ID: 954510787

View in Genome Browser
Species Human (GRCh38)
Location 3:51123117-51123139
Sequence ATGAAGCTACGGACTGGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954510787_954510791 -10 Left 954510787 3:51123117-51123139 CCATAACCAGTCCGTAGCTTCAT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 954510791 3:51123130-51123152 GTAGCTTCATTCCACTGCCCGGG 0: 1
1: 0
2: 2
3: 18
4: 145
954510787_954510796 13 Left 954510787 3:51123117-51123139 CCATAACCAGTCCGTAGCTTCAT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 954510796 3:51123153-51123175 AGGATAATTCAGCCTACCCATGG 0: 1
1: 0
2: 0
3: 5
4: 82
954510787_954510792 -7 Left 954510787 3:51123117-51123139 CCATAACCAGTCCGTAGCTTCAT 0: 1
1: 0
2: 0
3: 3
4: 38
Right 954510792 3:51123133-51123155 GCTTCATTCCACTGCCCGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954510787 Original CRISPR ATGAAGCTACGGACTGGTTA TGG (reversed) Intronic
905562690 1:38940103-38940125 ATGAAGATACAAACAGGTTAAGG - Intronic
912204493 1:107494927-107494949 ATGTAGCTGCGGGCTGTTTATGG - Intergenic
915978429 1:160405642-160405664 ATGAAGCTGGGGGCTGGGTAGGG + Intronic
923744759 1:236690010-236690032 ATCAAGCCACGGACTGATTATGG - Intronic
1069232760 10:66032497-66032519 TTGAAGCTACGGTCTCCTTAAGG + Intronic
1073415045 10:103373971-103373993 ATGAAGCTGGGAATTGGTTAGGG + Intronic
1080791144 11:35523789-35523811 ATGAAGCTGCGCTCTGGTTCAGG + Intronic
1081476666 11:43439759-43439781 ATGAAGCTACGGGCTGGGTGCGG - Intronic
1087993141 11:104770674-104770696 ATCAAGCTAGGAACTGTTTAGGG - Intergenic
1097711082 12:62918166-62918188 CTGAAGCCACAGACTGGCTAGGG + Intronic
1099579099 12:84419172-84419194 ATTAAGCTACGCAGTGCTTAAGG + Intergenic
1111525829 13:89467579-89467601 ATGAAGCTGGGAACTGGCTAGGG - Intergenic
1124223476 15:27869806-27869828 ATGAAGCTGAGGATTGGGTAAGG + Intronic
1127060081 15:55173426-55173448 ATAAAGTTAAGGACTGATTAAGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1134288737 16:12885926-12885948 ATGAAGCTAAGGAATGTTGATGG - Intergenic
1140631146 16:76854089-76854111 ATGAAGCTTCCCACTGGTAATGG - Intergenic
1140721846 16:77779253-77779275 ATGAAGCAACGGAAAGATTAAGG + Intergenic
1158938859 18:62388594-62388616 AAGGAGCTACTCACTGGTTAGGG - Exonic
1202675096 1_KI270710v1_random:36286-36308 ATGAATCTACGTACTTCTTAAGG - Intergenic
926007302 2:9382391-9382413 ATGTAGCTACTATCTGGTTATGG + Intronic
940148701 2:150575840-150575862 ATGAAGGTACACACTAGTTAGGG - Intergenic
1170643133 20:18173668-18173690 ATGATGTCAGGGACTGGTTAAGG - Intronic
1175530524 20:59671746-59671768 ATGAAGGAACGGACTGGCCATGG + Intronic
1179237021 21:39556601-39556623 ATGAAGCAACGGTATGGTTTAGG - Intronic
1184203263 22:42983926-42983948 AAGAAGCTACGCACAGGCTATGG + Intronic
954510787 3:51123117-51123139 ATGAAGCTACGGACTGGTTATGG - Intronic
988135290 5:27162408-27162430 ATTATGCTACGGTCTGATTAAGG - Intergenic
988536413 5:32072936-32072958 ATGAAGCTAGGGCCTGGTGAGGG - Intronic
1003721917 6:8713086-8713108 ATGAAGCTATGAACTGTTTTGGG + Intergenic
1019197870 6:170292421-170292443 ATGAAGCTACGGAGGTGTTGGGG - Intergenic
1028950489 7:96630116-96630138 CTGCAGCCAAGGACTGGTTATGG - Intronic
1029241630 7:99167299-99167321 ATCAGGCTACGGACTGGTCTAGG - Intergenic
1046221891 8:111227538-111227560 CTGAAGCTACGAACTGCCTAGGG + Intergenic
1050545605 9:6706320-6706342 CTGAAGCTAGGAACTGCTTAGGG - Intergenic
1057875035 9:98747438-98747460 AGGGGGCTAAGGACTGGTTAAGG - Intronic
1062433928 9:136538157-136538179 AGGGAGCTAAGGACTGGTTTGGG - Intronic
1187460205 X:19479618-19479640 ATGAAGCTACGCAATGCCTATGG + Intronic
1192245220 X:69366429-69366451 ATCAGGCTCAGGACTGGTTAAGG + Intergenic
1200822327 Y:7599649-7599671 ATGAAGATACGGCATTGTTAAGG - Intergenic
1202149717 Y:21833717-21833739 GTGAAGATACAGACTGGTGAAGG + Intergenic
1202237974 Y:22734368-22734390 ATGAAGATACGGCATTGTTAAGG + Intergenic