - Intergenic
931386594 2:61803517-61803539 CACAATAAGATTAATAAGGCCGG + Intergenic
932464778 2:71911781-71911803 AACATTAATCATAAGAAAGCTGG + Intergenic
934844784 2:97655791-97655813 CACAAAAAGCCTCAGGAGGCTGG - Intergenic
935480363 2:103580460-103580482 GACAATAAGCAAAAGAAAGCTGG - Intergenic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
937893069 2:126954844-126954866 AACAGTAAGCACAAGAAAGCTGG - Intergenic
938143974 2:128819120-128819142 GAAAATAAGGGTAAGAAGGCTGG - Intergenic
939226424 2:139370544-139370566 GAAAATAAGCATAAGAAGTTCGG + Intergenic
939448803 2:142344972-142344994 AACAGTAAGCATAAGAAGATTGG + Intergenic
939726901 2:145732019-145732041 AATAATAATAATAAGAAGGCAGG + Intergenic
939898130 2:147817522-147817544 AAAAATAAACATAAGCAGGCTGG + Intergenic
940749981 2:157614803-157614825 CACACTAACTATAAGAAAGCTGG - Intronic
941570778 2:167167414-167167436 CACAAAAAGCATAAAAAGAATGG - Intronic
942049509 2:172126116-172126138 AACAATAAGCATGAAAAAGCTGG - Intergenic
942358811 2:175149497-175149519 CACACTATGCATAAGAAAACTGG + Intronic
943052254 2:182928844-182928866 CACAAACACCATGAGAAGGCAGG + Exonic
944330479 2:198459995-198460017 TACAATAAACAAAAGAAAGCTGG - Intronic
945428255 2:209734671-209734693 GTCAATTAGCATAAGTAGGCAGG - Intergenic
946795980 2:223353759-223353781 AACAGTAGGCATAAGAAGGGTGG - Intergenic
946889364 2:224259492-224259514 GACAATAAGAATAAGCCGGCTGG + Intergenic
947030292 2:225784552-225784574 CACAATATCCATAAGGAGGAAGG + Intergenic
947059074 2:226141655-226141677 CACGCTAAACATCAGAAGGCTGG - Intergenic
947086763 2:226461569-226461591 AACACTAAGCATAAGAAATCTGG + Intergenic
947458847 2:230284371-230284393 CAGAATGAGAATGAGAAGGCAGG + Exonic
948550593 2:238770164-238770186 CAGCATATGCATGAGAAGGCAGG - Intergenic
1169835852 20:9877792-9877814 CACAGCAACCATAAGAAAGCTGG + Intergenic
1170064625 20:12298367-12298389 CACAAAAAACATGAAAAGGCAGG - Intergenic
1170397590 20:15944288-15944310 AAAAATAAGCAAAAGAAGGAAGG + Intronic
1170879483 20:20283370-20283392 AACAGTAAGCATAAGAAGAATGG - Intronic
1173936256 20:46867867-46867889 AACAATAAGCATAAGAAGGCAGG - Intergenic
1174778562 20:53367865-53367887 TAAAAGAAGAATAAGAAGGCTGG - Intronic
1176303405 21:5110628-5110650 CACATTAATCACAAGAAAGCTGG + Intergenic
1176904781 21:14486688-14486710 CAAAATAGGCATAAGAAACCAGG + Intronic
1177868515 21:26542211-26542233 CATAAACAGCATAAGAAGGTGGG + Intronic
1179477021 21:41653528-41653550 AACATTAGCCATAAGAAGGCAGG - Intergenic
1179853628 21:44151322-44151344 CACATTAATCACAAGAAAGCTGG - Intergenic
1179964894 21:44797418-44797440 CTCAATAAAAATGAGAAGGCCGG + Intronic
1181084463 22:20433011-20433033 GACAATCAGCATAAACAGGCCGG - Intronic
1181298549 22:21862233-21862255 CACAATAACCTTAACAAGACAGG + Intronic
1181619325 22:24077751-24077773 CCCAATCAGCATAAGGAGGATGG - Intronic
1182190389 22:28453990-28454012 TAAAGGAAGCATAAGAAGGCAGG - Intronic
1182912727 22:34000197-34000219 AACACTATGCATAAGAAAGCTGG + Intergenic
1184944438 22:47793094-47793116 AAAAATAAGCATAAAAAGGAAGG + Intergenic
1185090349 22:48764416-48764438 AACAGTAAGCATAAGAAATCTGG + Intronic
949730157 3:7101409-7101431 AACAACAAGCATAAGAAAGCTGG - Intronic
950182167 3:10921800-10921822 AACAATAAACATAAGAAAACTGG + Intronic
951030178 3:17872790-17872812 TACAATAAACATAAGAATGAAGG + Intronic
952674481 3:36010774-36010796 AACAATAAACATGAGAATGCAGG - Intergenic
954050375 3:47970511-47970533 CCCAAAAAACATCAGAAGGCTGG + Intronic
954502554 3:51032486-51032508 CACAATAAGCATAAGAAGGCTGG - Intronic
954897718 3:53991146-53991168 CTCAAAAAATATAAGAAGGCCGG - Intergenic
955614239 3:60789217-60789239 CACAACAAGAATACGAAGGTTGG + Intronic
955954029 3:64269855-64269877 CACAATAAAGAAAGGAAGGCTGG + Intronic
956532306 3:70234082-70234104 CACATTAAGAATAAAAAGACTGG + Intergenic
957262245 3:77917155-77917177 TACAATAAACATGAGAATGCAGG + Intergenic
957538528 3:81537797-81537819 AAGAATAAGCATAAGCATGCAGG - Intronic
958588812 3:96126408-96126430 TGCAATAAACATAAGAAGGCAGG - Intergenic
958786284 3:98599721-98599743 TACAATAAGAAAAAGAAGGGAGG - Intergenic
958943850 3:100342186-100342208 AACATTAGGCATAAGAAGGCTGG - Intronic
959081175 3:101802629-101802651 CTTAATAAGCATAGGAAGTCAGG + Intronic
959845526 3:111028177-111028199 CACAATAAGGTAAAGAAGGATGG + Intergenic
960070931 3:113429436-113429458 AACAGTAAGCATAACACGGCTGG - Intronic
960281989 3:115790714-115790736 CAGAACAACAATAAGAAGGCTGG + Intergenic
961339007 3:126204910-126204932 GACAATAAGCATAATAAAGATGG + Intergenic
962595074 3:136934034-136934056 CACCATAAGCACTAGAAGGTAGG + Intronic
962670620 3:137703404-137703426 AACAATAAACATCAGAAAGCTGG - Intergenic
963201479 3:142590781-142590803 AAAAATAAGTAAAAGAAGGCTGG - Intergenic
963235580 3:142952790-142952812 AACAAAAAGCAGCAGAAGGCAGG - Intronic
964699585 3:159550527-159550549 AACACTAAGCAAAAGAAAGCTGG - Intronic
966009396 3:175056286-175056308 CACACTAATGATAAGAAGGAAGG - Intronic
966209608 3:177439547-177439569 CAAAATGTGCATAATAAGGCTGG - Intergenic
970013878 4:11490886-11490908 AACAAGAGGCATAAGTAGGCTGG - Intergenic
971056004 4:22913481-22913503 AACAATATGCATAAGAAAGCTGG - Intergenic
971549169 4:27927758-27927780 TCCAATCAGCATAAGAAGGTGGG + Intergenic
972419780 4:38876465-38876487 GAGAATAAGCATAGGAAGGCAGG - Intronic
972822790 4:42721447-42721469 CACAATAAGCCAAGGAATGCAGG - Intergenic
974072376 4:57136039-57136061 CATAATAAGCATATAATGGCTGG + Intergenic
974872661 4:67661999-67662021 CACAATAACCCTATGAAGGTAGG + Intronic
975392730 4:73837712-73837734 CCCAGTAAGAATAAGAAGGAAGG + Exonic
976148583 4:82068838-82068860 CAGAATTAGCATAAGAACGTGGG + Intergenic
977072903 4:92415009-92415031 CAAAATAATAATAATAAGGCAGG - Intronic
977197251 4:94078553-94078575 CACAAGAAACATGAAAAGGCTGG - Intergenic
977869029 4:102067484-102067506 AAACATAAGCATAAGAAAGCTGG + Intronic
978781768 4:112563629-112563651 CACAGAAGGCCTAAGAAGGCAGG + Intronic
979044459 4:115844469-115844491 CACAATAAGCAAATAAAGACTGG - Intergenic
981160191 4:141488254-141488276 CACAATTAGAACAAGGAGGCCGG - Intergenic
981602921 4:146511171-146511193 CACATTAAACATAAGAAACCAGG + Intronic
982349971 4:154404834-154404856 GACAATAAGCATGATAAAGCTGG - Intronic
982989303 4:162250535-162250557 AACAATAAACATGAGAAGGCTGG + Intergenic
984226360 4:177039982-177040004 CTGAATAAGCACAATAAGGCAGG + Intergenic
984776854 4:183489038-183489060 AAATATAAGCATAAGAAGGTTGG - Intergenic
985114322 4:186576093-186576115 CAAAATAAGCAAAATAAGGGGGG + Intergenic
986082708 5:4410581-4410603 CAGAATAAGCATAATATGTCAGG - Intergenic
986248050 5:6029019-6029041 AACAAAAAGCAAAAGGAGGCTGG - Intergenic
986834636 5:11621837-11621859 CTCATTAAGCATATGTAGGCGGG + Intronic
988972463 5:36483382-36483404 CACAATAATAATCAGAAGCCAGG - Intergenic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990051022 5:51501285-51501307 AACACTAAGCAAAAGAAAGCTGG - Intergenic
990982759 5:61616534-61616556 CACAAATAGCATAAGAACTCAGG + Intergenic
991325146 5:65422836-65422858 TGCAATAAGCATATGAATGCAGG - Intronic
992317174 5:75567991-75568013 CACAGTAAGACTAAGAAGGAAGG + Intronic
992504578 5:77374198-77374220 GCAAACAAGCATAAGAAGGCTGG - Intronic
992821313 5:80499658-80499680 CATCAGAAGCATAAGAATGCAGG - Intronic
992978835 5:82145099-82145121 AACAATAACCATAAGAATGTTGG - Intronic
993337881 5:86683999-86684021 CAAAATGAGCATAAGAAGAGAGG + Intergenic
993403305 5:87479861-87479883 CTAACTAAGCATAAGAAAGCTGG - Intergenic
993634755 5:90330754-90330776 CACAGGAAACATAAAAAGGCAGG - Intergenic
994641598 5:102417159-102417181 AACAACAAGCAAAAGAAAGCTGG - Intronic
995238778 5:109861581-109861603 CACAACAACCCTAAGAAGGTAGG + Intronic
995421933 5:111977560-111977582 AACAATGGCCATAAGAAGGCTGG - Intronic
995496655 5:112752174-112752196 GAAAATATGAATAAGAAGGCAGG - Intronic
995684122 5:114752375-114752397 AACAATAATCAAAAGAAAGCTGG - Intergenic
995828130 5:116324574-116324596 CAAAAGAAACATAACAAGGCTGG + Intronic
995901663 5:117076046-117076068 AACAGTAAGCATAAGAATTCTGG - Intergenic
996127771 5:119746024-119746046 CAGCAAAAGCATGAGAAGGCAGG - Intergenic
1000826385 5:166050277-166050299 CACAATGAACATGAGAAGGCTGG - Intergenic
1000941336 5:167364635-167364657 TACAATAAAAATAAGAAAGCTGG + Intronic
1001532139 5:172470826-172470848 AACAGTAAGAATAAGAATGCTGG - Intergenic
1003584284 6:7372560-7372582 CAAAAGAACCACAAGAAGGCAGG + Intronic
1004052623 6:12101923-12101945 AATAACAAGCATAAGAAAGCTGG + Intronic
1004201296 6:13550340-13550362 AACAAAAAAGATAAGAAGGCTGG - Intergenic
1006980942 6:38147439-38147461 CACAATAAACATGCGAATGCAGG + Intronic
1010776817 6:79896284-79896306 CACCATCAGAATAAGAGGGCTGG + Intergenic
1010882121 6:81190377-81190399 CAAAATAAGCATACAAATGCAGG - Intergenic
1011364659 6:86568634-86568656 CCCAATAAGTATGAGAAGGGAGG - Intergenic
1011695137 6:89905791-89905813 CACACTAATCAAAAGAAGGCAGG - Intergenic
1011777333 6:90746398-90746420 CAAGATAGGCACAAGAAGGCTGG - Intergenic
1012762586 6:103320921-103320943 GAACATAAACATAAGAAGGCCGG + Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013722326 6:113045419-113045441 CAAAATAGGCTTAGGAAGGCAGG + Intergenic
1013918423 6:115369472-115369494 CAGAAAAAGCATTAGAAGGTTGG + Intergenic
1015171358 6:130258199-130258221 AACAATAAGAATACGAAAGCTGG - Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015528568 6:134197527-134197549 CATAAAAAGCAAAAGTAGGCCGG + Intronic
1016660387 6:146570861-146570883 CACAAGAAACATAAAAAAGCAGG + Intergenic
1017397242 6:154016354-154016376 CACAAAAAGCATAAGAAAGTAGG + Intronic
1017613797 6:156222097-156222119 CACAATAAGTAAAAGAAAACTGG + Intergenic
1018654147 6:166017346-166017368 AACAGTAAGCATAAGAAAGCTGG + Intergenic
1019046328 6:169150498-169150520 CAAAATATGCATAAGAAAACTGG - Intergenic
1020362501 7:7343633-7343655 AAGAATAAGCATAACAAAGCTGG - Intergenic
1023215604 7:37859307-37859329 AAGAATAAGCATTAGAAGGATGG - Intronic
1023344372 7:39256319-39256341 GCCAATAAGCATAGGAAGACCGG + Intronic
1024405522 7:48975181-48975203 CCCAATAAGGATTAAAAGGCAGG + Intergenic
1024488928 7:49954553-49954575 AACACTAAACATAAGAAAGCTGG + Intronic
1024536049 7:50435252-50435274 AACAATAACAATAAGAAGTCAGG - Intergenic
1027914668 7:84300558-84300580 AATAATAAGCATGAGAATGCTGG + Intronic
1027938027 7:84633845-84633867 CACAATAAACAAAGAAAGGCAGG + Intergenic
1028559022 7:92153358-92153380 AAAAATAAGCATAAGAGGCCGGG - Intronic
1028862883 7:95674104-95674126 AACAATAACCAAAAGAAAGCTGG + Intergenic
1028990738 7:97046342-97046364 CACTATAACCATGAGAAGGCTGG - Intergenic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1031147240 7:118010365-118010387 CATTATAACCATAAGAAGGTAGG + Intergenic
1031518309 7:122729317-122729339 CACAATAAACATGAGGATGCAGG + Intronic
1031543802 7:123027876-123027898 AACAATAATAACAAGAAGGCTGG - Intergenic
1031719027 7:125145746-125145768 AACACTAACCATAAGAATGCTGG + Intergenic
1031939394 7:127771572-127771594 TCCAATAAGCCTAAGAAGGCAGG - Intronic
1033178126 7:139146296-139146318 CAAAATAAGCATTACAAGGTTGG + Intronic
1034118376 7:148604735-148604757 TAAAATAAACAGAAGAAGGCAGG + Intronic
1036478340 8:9115156-9115178 GACAATAAACATAAGAAGACTGG + Intronic
1037981959 8:23260806-23260828 CACTATAAAGATGAGAAGGCAGG - Exonic
1039200480 8:35086440-35086462 AGCAATAACCATAAGAAAGCTGG - Intergenic
1039708028 8:40027034-40027056 CACAATAAGCACAAGAAGGACGG + Intergenic
1040396412 8:47004695-47004717 AACAATAATCAAAAGAAAGCAGG - Intergenic
1040783024 8:51133509-51133531 CATACTAAGTAAAAGAAGGCAGG + Intergenic
1041012913 8:53561161-53561183 CACTATAAGAATTTGAAGGCTGG + Intergenic
1041034906 8:53778886-53778908 AACCATAAGCGTAAGAATGCTGG + Intronic
1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG + Intergenic
1042079520 8:65036009-65036031 CATAATAGGCATAATAAGGAAGG - Intergenic
1042094614 8:65199802-65199824 CACAATAAGAATAATAAGATTGG - Intergenic
1043791946 8:84480096-84480118 CACAATAAGAATAACGAGTCAGG - Intronic
1043839092 8:85080703-85080725 AACACTAATCATAAGAAGGTAGG - Intergenic
1044403958 8:91805396-91805418 ATCAGTAAGCATAAGAAGGCTGG + Intergenic
1045155995 8:99472015-99472037 AACAGTCAGCATAAAAAGGCTGG + Intronic
1045642363 8:104265397-104265419 AACAGTAAGCATAAGAAGGATGG - Intergenic
1047711919 8:127561103-127561125 CACAACAAGCATAGGGAGGCGGG + Intergenic
1047888025 8:129274451-129274473 CCCAAGAAGCAGAAAAAGGCAGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048825271 8:138417853-138417875 AAAAATAAGCATAAGAACTCTGG + Intronic
1048935661 8:139354397-139354419 AACAGTAAGCATAAGAAAACTGG + Intergenic
1049384673 8:142336401-142336423 AACAGTAATCATAAGAAAGCTGG + Intronic
1049837997 8:144751878-144751900 AACAGTAAGTATAAGAAGGATGG + Intronic
1051007113 9:12358639-12358661 TATAATAAGCACAAGAATGCAGG - Intergenic
1051201909 9:14634775-14634797 CACAAGAAACATAAAAAAGCAGG + Intronic
1052129662 9:24827820-24827842 CACAGTAAGCAAAACATGGCAGG + Intergenic
1052263075 9:26540021-26540043 CACAATACGCATAATAAGTTAGG + Intergenic
1055160069 9:73115633-73115655 CCCAATCATCATAAGATGGCAGG + Intergenic
1055405044 9:75965526-75965548 AACAAAAAGCAGAAGAAGGGAGG - Intronic
1056303497 9:85267156-85267178 CACAAGTAGCAAAAGAAGGAGGG - Intergenic
1057709713 9:97428282-97428304 CACAAATACCATAAGAATGCAGG - Intronic
1058847574 9:108976276-108976298 CATACTAAGCAAAAGAAGCCAGG - Intronic
1059066361 9:111089738-111089760 AACAGTAAACATTAGAAGGCTGG + Intergenic
1059222377 9:112636683-112636705 AACAATAAGCAAATGAAAGCTGG - Intronic
1059467907 9:114481027-114481049 AACAATATGCCTAAGAAGGGGGG + Intronic
1062719632 9:138031821-138031843 CATATTAATCAAAAGAAGGCAGG - Intronic
1187243239 X:17531888-17531910 CACTATGAGGATAAGAAGGAGGG - Intronic
1187627104 X:21127812-21127834 AACATTAAGCATAAGAAGTCTGG - Intergenic
1188861348 X:35260244-35260266 CACAATACTCATAAAAAGGCAGG + Intergenic
1189345155 X:40235251-40235273 GAGAATAAGTATAAGAGGGCTGG - Intergenic
1191647700 X:63500597-63500619 TACAATAAGCATGAGAGTGCAGG - Intergenic
1193889355 X:87025232-87025254 TGCAATAAACATAAGAATGCAGG + Intergenic
1197666104 X:129225103-129225125 CACAATAAAAATAAGAAAGAAGG - Intergenic
1198973688 X:142310478-142310500 CACAGTAAGAGTAAGAAAGCTGG + Intergenic
1199190538 X:144964812-144964834 CACAATTAGCAGAAGAATGAGGG - Intergenic
1199670249 X:150140657-150140679 AACAGTAATCATAAGAAAGCTGG - Intergenic
1200872834 Y:8121898-8121920 CAGAATAAGCATTAAAATGCAGG + Intergenic
1201366628 Y:13213507-13213529 CACAATAAACAGATGTAGGCCGG - Intergenic