ID: 954510786

View in Genome Browser
Species Human (GRCh38)
Location 3:51123102-51123124
Sequence GGTTATGGCTGACCACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954510786_954510790 4 Left 954510786 3:51123102-51123124 CCAGGGTGTGGTCAGCCATAACC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 954510790 3:51123129-51123151 CGTAGCTTCATTCCACTGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 79
954510786_954510791 5 Left 954510786 3:51123102-51123124 CCAGGGTGTGGTCAGCCATAACC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 954510791 3:51123130-51123152 GTAGCTTCATTCCACTGCCCGGG 0: 1
1: 0
2: 2
3: 18
4: 145
954510786_954510796 28 Left 954510786 3:51123102-51123124 CCAGGGTGTGGTCAGCCATAACC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 954510796 3:51123153-51123175 AGGATAATTCAGCCTACCCATGG 0: 1
1: 0
2: 0
3: 5
4: 82
954510786_954510792 8 Left 954510786 3:51123102-51123124 CCAGGGTGTGGTCAGCCATAACC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 954510792 3:51123133-51123155 GCTTCATTCCACTGCCCGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954510786 Original CRISPR GGTTATGGCTGACCACACCC TGG (reversed) Intronic
905401630 1:37707888-37707910 GATGATGGCTGACCAGACCAAGG - Intronic
909494616 1:76264665-76264687 GATTATGTCTGAACAAACCCAGG - Intronic
912419353 1:109532674-109532696 GGTGAGGGCTGACCACCTCCCGG + Intergenic
915431219 1:155868485-155868507 AGTGATGGATGACCAGACCCAGG + Exonic
1068876609 10:62003517-62003539 GGTAATGGCTGCCTTCACCCTGG + Intronic
1068994513 10:63187501-63187523 GATCATGGCTCACCACAGCCTGG + Intronic
1070915243 10:80149915-80149937 GATTATGGCTCACTACAGCCTGG + Intergenic
1072759032 10:98040697-98040719 GATCATGGCTCACCACAGCCTGG - Intergenic
1077037771 11:503561-503583 GAATTTGGGTGACCACACCCTGG - Exonic
1078131526 11:8618181-8618203 GGGGATGGCTGGCCAGACCCTGG + Intronic
1083184454 11:61009074-61009096 GGCTAAGGCTGACCACCTCCCGG + Intronic
1083412917 11:62506141-62506163 GATCATGGCTCACCACAGCCTGG - Intronic
1086333478 11:85776958-85776980 GGTTAAGTCTTACCTCACCCTGG - Intronic
1089527860 11:119108492-119108514 GGATCTGCCTGACCACACCAGGG - Intronic
1103518142 12:121520743-121520765 GGTTTTGGCTGCCCCCAACCTGG + Intronic
1107993926 13:45842407-45842429 AGTCATGGCTCACCACAGCCTGG + Intronic
1108500387 13:51065063-51065085 GGTGTTTGCTGCCCACACCCAGG + Intergenic
1110132087 13:72021696-72021718 GGGTATGCCTGAGCACACACCGG - Intergenic
1114257429 14:21015409-21015431 GGTGTTGGGTGACCACACGCAGG - Intergenic
1115223795 14:31083568-31083590 GATCATGGCTCACTACACCCTGG + Intronic
1122043518 14:99007356-99007378 GATCTTGGCTGGCCACACCCTGG - Intergenic
1129332702 15:74835903-74835925 GGTCATTGCTGCCCACACCCAGG - Intergenic
1132813935 16:1817123-1817145 GGTTAAGGCCCCCCACACCCCGG + Intronic
1133678333 16:8096921-8096943 GGCCATAGCTGACCACACCGAGG - Intergenic
1135604214 16:23809173-23809195 GTTTATGGCTGTGCACACCCAGG - Intergenic
1138549723 16:57740770-57740792 GGTGAGGGCTGACCACACAGAGG - Intronic
1143318273 17:6049481-6049503 GGTTATCTCTGACCATACCTGGG + Intronic
1146852893 17:36238676-36238698 GGTCATGGCTCACCACAGCTTGG - Intronic
1148885414 17:50768590-50768612 TTTTATGGCGGACCACACCCTGG - Intergenic
1149406384 17:56356128-56356150 GCTAATGGCAGACCCCACCCAGG + Intronic
1151014497 17:70538608-70538630 GGTTATGGCTCACTGCAGCCTGG + Intergenic
1153560954 18:6371234-6371256 GGCTATGGCTTGCCACCCCCTGG + Intronic
1165009016 19:32829962-32829984 GATGATGGCTCACTACACCCTGG + Intergenic
1166537101 19:43581164-43581186 AGTGCTGGCTGACCACTCCCTGG - Exonic
1166765353 19:45249681-45249703 GATTATGGCTCACCGCAGCCTGG - Intronic
1167071979 19:47227017-47227039 CGTTAAGCCTGACCACCCCCGGG - Intronic
1167349909 19:48968106-48968128 TGTCATGTCTGACCACACCTGGG + Exonic
1168264793 19:55216867-55216889 GGTCCTGGCTGGCCCCACCCAGG - Intergenic
930523368 2:52496174-52496196 GGTGATTGCTGACCATACCTGGG - Intergenic
938376080 2:130807738-130807760 GGCTATGGCTGACTGCACCAAGG + Intergenic
942742062 2:179192580-179192602 GGCTATGGCTGAGTAGACCCTGG - Intronic
947481071 2:230500540-230500562 GGCTAGGGCTGAACATACCCAGG + Intronic
947789585 2:232856754-232856776 GGCTATGAGTGACCACACCCAGG - Intronic
947791411 2:232871369-232871391 GGTCAAGACTGAGCACACCCTGG - Intronic
1169194124 20:3674218-3674240 CATTGTGGCAGACCACACCCTGG - Exonic
1171721150 20:28564373-28564395 AGTTATTGCTGACCACATACTGG - Intergenic
1173854270 20:46240020-46240042 GGGTATGACTGCACACACCCAGG - Intronic
1174398361 20:50261707-50261729 GCTTAGGCCTGGCCACACCCTGG + Intergenic
1179436158 21:41363602-41363624 GGTCATGGCTGACCAAGCACTGG - Intronic
1181683235 22:24510591-24510613 GGTAAGGGCTGCCCACAGCCAGG + Intronic
1183457809 22:37932374-37932396 GGTTGTGGCTGTCCCCACACTGG + Intronic
1184892268 22:47387315-47387337 GGTCGTGGCTGTCCCCACCCAGG - Intergenic
1184978919 22:48082254-48082276 GGTGATGACTGACCACAGCAAGG + Intergenic
1185415151 22:50705594-50705616 TGGCTTGGCTGACCACACCCTGG + Intergenic
954510786 3:51123102-51123124 GGTTATGGCTGACCACACCCTGG - Intronic
958762204 3:98322629-98322651 GGTTATGGCTGGCAAGACACTGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
966396696 3:179511046-179511068 GGGTATGGCTGACCATCCCTGGG + Intergenic
967119700 3:186371773-186371795 GGTTATGGTTGAACATTCCCTGG + Intergenic
990640721 5:57780629-57780651 TCTGAGGGCTGACCACACCCTGG - Intergenic
999115645 5:149161061-149161083 GGATGTGGCTGCCCTCACCCAGG + Intronic
1001302991 5:170551208-170551230 GGCTTTGGCTGATCTCACCCTGG + Intronic
1005111448 6:22286177-22286199 GGTCATGGCTGACCCCTTCCCGG - Intergenic
1014057056 6:117028284-117028306 GGATATGCCTGATGACACCCAGG - Intergenic
1016197518 6:141363673-141363695 GGTGAGGGCTTACCACACACAGG - Intergenic
1021815090 7:24438990-24439012 GGTTATGGCTGAAAACTCCCTGG + Intergenic
1026157314 7:67837938-67837960 GGTGATGGCTGAGCACAGCTTGG - Intergenic
1026250584 7:68666540-68666562 GGGTATGGGATACCACACCCTGG + Intergenic
1026910756 7:74090538-74090560 GTGCATGGCTGACCACAGCCAGG + Intronic
1030644749 7:112047756-112047778 GATTATAGCTCACCACAGCCTGG + Intronic
1035245598 7:157560446-157560468 GGGCGTGGCTGACCCCACCCAGG - Intronic
1035723270 8:1808984-1809006 AATTATGGCTCACCACAGCCTGG + Intergenic
1038376712 8:27047388-27047410 GGCTATGGCTGACTTCATCCAGG - Intergenic
1038404105 8:27309166-27309188 GGTCAGGGCTGAGAACACCCAGG - Intronic
1048428068 8:134341082-134341104 GGCTATGGCTGACCACAGGAGGG - Intergenic
1049175287 8:141188994-141189016 GGTGATGGCCGACCAGAACCAGG + Exonic
1049349674 8:142157798-142157820 GGTTGGTGTTGACCACACCCTGG + Intergenic
1057756766 9:97845405-97845427 GCTTGTGGCTGACCACACTGAGG - Intergenic
1060545870 9:124458627-124458649 GATGATGGCTGACCCCACCTGGG - Exonic
1061161740 9:128899347-128899369 GGGCATTTCTGACCACACCCAGG + Intronic
1062716576 9:138013430-138013452 GGCTGTGCCTGGCCACACCCTGG - Intronic
1188511097 X:30937410-30937432 GGCTCTGGCTGGACACACCCAGG + Intronic
1190265133 X:48823587-48823609 AGGTAAGGCTCACCACACCCAGG + Exonic
1197778119 X:130133692-130133714 GATCATGGCTCACCACAGCCTGG + Intronic