ID: 954510747

View in Genome Browser
Species Human (GRCh38)
Location 3:51122763-51122785
Sequence TCTTCTGGGCAGTGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 354}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954510747_954510753 -1 Left 954510747 3:51122763-51122785 CCAGCTTCCCACTGCCCAGAAGA 0: 1
1: 0
2: 1
3: 42
4: 354
Right 954510753 3:51122785-51122807 AGCATCCTGACATCTGACCTGGG 0: 1
1: 0
2: 0
3: 12
4: 186
954510747_954510755 7 Left 954510747 3:51122763-51122785 CCAGCTTCCCACTGCCCAGAAGA 0: 1
1: 0
2: 1
3: 42
4: 354
Right 954510755 3:51122793-51122815 GACATCTGACCTGGGTCTGCAGG 0: 1
1: 0
2: 2
3: 17
4: 218
954510747_954510758 25 Left 954510747 3:51122763-51122785 CCAGCTTCCCACTGCCCAGAAGA 0: 1
1: 0
2: 1
3: 42
4: 354
Right 954510758 3:51122811-51122833 GCAGGATTTATGGATATATGAGG 0: 1
1: 0
2: 1
3: 11
4: 154
954510747_954510752 -2 Left 954510747 3:51122763-51122785 CCAGCTTCCCACTGCCCAGAAGA 0: 1
1: 0
2: 1
3: 42
4: 354
Right 954510752 3:51122784-51122806 GAGCATCCTGACATCTGACCTGG 0: 1
1: 0
2: 0
3: 13
4: 119
954510747_954510756 15 Left 954510747 3:51122763-51122785 CCAGCTTCCCACTGCCCAGAAGA 0: 1
1: 0
2: 1
3: 42
4: 354
Right 954510756 3:51122801-51122823 ACCTGGGTCTGCAGGATTTATGG 0: 1
1: 0
2: 0
3: 17
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954510747 Original CRISPR TCTTCTGGGCAGTGGGAAGC TGG (reversed) Intronic
900619183 1:3579190-3579212 TCATTTGGGCCATGGGAAGCGGG - Intronic
901473834 1:9475543-9475565 TCCTCTGGGCTGTGGGCAGAGGG - Intergenic
901843155 1:11966230-11966252 TCCTGTGGGAAGTGGGAAGCAGG - Exonic
901861662 1:12078592-12078614 TCTCATGGGGAGTGGGGAGCAGG + Intronic
902788880 1:18751643-18751665 TTGCCTGGGAAGTGGGAAGCGGG + Intergenic
903668190 1:25020815-25020837 GCTTCTGTGCAATGGGCAGCAGG - Intergenic
903679324 1:25086790-25086812 TCTTCTGGGGAGGCTGAAGCAGG + Intergenic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904929517 1:34075260-34075282 TCTTGTGGGCAGAAGGAGGCTGG - Intronic
905468024 1:38170496-38170518 TCCTCTGGGGGATGGGAAGCAGG + Intergenic
905583297 1:39098510-39098532 TCTACTGTGCCTTGGGAAGCCGG + Intronic
906455866 1:45996465-45996487 TCTTCTGGCTAGTGGGCACCAGG - Intronic
906670728 1:47652522-47652544 TCTTCTGTCCAGTGGGAACTCGG + Intergenic
908167333 1:61471423-61471445 TGTTCTGGGCATTGGGAAGAGGG - Intergenic
908640585 1:66218603-66218625 TCTTCTGGGCTGGGGGTGGCTGG - Intronic
909070567 1:70988535-70988557 CCTTCTGGTCAGTAGGAAGGAGG - Intronic
910172061 1:84387988-84388010 TCTTCTGGAGAGTGGGCAGGTGG + Intronic
910661046 1:89672992-89673014 TGTTTTGGGCAGTGGAAAGTAGG - Intronic
912572570 1:110635276-110635298 TTTTCTGGACAGTGAGAATCAGG + Intergenic
912811645 1:112799575-112799597 TCTACTGGGCCTTGTGAAGCTGG + Intergenic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
915019938 1:152769640-152769662 TCTTCTGGGGTGTGGGAGTCAGG + Intronic
915091493 1:153429374-153429396 TCTTTTGGGCAGTGAGGGGCTGG - Intergenic
915581788 1:156817134-156817156 TGTTCTGAGCAGTGGGAATGGGG + Intronic
915624676 1:157107335-157107357 ACTACTGGGCAGAGGGAGGCAGG - Intergenic
915812723 1:158931862-158931884 TCTTCAGGGCAGTGGGGTGAGGG + Intronic
916192072 1:162189557-162189579 TGTTCTAGGCACTGGGAAACAGG + Intronic
918046200 1:180942402-180942424 TCTCCTAGGCAGAGTGAAGCAGG + Intronic
918113100 1:181475515-181475537 TTTTTGGGGCAGTGTGAAGCAGG + Intronic
919540816 1:198843195-198843217 TTTTCTGTGCAGTGGGCAGGAGG - Intergenic
921792157 1:219302426-219302448 GCTTCTGGGCTGTGGAAAGCAGG - Intergenic
923147355 1:231207541-231207563 TCTTGGAGGCAGTGGGGAGCTGG - Intronic
924672603 1:246144815-246144837 TCTTCTGTGAAGTGGGAACATGG - Intronic
1063435659 10:6027710-6027732 TCTTCTGGACAGTGAGAAAAAGG - Intronic
1065479448 10:26177648-26177670 TCTTCTGGGCAGAGGTCAGCAGG - Intronic
1067082955 10:43221834-43221856 TCATCTGGGAAGTGGAGAGCAGG - Intronic
1068290496 10:54996032-54996054 CTTTCTGTGCAGTGGGGAGCAGG + Intronic
1069830100 10:71277697-71277719 TGTACCTGGCAGTGGGAAGCAGG + Intronic
1070482899 10:76902589-76902611 TGTCCTTGGCAGTGGGAAGAGGG - Intronic
1070762428 10:79032687-79032709 TCTTCTGGGCAGGATGAAGTGGG - Intergenic
1070788195 10:79174441-79174463 TTTGATGGGCAGTGGGGAGCCGG + Intronic
1070972890 10:80582164-80582186 TCTTCTGGCCAGAGGGAGGGAGG - Intronic
1072454319 10:95562523-95562545 TCTTCAGGGATGTGGGAAGCTGG - Intergenic
1072482365 10:95821599-95821621 TCTTTTGGGAAGGGAGAAGCAGG + Intronic
1073051413 10:100669748-100669770 CCATCTGTACAGTGGGAAGCAGG - Intergenic
1073598088 10:104819627-104819649 TGTGCTGGGCAGTGGGAGGCAGG + Intronic
1075077928 10:119363682-119363704 GCCTCTGGGAAGAGGGAAGCTGG + Intronic
1075121308 10:119666831-119666853 TTTTCTGGGCAGTGGTAAATGGG - Intronic
1075417078 10:122272033-122272055 TGTCTAGGGCAGTGGGAAGCTGG + Intronic
1076234915 10:128856088-128856110 ACTGCTGGGAAGTGGGAAGTGGG + Intergenic
1076573618 10:131449308-131449330 TCGTCAGGGCAGGGGGATGCTGG + Intergenic
1077002029 11:328267-328289 GCCTCTGGGCAGTGGGCAGCGGG + Intergenic
1077791422 11:5444577-5444599 TCAGGTGGGCAGTGTGAAGCAGG + Intronic
1079300958 11:19278584-19278606 TGTTCTGGCCAGAGGGATGCTGG - Intergenic
1079338984 11:19596580-19596602 TGTCCGGGGCAGTGGGAGGCTGG - Intronic
1080462857 11:32471027-32471049 GATTCTGGACAGTGGGAAGATGG - Intergenic
1080759863 11:35238062-35238084 CCCTCAGGGCAGTGGCAAGCTGG + Intergenic
1082805395 11:57446142-57446164 TATTCTGAACAGTGGGAAGTAGG - Intergenic
1082972419 11:59037572-59037594 TTTTCTGTGCAGTGAGCAGCTGG + Intronic
1082976892 11:59081474-59081496 TTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083770485 11:64864289-64864311 CCTTCTGGGCACAGGGAACCTGG - Intronic
1084120197 11:67064610-67064632 AGTTCTGGACACTGGGAAGCAGG - Intronic
1084120755 11:67067632-67067654 TGTTCTGGGCATTGGGTACCAGG + Intronic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1084481085 11:69420633-69420655 GATTCTGGGCAGGGTGAAGCCGG + Intergenic
1085240093 11:75045935-75045957 TTTTATGGGCAGTAGGAAGAAGG - Intergenic
1087138222 11:94740961-94740983 TCGTCTGGGCTGTAGGATGCGGG - Intronic
1087664679 11:101030580-101030602 TCTCCTGGTCAGTTGGAGGCAGG + Exonic
1088693254 11:112345650-112345672 TCTGCTGGGTGGTGGGGAGCTGG + Intergenic
1088884417 11:113995772-113995794 TGTTCTGGGGATTGGGAAGTGGG + Intergenic
1089036513 11:115399228-115399250 TCTTCTTGAAAGTTGGAAGCTGG + Intronic
1089539797 11:119182949-119182971 GCTGCTGGCCAGTGGGAGGCAGG - Intronic
1089560725 11:119341833-119341855 TCTTCTGGGTGGAGGGAAGGAGG - Intronic
1090184161 11:124725418-124725440 TGCTCTGGGCACTGGGAATCAGG - Intergenic
1090481431 11:127072067-127072089 TCTCCTGGGGAGAGAGAAGCAGG - Intergenic
1091586717 12:1821051-1821073 TCTGCTGGGAAGTGGGGAGGAGG + Intronic
1092963666 12:13620496-13620518 GGTTCTGGGCAGTGGTGAGCTGG - Intronic
1093977298 12:25437400-25437422 TCTTGTGGGCTGTGGGTAACTGG + Intronic
1094259320 12:28474947-28474969 TCTTTTGGGAAGTGGGAAACTGG + Intronic
1094680480 12:32662810-32662832 TCATCTGTGCAGTGGCGAGCTGG + Intergenic
1095487458 12:42699812-42699834 TCTTCTGGGCTGTTGGATGGGGG + Intergenic
1096133014 12:49175592-49175614 TCTTCAGAGCAGTGGAAAGATGG + Intergenic
1096488929 12:52003173-52003195 TCTTGTGGGCGGTGGACAGCTGG - Intergenic
1096586677 12:52627283-52627305 ACTTCTGGCTACTGGGAAGCAGG - Intergenic
1096626100 12:52897107-52897129 TCTTCTTGGGACTGAGAAGCTGG - Intergenic
1097895842 12:64824505-64824527 GCTTCTGGGCACGGGGGAGCTGG + Intronic
1098110126 12:67112892-67112914 TCTCCTGGGCACTGTGAAGAGGG + Intergenic
1098357673 12:69626796-69626818 TTGTCTGTGCAGTGGGTAGCTGG - Intergenic
1100390002 12:94139903-94139925 TCTTGTGGGCAGGGGCAAGATGG + Intergenic
1100857208 12:98768059-98768081 CCTTCTGGGCAGTGAGAACTTGG - Intronic
1102004016 12:109577404-109577426 TCTCATGGGGAATGGGAAGCAGG - Intronic
1102924474 12:116816188-116816210 TCTCCTGGGTACTGGGGAGCAGG + Intronic
1103056667 12:117826441-117826463 GCTACTGGGCACTGGGAAGGAGG + Intronic
1103735723 12:123059585-123059607 TCTCTTGGACAGTGGGAAGCTGG + Intronic
1105346636 13:19578846-19578868 TCTTGTGGGGTGGGGGAAGCGGG + Intergenic
1105460683 13:20582790-20582812 TATTCTGGGTAGTGTGAAGTGGG + Intronic
1106435475 13:29719999-29720021 TGTCCTGGGCATTGGGGAGCTGG + Intergenic
1107881427 13:44835195-44835217 TGTTCTGAGCAGTTGGAAACTGG - Intergenic
1109510768 13:63369029-63369051 TGTTCTGGGGAGTGGGTGGCAGG + Intergenic
1109584707 13:64384210-64384232 TCTAATGGGCTGTGAGAAGCTGG - Intergenic
1109955865 13:69565128-69565150 TGTTTTGGTGAGTGGGAAGCAGG + Intergenic
1110543882 13:76735447-76735469 TGTTCTGGGCAGTGGGATGAAGG - Intergenic
1110627505 13:77668168-77668190 GCATCATGGCAGTGGGAAGCAGG + Intergenic
1110802194 13:79711687-79711709 TGTTCCAGGCAGAGGGAAGCAGG + Intergenic
1113074619 13:106455386-106455408 TCCCCTGGGCAGTGGGCAGTAGG - Intergenic
1113235863 13:108273076-108273098 ACTTCTGGGCTGTGGAAATCTGG - Intronic
1113800285 13:113082869-113082891 CCTGCTGGGCAGGTGGAAGCCGG + Intronic
1114815676 14:25955079-25955101 TCTGCTGGCCACTGGGTAGCAGG + Intergenic
1115271865 14:31561557-31561579 GCTGCAGGGCAGGGGGAAGCGGG + Intronic
1116760744 14:49010187-49010209 TTTCCTGGGCAGTGGGTATCGGG - Intergenic
1117561642 14:56946483-56946505 ACTGCTGGGAAGAGGGAAGCAGG - Intergenic
1117953620 14:61106363-61106385 TCTTCTGGGTAGTAGCAAGATGG + Intergenic
1118509283 14:66452990-66453012 TCTTCTGAGAAGTGGGAGGAGGG - Intergenic
1119372777 14:74161821-74161843 TCTTCTGTGCAGCGACAAGCAGG - Intronic
1119407673 14:74408765-74408787 TCTTCTGGGGAGTGGGCTGGGGG + Intronic
1119703773 14:76771704-76771726 TTTTCTGGGCATTGAGTAGCAGG + Intronic
1120307177 14:82785513-82785535 TTTTCGGGGCAGTCAGAAGCAGG + Intergenic
1121730012 14:96180199-96180221 TCTTCTGGCCAATGGGATGTAGG + Intergenic
1121786915 14:96668869-96668891 TCTCCTGGGCAGGAGGAAACTGG + Intergenic
1122069396 14:99195848-99195870 TCTTCTGGGCAGCAGGCAGGAGG - Intronic
1123802905 15:23840044-23840066 GCTGCTGGGCAGTAGGAAGGAGG + Intergenic
1125134790 15:36328829-36328851 TTTTCTGAGCTGTGGGCAGCAGG - Intergenic
1125680758 15:41528811-41528833 TTTTGTGAGCAGAGGGAAGCTGG + Intronic
1126638191 15:50799799-50799821 TCTTGTGGGGAGTGGGACTCGGG + Intergenic
1126744127 15:51807779-51807801 TCTCCTGGTCACTGGGAAGAGGG - Intronic
1126773283 15:52078372-52078394 TTTTCTGGTCTGAGGGAAGCTGG - Intergenic
1127621253 15:60736913-60736935 TCTTCGAGGCATTGGGAAGGTGG - Intronic
1127760720 15:62136875-62136897 GCTGATGGGCAATGGGAAGCAGG + Intergenic
1129144391 15:73633589-73633611 CTCTCTGGGCAGTGGGGAGCTGG + Intronic
1130359005 15:83163312-83163334 TCTTGCAGGCAGTGGGAAGGAGG - Intronic
1130883434 15:88074150-88074172 TCTTCTGTGAAGTGGGAAGTGGG - Intronic
1132643629 16:988998-989020 TCTCCTGGGCAGTGAGATTCGGG + Intergenic
1133097295 16:3456393-3456415 TCTTCTAGCCAGTGGGAAAGGGG + Intronic
1133157482 16:3885286-3885308 TATTTGGGGCAGTGGGAAGCAGG + Intergenic
1133988802 16:10689127-10689149 TCTTTTGGTCAGTGGTATGCTGG - Intronic
1134020346 16:10917124-10917146 TGTTCTGGGCTCTGGGAAGTTGG + Intronic
1134596092 16:15497121-15497143 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1134771782 16:16815374-16815396 TCTTCTGGACTCCGGGAAGCTGG - Intergenic
1136277736 16:29188887-29188909 GCTTCTGGGCAGTGGGGTGTGGG + Intergenic
1139287492 16:65828638-65828660 TGTGCTGGGCAGTAGGAAGATGG - Intergenic
1139372055 16:66475099-66475121 GCTTATGTGAAGTGGGAAGCAGG + Intronic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1140836197 16:78796420-78796442 AATTCTGGCCAATGGGAAGCAGG - Intronic
1141081470 16:81056817-81056839 CCTTCTGGGATGTGGCAAGCTGG + Intronic
1141480055 16:84300425-84300447 CCAGCTGGGGAGTGGGAAGCTGG - Intronic
1141723170 16:85768113-85768135 ACACCTGGGCAGAGGGAAGCAGG - Intergenic
1141884424 16:86881995-86882017 TCTGCTGTGCAGAGAGAAGCTGG - Intergenic
1142082110 16:88154929-88154951 GCTTCTGGGCAGTGGGGTGTGGG + Intergenic
1142155688 16:88531983-88532005 TCTTCTGTGGGGTGGGAAGCAGG - Exonic
1142761330 17:2043501-2043523 TTTTCTGGGCAGCGCCAAGCAGG + Intergenic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143260568 17:5595533-5595555 TCTGCTGGGCAATGGGAGGAAGG - Intronic
1143365453 17:6405622-6405644 GCTTGTGGGCAGAGGGAAGGAGG - Intronic
1143411116 17:6709661-6709683 TCTTCTGGGTGATGAGAAGCAGG - Intronic
1144232321 17:13220478-13220500 GCTTCTGGGAAGAGGGAGGCTGG + Intergenic
1144508184 17:15851473-15851495 TCTTCTGGGCAGTATGAGGCAGG - Intergenic
1144779328 17:17799952-17799974 CCCCATGGGCAGTGGGAAGCAGG - Intronic
1144993124 17:19247689-19247711 TTTTCTGGGTAGTAGGGAGCAGG + Intronic
1145172305 17:20669107-20669129 TCTTCTGGGCAGTATGAGGCAGG - Intergenic
1145202494 17:20959199-20959221 TCATCTGGGCAGTGTGAGGCAGG - Intergenic
1145251054 17:21297272-21297294 TCTTCTTGGCAGGCGGCAGCAGG + Intronic
1145269331 17:21396354-21396376 TCGTCTGCAAAGTGGGAAGCAGG - Intronic
1145823524 17:27858916-27858938 TCATCTGGGTAGAGGGTAGCTGG + Intronic
1146793355 17:35765217-35765239 TCCTCTGCGCAGTGGGCAGAAGG - Intronic
1146820791 17:35982447-35982469 TGTTGAGGGCAGTGGGAGGCAGG + Intergenic
1147623477 17:41883910-41883932 CCTGGTGGGCAGTGGAAAGCTGG - Intronic
1148454968 17:47806281-47806303 TCCTCTAGGCACTGGGAAGCAGG + Intergenic
1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG + Intergenic
1149460102 17:56821837-56821859 TGTTTTGGGCAGTGGGATGGTGG + Intronic
1150544956 17:66146675-66146697 TTATAGGGGCAGTGGGAAGCAGG - Intronic
1150707410 17:67499579-67499601 GCCTCTGGGCAGTAGGAAGTAGG - Intronic
1151433757 17:74081663-74081685 TATACTGGGCAGTGGGAACCAGG - Intergenic
1152929435 17:83102293-83102315 GCTTCAGGGCAGTAGGAAGGGGG + Intergenic
1153518683 18:5930953-5930975 TATTCTGAGCAGTGGAATGCTGG - Intergenic
1153799379 18:8656053-8656075 TCCTCTGGGCTGGGGGAACCAGG + Intergenic
1154201033 18:12301042-12301064 TCATCTGGCCAGTGGTGAGCTGG + Intergenic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1154390034 18:13928868-13928890 TCTTCATAGCAGTGGGAAGACGG + Intergenic
1155339586 18:24800341-24800363 TCTACTGGGCAGTGCCATGCTGG - Intergenic
1155911908 18:31513690-31513712 TCCTCAGGGCAGAGGGAAGCGGG - Intronic
1157815211 18:50725134-50725156 AGTTCTGGGCAGTGGGAACCTGG - Intronic
1159682900 18:71377198-71377220 TCTTCAGGGAAATTGGAAGCAGG - Intergenic
1160162691 18:76486704-76486726 TCTTCAAGGCAGAGGGAATCTGG - Intronic
1160442580 18:78903672-78903694 TCTTCTGAGCAGTTGGAGGCAGG + Intergenic
1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG + Intronic
1161497111 19:4592722-4592744 TGTGCTGGGCTCTGGGAAGCTGG - Intergenic
1161723022 19:5914162-5914184 TGTGCTGGGCAGTGGGGAGTGGG - Exonic
1161933490 19:7356719-7356741 TCATATGGGCAGTGGGGAGCCGG - Intronic
1162100958 19:8338372-8338394 CCTGCTGGGCAGGAGGAAGCAGG + Intronic
1162128287 19:8511052-8511074 TCTTCTGGGCTGGGGGAGCCCGG - Intronic
1162412887 19:10517242-10517264 GCCTCTGGGGAGGGGGAAGCTGG - Intronic
1163298911 19:16430640-16430662 TGTGCTGGGCAGTGGGAAGGTGG - Intronic
1163826891 19:19528993-19529015 TCAGCTGGGGAGAGGGAAGCTGG + Intronic
1164767671 19:30784237-30784259 TCTCCAAGTCAGTGGGAAGCAGG - Intergenic
1164832291 19:31331919-31331941 TCTTCTGGGCAGGGGCAAGGAGG + Intronic
1165819410 19:38665159-38665181 AGTTCTGGGCAGTGGGGAGTGGG - Intronic
1166062914 19:40337922-40337944 GCTTCTGGTCAGTGGGACCCAGG - Intronic
1166169726 19:41019252-41019274 GCCTGTGGCCAGTGGGAAGCTGG + Intergenic
1166966483 19:46532155-46532177 CCTGCTGTGCAGTGGGAAGTAGG - Intronic
1168201395 19:54818244-54818266 TCTTCTGGGCACTGGGAGTGAGG + Intronic
925277708 2:2662208-2662230 TCTTCTGGGCAGTGAGCACTGGG - Intergenic
927069254 2:19508839-19508861 TCTTCTACGGAGGGGGAAGCTGG - Intergenic
927293104 2:21423609-21423631 TCCTGTGGTCAATGGGAAGCTGG + Intergenic
927577628 2:24212653-24212675 TCTGATGAGCAGTGGGTAGCGGG + Exonic
928108210 2:28486477-28486499 TCTGCAGGGCAGTGGGAAGCTGG + Intronic
928978091 2:37109903-37109925 TCTTCTGATCAGTGGGGAGGAGG + Intronic
929713888 2:44291811-44291833 TTATCTGCACAGTGGGAAGCTGG + Intronic
929936347 2:46297110-46297132 TCGTCTGGGCGGCGGGTAGCGGG - Intronic
933650011 2:84843009-84843031 TCTCCTGGGCACTGGAGAGCTGG + Intronic
933984613 2:87580453-87580475 TCGTGTGGGCAATGGGAAGGTGG - Intergenic
936018891 2:108979898-108979920 ACTGCTGGGCGGTGGGAAGCAGG + Intronic
936153275 2:110033086-110033108 CCTCCTGGGCAGTGGAAACCTGG + Intergenic
936191406 2:110338329-110338351 CCTCCTGGGCAGTGGAAACCTGG - Intergenic
936309238 2:111370347-111370369 TCGTGTGGGCAATGGGAAGGTGG + Intergenic
938248463 2:129796476-129796498 CCTTCACTGCAGTGGGAAGCTGG - Intergenic
938838272 2:135130963-135130985 CTGTCTGGGCAGTGGGAATCAGG + Intronic
939308330 2:140437797-140437819 ACTTCAGGACAGTGGGAAGAAGG + Intronic
939848283 2:147274110-147274132 TCTTCTGCTCTGAGGGAAGCTGG - Intergenic
940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG + Exonic
940667634 2:156628094-156628116 ACTTCTGTGCAGTGGGGTGCTGG + Intergenic
941007582 2:160263369-160263391 CCTCATGGGCAGTGGGGAGCTGG - Intronic
945279934 2:208026441-208026463 TCTTCTGGAGGGTGGGAAGGTGG - Intergenic
946479484 2:220040447-220040469 TGTCCTGGGCAGTGCGGAGCTGG + Intergenic
947098746 2:226595654-226595676 TCTTGGGGGCAGTGGGATGATGG + Intergenic
948181058 2:235980782-235980804 TCTTTTGGGCACAGGGTAGCAGG - Intronic
948447817 2:238046650-238046672 TCTTCAGGGCAGTGGCTGGCAGG - Intronic
1168965113 20:1894299-1894321 GCCTCTCGCCAGTGGGAAGCGGG + Exonic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169141678 20:3230344-3230366 TCTTCCTGGCAGGGGGAGGCAGG - Intronic
1170091470 20:12593691-12593713 TATTCTGAGACGTGGGAAGCAGG - Intergenic
1170582873 20:17712026-17712048 TCTTCAAGGCAGTGGGGAGAGGG + Intronic
1171233045 20:23502543-23502565 TCTTATGTGCAGCAGGAAGCAGG - Intergenic
1171460954 20:25297635-25297657 TCTCTTGGGCAATGGGAGGCAGG - Exonic
1172285902 20:33740244-33740266 TATTCTGGGAAGTGGAAAGGAGG + Intronic
1172480632 20:35269400-35269422 TCCTCGGGACAGTGGGAGGCTGG - Intronic
1172897236 20:38308948-38308970 TTATCTGGGAACTGGGAAGCTGG - Exonic
1173255586 20:41392407-41392429 TCTTCTGGGCCTGGTGAAGCTGG - Intergenic
1173617144 20:44410712-44410734 TCTTCTGTAAAGTGGGGAGCAGG - Intronic
1175174902 20:57105475-57105497 TGTGCCGGGCAGTGGGAAGTCGG - Intergenic
1175225107 20:57440039-57440061 TATTCTGAGCAGCGGGAAGCTGG - Intergenic
1175258547 20:57661399-57661421 TGTCCTGGGCAGGGCGAAGCTGG - Intronic
1178835486 21:36094041-36094063 CTTTCTGTGCAGTGAGAAGCGGG + Intergenic
1179093774 21:38293218-38293240 CCTTCTGGTAAGTGGGAAGAAGG - Intronic
1180012063 21:45058070-45058092 TCCGCTGGGCTGTGGGAAGCAGG + Intergenic
1180618741 22:17146066-17146088 TTCTCAGGGCAGTGGAAAGCAGG - Intronic
1180750948 22:18123931-18123953 TCATGTGGGCGGTGAGAAGCAGG - Intronic
1180959770 22:19757246-19757268 TCTTCTCTGCTGTGGCAAGCTGG + Intronic
1181865708 22:25853332-25853354 TCTTCTTTGCAGTGGGTACCAGG + Intronic
1181906217 22:26198940-26198962 TGTTCTGGCCAATGGGAAGCTGG + Intronic
1182423553 22:30260195-30260217 TCTCCTGGGCAGTGAGAGGTAGG + Intergenic
1182469940 22:30542346-30542368 GCCTCTCGCCAGTGGGAAGCGGG + Intronic
1183271136 22:36863203-36863225 TGTTCTGGGCACTGGGATGTAGG + Intronic
1185132141 22:49045260-49045282 TCTTCTTGACAGTGGGACCCAGG - Intergenic
1185248765 22:49788436-49788458 ACTTCTGTGCTGTGGGGAGCGGG - Intronic
950100514 3:10353778-10353800 TCTTCTGTGCAGTGGAGAGAGGG + Intronic
950131709 3:10551855-10551877 CTTCCTGGGCTGTGGGAAGCAGG + Intronic
950657817 3:14447913-14447935 TCTTCGGGGGAGTGGGAGGAGGG + Intronic
952171866 3:30815974-30815996 TCGTCTGTACAGTGGGAAGGGGG + Intronic
953982253 3:47418706-47418728 CCTGCTGGGCACTGGGAAGCAGG - Exonic
954286742 3:49624853-49624875 TCTTCTGGGCAGGAGGAAGAGGG + Intronic
954290555 3:49647781-49647803 TCTTCTGGGGAATGAGAATCGGG - Intronic
954510747 3:51122763-51122785 TCTTCTGGGCAGTGGGAAGCTGG - Intronic
954665462 3:52249087-52249109 CTTTCTGGGCAGATGGAAGCTGG - Intronic
954792081 3:53141066-53141088 CCTTCTGGCCACTGGGTAGCAGG - Intergenic
954860968 3:53690174-53690196 TTTTCTCGTCAGTTGGAAGCTGG + Intronic
955750361 3:62180346-62180368 TTGTCTCAGCAGTGGGAAGCAGG + Intronic
955840048 3:63103016-63103038 TCTTCTTGGTAATGGGAAGGGGG - Intergenic
961011385 3:123438521-123438543 TGTCCTGGGCAGGGTGAAGCAGG - Intronic
961056624 3:123794134-123794156 TCTTCTAGGAAAGGGGAAGCTGG + Intronic
961330515 3:126135471-126135493 GCTTCTGGGCAGTGGCACGGGGG - Intronic
962254776 3:133862817-133862839 TGTTCTTGGCAGTGGCAAGGGGG - Intronic
962678897 3:137778490-137778512 TCGTCTGGGCAGGAGAAAGCAGG + Intergenic
963427523 3:145151048-145151070 TCTTCTGGGCTGAGGGCAGTTGG + Intergenic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
968867608 4:3223723-3223745 CCTCCTGGTCAGTGAGAAGCTGG + Intronic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969157685 4:5225881-5225903 TGTGCTGCACAGTGGGAAGCAGG + Intronic
969636766 4:8373974-8373996 GCTCCTGGGCAGAGTGAAGCAGG + Intronic
969648431 4:8447897-8447919 TCTTGGGGGCAGTGGGCACCTGG + Intronic
970533814 4:17009007-17009029 TCATCTCTGCACTGGGAAGCAGG + Intergenic
970570117 4:17371867-17371889 TGTTCCAGGCAGAGGGAAGCTGG - Intergenic
973281021 4:48361480-48361502 TCTTAAGGGCAGAGGGAAACTGG + Intronic
974124374 4:57677522-57677544 TTTTCTGTGCAGTGAGCAGCAGG + Intergenic
974665588 4:64957117-64957139 TCTTGTGGGGAGTGGGGAGGGGG - Intergenic
975893190 4:79053717-79053739 ACCTCTGGGCAGTTGGAAGAGGG + Intergenic
977486046 4:97647789-97647811 TGTTCTGGGCAGAGGGAAACAGG + Intronic
977786601 4:101042342-101042364 TTTTCAGGGCAGAGGGAAGGTGG - Intronic
977868025 4:102053226-102053248 TCTTTGGAGAAGTGGGAAGCTGG + Intronic
977895400 4:102358888-102358910 TCTTCTGGGGAGTGGAGAGTGGG - Intronic
978287832 4:107099222-107099244 CCTTCAGGGCAGTGGGGTGCAGG - Intronic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
979171876 4:117610492-117610514 TCTTCTGTGCAGCAGGATGCTGG - Intergenic
979615015 4:122732824-122732846 GCGTCTGGCCGGTGGGAAGCCGG + Exonic
984417360 4:179478353-179478375 CATTAAGGGCAGTGGGAAGCAGG + Intergenic
985029800 4:185778186-185778208 TCTACTGGGCAGTGCCATGCAGG + Intronic
985048303 4:185964634-185964656 TCTTCTGGGCAATAGGTAGGAGG + Intergenic
985280656 4:188282993-188283015 TCTCCTCCGCAGTAGGAAGCAGG + Intergenic
985478729 5:94105-94127 GCTTCTTGGCAGTGAGATGCTGG - Intergenic
987923372 5:24311314-24311336 TCTTTTGGGAAATGGGAAGAGGG - Intergenic
989178580 5:38554934-38554956 TCTTCTGGGGAATGAGAATCAGG - Intronic
989581763 5:43040013-43040035 TTTTCTTGGCTGTGTGAAGCGGG - Exonic
990172026 5:53062200-53062222 TTTTCTAGGCAGAGGGAAGTGGG - Intronic
990537013 5:56733002-56733024 TATTCCAGGCAGGGGGAAGCTGG - Intergenic
990966243 5:61451110-61451132 TCTTCTGTGCAGTTGTAAGCAGG - Intronic
992366092 5:76091447-76091469 CATTCTGGGCAGTGAGAGGCAGG - Intronic
992390592 5:76327267-76327289 TGTTGGGGGCAGTGGGAAGAGGG + Exonic
996790522 5:127289453-127289475 TCTTCTGGACAGGGAAAAGCTGG + Intergenic
997579481 5:135008254-135008276 TCATCTGGGCCTAGGGAAGCTGG + Intronic
997598997 5:135126790-135126812 TTTCCTGGGCAGTGGGCGGCGGG + Intronic
998024598 5:138804475-138804497 CTTGCTGGGCAGTGGGAAGCAGG - Intronic
998131324 5:139652520-139652542 TGTTCTGGGATGTGGGAATCTGG + Intronic
998352348 5:141509675-141509697 TCTTCTGTACAGTGGGACGTTGG + Intronic
1001304242 5:170560136-170560158 TTTTCTGGGCAGTGTGGGGCAGG + Intronic
1001320757 5:170679098-170679120 TCTTCTGGGCAGATGGGATCTGG + Intronic
1001960995 5:175880349-175880371 TCCTCCTGGCAGTGGGGAGCAGG - Exonic
1002553811 5:180018713-180018735 TTTTCTGAGCAGTGGGCAGGGGG - Intronic
1002593268 5:180305603-180305625 TCCTCTGGTCACTGGGAGGCCGG - Intronic
1003284044 6:4718625-4718647 ACTTCTGGCTAGTGGGAATCTGG - Intronic
1006563590 6:34935065-34935087 TCTTCTGGACAGTGATAGGCTGG + Intronic
1006793485 6:36718141-36718163 TGTCCCGGGCAGTGGGAAGGAGG - Intronic
1007558479 6:42785697-42785719 TCTTCTGGGTTTTGGGAAGTAGG + Intronic
1007935459 6:45728344-45728366 TGTTCTGGGCAGAGGAAAGGAGG + Intergenic
1008463168 6:51799745-51799767 TCTTTTGAGGAGTGGAAAGCTGG + Intronic
1009226927 6:61028721-61028743 TGTTGTGGGGTGTGGGAAGCAGG + Intergenic
1011490025 6:87882153-87882175 TTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1014097745 6:117479011-117479033 TCTGGGGGGTAGTGGGAAGCAGG - Intronic
1014221179 6:118800307-118800329 TCTTTTGGGAGGTGGGGAGCAGG - Intergenic
1014910946 6:127092216-127092238 TCTGCTGGGCTGTGGCAAGTGGG - Intergenic
1017160936 6:151365592-151365614 TCTCCTGGGCAGTGGGGACTCGG - Exonic
1017475866 6:154791972-154791994 TCTGCTTGCCAGTGGCAAGCAGG + Intronic
1017913351 6:158813945-158813967 TCTTCTGCCCAGTGGAAAGAAGG - Intronic
1017992297 6:159502005-159502027 TCTGCAGAGAAGTGGGAAGCAGG - Intergenic
1019478786 7:1256630-1256652 TCTCCTGGTCCGTGGGAAGGTGG + Intergenic
1019625501 7:2013853-2013875 TCACCTGTGCAGTGGGAAGAAGG - Intronic
1019749293 7:2718739-2718761 TCTTGTGGTCAGGGAGAAGCGGG + Intronic
1021446142 7:20735739-20735761 TCTTCCTTGCAGTGGAAAGCTGG - Intronic
1021849086 7:24790460-24790482 TTTTATGGGCAGTAGGAAGAAGG + Intergenic
1022359556 7:29644953-29644975 TCTTCTTGGCATTGGCAGGCCGG + Intergenic
1024062519 7:45709614-45709636 CATCCTGGGCAGTGGGGAGCTGG - Intronic
1024229905 7:47355854-47355876 TCTGCTGGGAAGTGGGATGAGGG + Intronic
1024479388 7:49848350-49848372 TCCTCTTGTCAGTGGGGAGCAGG - Intronic
1026388262 7:69873750-69873772 TCTTCTGGGAGGTGAGAAGTTGG - Intronic
1026396853 7:69964174-69964196 TCTTCTATGCAGTGGCATGCTGG + Intronic
1027901429 7:84120920-84120942 TCCACTGGGCATTGGGAAGAGGG + Intronic
1029021844 7:97372325-97372347 CCTTCTGTGCAGTGAGCAGCAGG + Intergenic
1029693448 7:102197767-102197789 TCTTCTGCGGGGTGGGAAGAGGG - Intronic
1029705389 7:102273208-102273230 TCTTCTAGGCAGTGGTGAGTTGG + Intronic
1032141406 7:129334249-129334271 TAATCTGGGCTGTGGGAAGATGG + Intronic
1032320984 7:130886538-130886560 TCTTCTCTGCAGTGGCAGGCTGG - Intergenic
1032501029 7:132400002-132400024 TCTTCTGGGCATTTGTAAGTTGG + Intronic
1032520629 7:132541256-132541278 TCTTATGGGGAGGGGGAAGCTGG - Intronic
1033085853 7:138341215-138341237 TCTTTTGGGAAATGGGAAGAGGG + Intergenic
1034071682 7:148192042-148192064 GCTTCTGAGGAGTGGGAAGTGGG + Intronic
1034558881 7:151867098-151867120 TGCTGTGGGCAGTGGGACGCTGG + Intronic
1035246936 7:157568763-157568785 TCTGCTGGGCCGTAGGAAGGTGG - Intronic
1036658707 8:10693820-10693842 TCTTCTGGGCAGTGCACAGAAGG - Intronic
1037386263 8:18345534-18345556 TCCTATGGGCAGGGGGAAGGAGG + Intergenic
1037780430 8:21864750-21864772 CCTTCAGAGCAGTGGGAAGAAGG + Intergenic
1040097937 8:43466333-43466355 TCTTCAGGGCGGTGGGACTCTGG + Intergenic
1040791923 8:51240743-51240765 TATTCTGGGCAGTATGCAGCAGG + Intergenic
1041113162 8:54506699-54506721 TCTGCTGTCCAGGGGGAAGCAGG + Intergenic
1041659835 8:60391073-60391095 TCTTCTGGGCATAGAGAAGTGGG + Intergenic
1042264209 8:66892030-66892052 TCTGCTGAGCTGTGGGCAGCAGG - Intronic
1044014007 8:87028463-87028485 CCTTCTGTGCAGTGAGCAGCAGG - Intronic
1044813692 8:96089394-96089416 TCCTATGGGCAGAGGGAAGTGGG - Intergenic
1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG + Intergenic
1047317382 8:123747064-123747086 TCTTCTAGGCATTGGGGATCTGG + Intergenic
1047355970 8:124122214-124122236 TGTTCTGGGCAGTGGGGATACGG + Intergenic
1047754856 8:127910651-127910673 ACTTCTGGGCAGTGCGAATTTGG + Intergenic
1049365242 8:142233901-142233923 GATTCTGTGCAGGGGGAAGCTGG - Intronic
1049975550 9:858199-858221 TCATGTGGCCAGTGGGAAGAGGG + Intronic
1054980166 9:71197016-71197038 TCTTGTGGGGTGTGGGAAGTCGG - Intronic
1055489217 9:76787795-76787817 TCCTGTGGGCAGTGGGAGGCGGG - Intronic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057081677 9:92178425-92178447 TCTTCAGGGTGGTGGGAGGCAGG + Intergenic
1059049579 9:110909257-110909279 CTTTCTGTGCAGTGGGCAGCAGG + Intronic
1059555344 9:115275574-115275596 TGTGCTGGGCTGTGTGAAGCTGG + Intronic
1061052366 9:128204105-128204127 TCTTCTAGGGACTGGGATGCGGG - Intronic
1061679690 9:132236808-132236830 GATTCTGGGCAGTGGAAGGCAGG + Intronic
1061986729 9:134134578-134134600 AATTGAGGGCAGTGGGAAGCTGG + Intergenic
1062002842 9:134225457-134225479 TCTGCTGGGCAGTGGGAGGTGGG + Intergenic
1185715528 X:2338934-2338956 TCATATGGGGAGTGGGAAGTAGG - Intronic
1186776881 X:12873666-12873688 TCTTCTGGGCAGTGGTATAAAGG - Intronic
1187479583 X:19643027-19643049 TCTTCTGGCCAGAAGGAAGAGGG + Intronic
1187715247 X:22096107-22096129 TCATGTGTGCAGTGGGAAGGTGG + Intronic
1187807210 X:23133721-23133743 TGTTCTGGGCAGCCGGAAGAAGG - Intergenic
1187948028 X:24445545-24445567 TCTTCTGGGGCATGGGAGGCTGG + Intergenic
1188043294 X:25395783-25395805 TATTCTGGGCAGTGTGAATCAGG + Intergenic
1190141204 X:47846716-47846738 GCTTCTGGGCAGCTGGAATCTGG - Intronic
1190556488 X:51641031-51641053 ACTTCTGTGCAGTGGGGATCTGG - Intergenic
1191663335 X:63672656-63672678 TCTTCTAGGCATTGGGAAGTTGG + Intronic
1195108489 X:101623191-101623213 CCCTCAGGGCAGTGGGGAGCTGG - Exonic
1196246488 X:113405682-113405704 TCTTCTGGACACTGGGACACTGG + Intergenic
1198369770 X:135979147-135979169 TTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1200102865 X:153696717-153696739 CCTTCTGGGGACTGGGAAGGGGG + Intergenic
1200267871 X:154655497-154655519 CCTTCTGGGGACTGGGAAGGGGG + Intergenic
1202047002 Y:20745306-20745328 TCCTTTGGGCAGTCAGAAGCAGG - Intergenic