ID: 954520286

View in Genome Browser
Species Human (GRCh38)
Location 3:51219078-51219100
Sequence GAGTCAGAGGGTCCTCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954520286 Original CRISPR GAGTCAGAGGGTCCTCTAAA AGG (reversed) Intronic
901227617 1:7623350-7623372 GAGGCAGCTGTTCCTCTAAAAGG + Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
905749640 1:40450924-40450946 AAGACAGAGGGTCCTCAGAAAGG + Exonic
924633163 1:245761378-245761400 CAGTAAGAGGGTCATCTGAAGGG + Intronic
1064677965 10:17780823-17780845 GAGACAGAGGGGCTCCTAAATGG + Intronic
1065708786 10:28495490-28495512 GAGGCAGGGGCTCCTCTAATGGG - Intergenic
1067424870 10:46200160-46200182 GAGTCAAAGTCTCCTATAAAAGG + Intergenic
1069116690 10:64515949-64515971 GGATCAGAGGGCCCTCTAAGGGG + Intergenic
1070364709 10:75725395-75725417 TAGTCAAAGGGTCCTTTAAAAGG + Intronic
1070875892 10:79809222-79809244 GAGTCAAAGTCTCCTATAAAAGG - Intergenic
1073604666 10:104882059-104882081 GAGGCAGAGTCTCCTTTAAAGGG + Intronic
1074234488 10:111571683-111571705 CAGTCAAAGTGTGCTCTAAATGG + Intergenic
1075361025 10:121834166-121834188 TAGTCAGAGGGTCCTCTCTGAGG - Intronic
1076260307 10:129059749-129059771 TAGACAGAGGGACCTCTGAAGGG - Intergenic
1077470794 11:2759668-2759690 GAGTTAGAGGATCCTCCAGAAGG + Intronic
1079107431 11:17580442-17580464 GAGTGAGAAGGTCCCCTACAAGG + Intronic
1079385987 11:19980179-19980201 GAGTCAGAGCCTCTGCTAAAGGG - Intronic
1080590476 11:33719260-33719282 AAGTCAGAGGATCCTCTATTGGG - Intronic
1082009099 11:47438332-47438354 GAGTCAGAGAGGCCCCTCAAAGG - Intronic
1083996435 11:66275349-66275371 GAGTTCGAGGGTCCTCTCAGAGG - Intronic
1085235656 11:75013273-75013295 GAGTCAGTGAATCCTCAAAAGGG + Intronic
1085442786 11:76578991-76579013 GGGTCAGAGGGACCTCCATAAGG + Intergenic
1093628311 12:21378419-21378441 GAGTTACATTGTCCTCTAAAGGG - Exonic
1096893457 12:54795636-54795658 GAGTCAGAGGGTGAACTATAGGG + Intergenic
1103024361 12:117561778-117561800 GAGTCTGAGGGTCTTAGAAAAGG - Intronic
1103645079 12:122385467-122385489 GAGGTGGAGGGTCCTCAAAATGG - Intronic
1105706478 13:22970652-22970674 GAGGCAGACGATCTTCTAAATGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1106402238 13:29441835-29441857 GAGGCAGAAGGTCCTTTTAAAGG - Intronic
1106592484 13:31109775-31109797 GAGTCCGAGGGACCTGGAAAAGG + Intergenic
1110436884 13:75485462-75485484 GAGTCAGTAGTTCCTCTGAAGGG + Intergenic
1110611359 13:77491608-77491630 GAGTCAGTGTGTCGTCAAAATGG + Intergenic
1113357715 13:109599117-109599139 GAATTAGAGAGTCCTCAAAAGGG - Intergenic
1115210907 14:30966760-30966782 GAGTGAGTGGGTCCTCTCCAAGG + Intronic
1115604795 14:34990146-34990168 GAGTCACAGGGTCTTCTAACTGG - Intronic
1117099360 14:52330995-52331017 AGGTCAGAGGGGCCACTAAATGG - Intergenic
1119551851 14:75520571-75520593 GAGTCTGTGGGTCATCTGAAAGG - Intergenic
1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG + Intronic
1127214361 15:56809222-56809244 GAGTCTGATGGTCCTCAAGAAGG - Intronic
1129618350 15:77119257-77119279 GAGTCAGAGGAACATCAAAAGGG + Intronic
1132539255 16:500750-500772 GAGGCAGAGGGTCCTCAGCATGG - Intronic
1139407113 16:66727777-66727799 GAGCCAGAGGGTCCTCTTGCAGG + Exonic
1141201786 16:81903839-81903861 GGGGCAGAGGGTGCTCTAAAAGG - Intronic
1142299881 16:89250521-89250543 CAGTCAGAGGAACCTCCAAATGG + Intergenic
1144407236 17:14963986-14964008 GGGTCAGAGTGACCTCTAAAGGG + Intergenic
1146111599 17:30094855-30094877 GAGTCAGAGGGTCCCCCACAGGG - Intronic
1151763300 17:76119631-76119653 GGCTCAGCGGGGCCTCTAAAGGG + Intronic
1152013763 17:77736217-77736239 GAGACAGTGGGTCCCCTACAGGG - Intergenic
1152264432 17:79286158-79286180 ACGTCAGAGGGTCCTCACAAGGG - Intronic
1161155437 19:2730191-2730213 GTGTCAGAGGCTCCTCTAGAGGG + Intronic
1161571298 19:5032152-5032174 GAGTCAGACTGTCCTCTCCACGG - Intronic
1161877518 19:6923154-6923176 AAGCCACAGGGTCCTCGAAATGG - Intronic
1166216010 19:41335583-41335605 GAGTCAGAGGATCACCTAGACGG - Intronic
1168276321 19:55280494-55280516 GAGTGGGAGGGGCCTGTAAAGGG - Intergenic
926835135 2:17010907-17010929 CAGTCAGACTCTCCTCTAAAGGG - Intergenic
927464366 2:23325835-23325857 GAGTCTGAGGCACCTCTCAAGGG + Intergenic
932336369 2:70933521-70933543 GAGTCAGAGGGACCTCAGATGGG + Intergenic
932978757 2:76636453-76636475 GAGTCAGTCTGTCCTCTATAAGG + Intergenic
941236754 2:162984609-162984631 GAGACAGAGGTTCCTGCAAAGGG + Intergenic
946908831 2:224441557-224441579 GAGACAGCGGGTTCTCTAAGTGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172719913 20:36991859-36991881 GTGCCAGAGGAACCTCTAAAAGG - Intergenic
1172913112 20:38424830-38424852 GACTCAGAGGCTCCTGTCAAAGG - Intergenic
1173639767 20:44592710-44592732 GCTTCAGAGGCTCCTCTCAAAGG - Intronic
1174339821 20:49888659-49888681 GGGTCAGAGCGCCCTCTAGAGGG + Exonic
1174661096 20:52213923-52213945 TAGTCAGAGGGGTCTCTAGAAGG - Intergenic
1175895914 20:62335529-62335551 GAGTCTGAGTGTGCTCTAGAGGG - Intronic
1178204074 21:30442838-30442860 CATTCAGTGGGTCCTCTATAGGG - Intergenic
1178671390 21:34594596-34594618 GGGCCTGAGGGTCCCCTAAATGG - Intronic
1179103258 21:38375780-38375802 GAGTCACAGGGTCCTTTTATAGG + Intergenic
1181492793 22:23271091-23271113 GACACAGAGGATCCTGTAAATGG - Intronic
1182219001 22:28742855-28742877 GAGGGAGAGGGTCCAATAAATGG + Intronic
1182860571 22:33556072-33556094 GAGTCAGGAGGGCTTCTAAAGGG - Intronic
949591359 3:5497368-5497390 GAATCAGAGAGTCGTCAAAAGGG + Intergenic
952252209 3:31665825-31665847 GGGTCAGGGGGTCCTCTGAAGGG + Intronic
954520286 3:51219078-51219100 GAGTCAGAGGGTCCTCTAAAAGG - Intronic
956361790 3:68455924-68455946 GAGTCATAAGGACCTTTAAAAGG - Intronic
958546714 3:95562598-95562620 GACTCAGAAGGTCCTCAAAGAGG + Intergenic
962315417 3:134356555-134356577 GAGTCAAATAGTCCTCTGAATGG - Exonic
967692880 3:192497243-192497265 GAGAAAGAGAGTCCTCAAAAAGG - Intronic
970443134 4:16101916-16101938 GAGTCAAAGCTTGCTCTAAATGG - Intergenic
970445371 4:16119586-16119608 GAGTCAAAGAATCCTCTGAAGGG + Intergenic
971904479 4:32709101-32709123 TAGGAAGAGGGTCCTATAAAAGG + Intergenic
972580498 4:40391468-40391490 GAGTAAGAGAGGCCTCTAAGGGG - Intergenic
979084270 4:116386785-116386807 GTGTCAGAAGGGCCTTTAAAAGG + Intergenic
984744084 4:183196665-183196687 GAGGCACAGGGTCCTCCTAAAGG - Intronic
985189516 4:187356952-187356974 GACCCAGAAGGTCCTTTAAATGG + Intergenic
986363985 5:7011143-7011165 GAGGCAGAGGGACATCCAAAGGG + Intergenic
986693895 5:10335095-10335117 GACTAAGATGGTCCACTAAAAGG + Intergenic
989162116 5:38401392-38401414 GAGTTAGAGCTTCCTCTAATGGG + Intronic
992980940 5:82171109-82171131 GATTCAGAGGTTCATCAAAATGG + Intronic
993055500 5:82975200-82975222 GAGTGAGTGGGTCCTCTCCACGG - Intergenic
995515421 5:112950213-112950235 GATTCAGAGGGTCCGTAAAATGG + Intergenic
997872043 5:137514849-137514871 AAGTCAGAGTATCCTCTAGAAGG + Intronic
1003749487 6:9040525-9040547 GAGGCAGAGGGTGCAGTAAAAGG - Intergenic
1003796625 6:9612667-9612689 GAGTCAGAGATGCCTCAAAAGGG + Intronic
1003874910 6:10426463-10426485 GAGACAGAGAGTCTCCTAAATGG + Intergenic
1007754072 6:44087511-44087533 GAGTCAGAGGCTCCTGGAATGGG - Intergenic
1007830403 6:44634154-44634176 GAGTAAGAGTGTCCTGGAAATGG + Intergenic
1009462579 6:63932372-63932394 GAGTCAGATGAACCTCCAAATGG - Intronic
1010956680 6:82098293-82098315 GAGTCAGAGGGTACTCTGTAGGG - Intergenic
1011633694 6:89351745-89351767 GAATCATTGGATCCTCTAAATGG - Intronic
1013616060 6:111844601-111844623 GAGTCTGAGGCACCTCTGAAAGG - Intronic
1017809242 6:157973064-157973086 GAGTCTGAGGGGCCTTTACAGGG + Intergenic
1023856040 7:44184727-44184749 GAGTCAGTGGCTCCTGGAAAGGG + Intronic
1026442706 7:70457996-70458018 GAGTGAGAGGGGCCTAGAAAAGG + Intronic
1028538273 7:91913791-91913813 GAGTCAGAGGGCCTCCAAAAAGG + Intergenic
1028588270 7:92472072-92472094 CAGTCAAAGGAACCTCTAAAAGG + Intronic
1030337610 7:108343041-108343063 CAGTCAGGGGAACCTCTAAAAGG - Intronic
1030892315 7:115014072-115014094 GGGTCAGAGAGTACTCAAAAGGG - Intronic
1032080379 7:128855684-128855706 GTGTGAGAGGCTCCTCTAAAGGG + Intronic
1036451253 8:8869932-8869954 GAGTCAGAGGGACCACTTAGAGG - Intronic
1037293658 8:17378426-17378448 GAGTCAGTGGGTCTTCAAGATGG - Intronic
1037418490 8:18676809-18676831 GAGGCACAGGGTCCTCTGACTGG - Intronic
1041894852 8:62912461-62912483 GAGTCAAAAGGTTCTTTAAAAGG - Intronic
1046151443 8:110231628-110231650 GAGTAAGAGGATCCTGTGAAAGG + Intergenic
1048279075 8:133091385-133091407 GTGTCAGAGGGTCCTCTGGATGG - Intronic
1048802196 8:138204520-138204542 GAGTCATAGCATCCTCTACAGGG + Intronic
1049349933 8:142159067-142159089 GGGTCAGATGATCCTCAAAAAGG + Intergenic
1049350261 8:142160587-142160609 GGGTCAGATGATCCTCAAAAAGG - Intergenic
1049355138 8:142183935-142183957 GCGTCTGAGGGTCTTGTAAATGG - Intergenic
1190574890 X:51825296-51825318 GGGTCAGAGAGAGCTCTAAAGGG + Intronic
1193355285 X:80512994-80513016 GCTTCAGATGGTGCTCTAAATGG - Intergenic
1198742114 X:139852687-139852709 GAGTGAGTGGGTCCTCTCCATGG + Intronic
1201365180 Y:13197505-13197527 CAGTCACATGATCCTCTAAAAGG + Intergenic