ID: 954521311

View in Genome Browser
Species Human (GRCh38)
Location 3:51229113-51229135
Sequence AGACTCTCCCAGTCAAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 1, 2: 4, 3: 11, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954521311_954521322 25 Left 954521311 3:51229113-51229135 CCTGTCCTTGACTGGGAGAGTCT 0: 1
1: 1
2: 4
3: 11
4: 145
Right 954521322 3:51229161-51229183 CAGGGTTTGGCCATGTGCGGTGG 0: 1
1: 0
2: 3
3: 83
4: 1072
954521311_954521316 6 Left 954521311 3:51229113-51229135 CCTGTCCTTGACTGGGAGAGTCT 0: 1
1: 1
2: 4
3: 11
4: 145
Right 954521316 3:51229142-51229164 TGCTTGACCTTAGAATAGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 81
954521311_954521317 7 Left 954521311 3:51229113-51229135 CCTGTCCTTGACTGGGAGAGTCT 0: 1
1: 1
2: 4
3: 11
4: 145
Right 954521317 3:51229143-51229165 GCTTGACCTTAGAATAGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 73
954521311_954521320 22 Left 954521311 3:51229113-51229135 CCTGTCCTTGACTGGGAGAGTCT 0: 1
1: 1
2: 4
3: 11
4: 145
Right 954521320 3:51229158-51229180 AGCCAGGGTTTGGCCATGTGCGG 0: 1
1: 0
2: 5
3: 205
4: 1200
954521311_954521318 12 Left 954521311 3:51229113-51229135 CCTGTCCTTGACTGGGAGAGTCT 0: 1
1: 1
2: 4
3: 11
4: 145
Right 954521318 3:51229148-51229170 ACCTTAGAATAGCCAGGGTTTGG 0: 1
1: 0
2: 0
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954521311 Original CRISPR AGACTCTCCCAGTCAAGGAC AGG (reversed) Intronic
900964937 1:5951409-5951431 AGACTCTCTCATTCTAGGAGGGG + Intronic
903214045 1:21833408-21833430 AGACCCTGCCAGTCAGGGAGTGG + Intronic
904012630 1:27398555-27398577 AGACTCACCCAGGGTAGGACGGG - Intergenic
904914039 1:33956906-33956928 AGACTCTGCAGGTCCAGGACAGG - Intronic
907574018 1:55509612-55509634 AGACTCTCCTGGACAAGCACTGG + Intergenic
908441840 1:64162996-64163018 AGAGTCTCCCCTTCAAGAACAGG + Intronic
910230074 1:84976470-84976492 AGATTTTCCCAGACAAGGTCGGG + Intronic
910711824 1:90189953-90189975 AGACTCTACCAGGCAGGGACGGG - Intergenic
911542013 1:99168085-99168107 AGACTCTTCTAGTCCAGGAGAGG + Intergenic
912473505 1:109921920-109921942 AGAATCTCCTTGACAAGGACTGG + Exonic
915092770 1:153438150-153438172 AAGCTCTCCCAGCCAAGGGCGGG + Intronic
915427732 1:155841359-155841381 AGACCTTCCAAATCAAGGACAGG + Intronic
919788918 1:201277471-201277493 AGAGGCTCCCAGCCATGGACAGG - Intergenic
922537019 1:226388981-226389003 ATACTCTCCCAGCCAGGGAGAGG + Intronic
923948819 1:238924104-238924126 ATACTCTTCAAATCAAGGACAGG - Intergenic
1062921634 10:1284836-1284858 TTCCTCTCCCACTCAAGGACTGG - Intronic
1063184552 10:3638868-3638890 AGACTCTGCCAGTCTGTGACAGG + Intergenic
1063414485 10:5862436-5862458 AGACTCTTCCAGTCAATGGTTGG + Exonic
1072821239 10:98559899-98559921 AGACTCTTCCAGACAAAGACTGG + Intronic
1073834761 10:107428587-107428609 AGAATTTTCCAGTGAAGGACAGG + Intergenic
1073840964 10:107498529-107498551 AGACACTCCCATTCAAGAAGGGG - Intergenic
1074066344 10:110018096-110018118 AGACTTTCCCAGTCAAACATAGG + Intronic
1075464042 10:122638134-122638156 ATACTCCCCCAGTGAAGGCCTGG + Intronic
1078877578 11:15413513-15413535 GGACTCTCCCAGACAAGTATGGG - Intergenic
1079412419 11:20201520-20201542 AGTCTCTCTCAGTTAAGAACAGG + Intergenic
1081280765 11:41207231-41207253 AGAGTCTTCCAGGCTAGGACAGG - Intronic
1081399441 11:42625866-42625888 ACACTCTCCTAGTAAAAGACAGG - Intergenic
1084742360 11:71147898-71147920 AGAATCTCCCAGACCAGGACTGG + Intronic
1085764614 11:79271842-79271864 AAACTCTCCCACTCCAGGAAAGG + Intronic
1088570192 11:111215312-111215334 AGACTTTCCCAGACAAAAACAGG + Intergenic
1091278709 11:134369999-134370021 AGAATATCCTAGACAAGGACAGG + Intronic
1098135583 12:67398238-67398260 AGACTCTCCTAGACATTGACCGG - Intergenic
1105417749 13:20227825-20227847 AGACGCTCCCATTCAAGGAGCGG + Intronic
1112408231 13:99139528-99139550 AGACCCTCCAAATCAAGGATGGG - Intergenic
1113843292 13:113371917-113371939 AGACACTGCCAGCCAAGGAGGGG - Intergenic
1115077936 14:29414086-29414108 GGACTCTCCCAGCCAGGCACGGG - Intergenic
1116023418 14:39487881-39487903 AGACTCTCCAAATCAAGGACAGG - Intergenic
1116641005 14:47462637-47462659 AGAATCTCCCAGGGAAAGACAGG + Intronic
1118762760 14:68890573-68890595 AGACTCTCCCTGACTAGGACTGG + Intronic
1121110122 14:91307059-91307081 AGCTTCTCCGAGTGAAGGACCGG - Exonic
1121155495 14:91680361-91680383 AGAACCTCCAAATCAAGGACAGG + Intronic
1128943173 15:71805051-71805073 AGACTTTACTAGTCAAGGGCTGG + Intronic
1129270975 15:74419100-74419122 AGACTCAGAGAGTCAAGGACAGG + Intronic
1130696417 15:86136148-86136170 AGAATCTCCCAGCCAAGTTCTGG + Intergenic
1131122044 15:89828793-89828815 TGACTCTCCCAGGCAAGCAAAGG + Intergenic
1131588190 15:93718744-93718766 AGAATCTCCCAGAGAAGGAGAGG - Intergenic
1131726044 15:95226386-95226408 ACACTCTCCAAGTCAGGGGCTGG - Intergenic
1133983443 16:10650543-10650565 AGACTCTGTCACTCAAGGCCAGG + Intronic
1135244640 16:20845090-20845112 ACATTCTCACAGGCAAGGACTGG + Exonic
1137317942 16:47347399-47347421 AGACCCTCCCAGCCATGCACAGG - Intronic
1138633088 16:58314994-58315016 AGACCCTCCAAATCAAGGATGGG + Intronic
1140719074 16:77754149-77754171 AGACTCTTCCAGGAAACGACAGG - Intergenic
1141259125 16:82434997-82435019 AGACTCTCCCAGTCTAGCCATGG - Intergenic
1141259137 16:82435074-82435096 AGACTCTCCCAGTCTAGCCATGG - Intergenic
1159833885 18:73312405-73312427 AGACTCTCTGAGTCAAGGACTGG + Intergenic
1160937192 19:1602297-1602319 AGACTCTCCAAGTGTAGGCCAGG + Intronic
1162438449 19:10678070-10678092 GGACTCTCTCTGTCAAGGGCTGG + Intronic
1164877362 19:31700855-31700877 AGAGTCTCCCAGAAAAGGAAGGG + Intergenic
928455653 2:31418982-31419004 AGACTTTCCCAGACAAAAACTGG - Intergenic
931401763 2:61937892-61937914 AGACCCTCCAAATCAAGGATGGG - Intronic
932509707 2:72273519-72273541 TGACTCTCCCAGGGAGGGACTGG - Intronic
933221636 2:79696563-79696585 AGACCCTCCAAATCAAGGATGGG - Intronic
934131642 2:88954517-88954539 AGCCTCTCCCAGCCTGGGACAGG - Intergenic
934135912 2:88996333-88996355 AGCCTCTCCCAGCCCGGGACAGG - Intergenic
934220407 2:90076964-90076986 AGCCTCTCCCAGCCCGGGACAGG + Intergenic
934234406 2:90217440-90217462 AGCCTCTCCCAGCCCGGGACAGG + Intergenic
934551678 2:95266806-95266828 AGACGCTCCCTGCCAAGGTCTGG - Intergenic
937112808 2:119379631-119379653 AGACTCTCCAAATCAAGGATGGG - Intergenic
937335164 2:121058209-121058231 TGACTCTCCCGGCCAAGGAGGGG + Intergenic
938811199 2:134854444-134854466 TGCCACTCCCAGTCATGGACAGG + Intronic
938901851 2:135805113-135805135 AGACTCACCCAGTGAAAGAAAGG - Intronic
939868701 2:147503903-147503925 AGACACTCCCAGTCCAGGACTGG - Intergenic
941266565 2:163370282-163370304 AGAATCTCCCAGGCAAGGACCGG - Intergenic
941911815 2:170771191-170771213 AGACACTCCGAGGCAACGACCGG + Intergenic
946339503 2:219058737-219058759 AGAGTCTCAGAGTCGAGGACTGG - Intronic
948358777 2:237403098-237403120 TGAGGCTGCCAGTCAAGGACAGG + Intronic
1168843991 20:929683-929705 TGACACTCCAAATCAAGGACAGG - Intergenic
1170699971 20:18695234-18695256 ATTTTCTCCCAGGCAAGGACTGG - Intronic
1173099116 20:40067327-40067349 AGACTTTCCCAGACAAAGAAAGG + Intergenic
1173398308 20:42701602-42701624 AGTCTCTCCCAGGCATGGCCAGG + Intronic
1173457670 20:43216443-43216465 AGAGTTTCCCAGGCAAGCACTGG - Intergenic
1173746211 20:45439174-45439196 AGACCCTCCAAATCAAGGAAGGG + Intergenic
1179072595 21:38085890-38085912 AGGCTCTCACAGTCAGGGAAAGG - Intronic
1180083394 21:45496914-45496936 AGCCTCCCCCAGTCAGAGACGGG - Intronic
1181051058 22:20238528-20238550 AGGCGCTCCCATCCAAGGACAGG + Intergenic
1181558339 22:23684945-23684967 AGACTCCTCCAGTCAAAGGCCGG + Intergenic
1183545130 22:38451410-38451432 AGGCAGTCCCAGGCAAGGACAGG - Intronic
1183771470 22:39929788-39929810 AGAGACTCCCAGTCAAGGATTGG - Intronic
950261291 3:11544702-11544724 AGACACACACAGTCAAGGGCGGG - Intronic
951160858 3:19419567-19419589 AGACTCTCACATTCAAGTAAAGG - Intronic
954521311 3:51229113-51229135 AGACTCTCCCAGTCAAGGACAGG - Intronic
954651624 3:52167749-52167771 AGACTCTCCAAATCAAGGATGGG + Intergenic
959477822 3:106832817-106832839 AGACCCTCCAATTCAAGGATGGG - Intergenic
967444158 3:189545191-189545213 AGACTCTCCAGATCAAGGATGGG - Intergenic
968610841 4:1556352-1556374 AGACCCTCCCAGATAAGGGCAGG + Intergenic
974974520 4:68873539-68873561 AGACCCTCCAAGTCAAGAAGGGG + Intergenic
983015237 4:162605389-162605411 AGACTCTCCCAATCAAGGACAGG + Intergenic
983110111 4:163739284-163739306 AGACTATCCCAGTGAAATACAGG + Intronic
984030642 4:174599776-174599798 AAACTTTCCCAGTCCAGGCCAGG + Intergenic
988030207 5:25753784-25753806 AGACTCTCCAAATCAAGGATGGG - Intergenic
992485476 5:77190255-77190277 AAACTGTTGCAGTCAAGGACTGG - Intergenic
993272089 5:85809601-85809623 AGACCCTCACAATCAAGGATGGG - Intergenic
998930657 5:147177451-147177473 GGATTCTCAGAGTCAAGGACGGG + Intergenic
1001426715 5:171627738-171627760 AGATTCTCCCAGTTGAGGCCGGG - Intergenic
1004564075 6:16779393-16779415 AGCCTGTCCCAGGCAATGACAGG + Intergenic
1006320933 6:33319080-33319102 GGACTCTCCCAGCCATGGCCTGG - Exonic
1006577733 6:35058413-35058435 AGACTTCCCCATTCAAGGGCAGG + Intronic
1012610369 6:101211294-101211316 AGAAACTCCAAGTAAAGGACAGG - Intergenic
1012759604 6:103282161-103282183 AGACCCTCCAAATCAAGGATTGG + Intergenic
1017485758 6:154900701-154900723 AGGAGCTCCCAGTCAAGGAAAGG + Intronic
1017497308 6:154994071-154994093 GGCCGCTCCCAGCCAAGGACTGG + Intronic
1018419239 6:163627879-163627901 AGACTCTCACAGTGAAGGTGTGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019747888 7:2710690-2710712 AGACTCTGGCAGTCAAGGGAAGG + Intronic
1021641870 7:22745468-22745490 AGATTCTCTAAATCAAGGACAGG - Intergenic
1022627067 7:32048061-32048083 TGACACTCCCAGTCAAGTAATGG - Intronic
1022679085 7:32527112-32527134 AGACCCTCCAAATCAAGGATGGG + Intronic
1023213971 7:37841019-37841041 ACACTCTCCCACCCCAGGACAGG + Intronic
1023476433 7:40584043-40584065 AGGCTCTCTCAGTCAAGAAAAGG + Intronic
1024352533 7:48381490-48381512 AGAGTCTCCCAGTCAGACACCGG - Intronic
1024382724 7:48717560-48717582 AGTCTCTCCCACTAAAGGAGAGG - Intergenic
1026909740 7:74084763-74084785 GGACTCCCCCAGCCTAGGACAGG + Intronic
1027797526 7:82713213-82713235 AGACCCTCCAAATCAAGGACAGG - Intergenic
1028149220 7:87352600-87352622 AGACCCTCCAAATCAAGGTCAGG - Intronic
1030006104 7:105121743-105121765 GGACTCTGCAAGTCCAGGACTGG - Intronic
1031344732 7:120651402-120651424 GGACTCTCCCAGCCATGCACGGG + Intronic
1031928408 7:127660370-127660392 ACAGTCTCCCAGTCAAGAGCAGG - Intronic
1034549161 7:151809331-151809353 AGACTCTCGCAGTCCACGGCAGG + Intronic
1035307755 7:157944107-157944129 AGACACTCCGAGCCCAGGACAGG + Intronic
1035318337 7:158012116-158012138 GGACTCTCTCAGCCAAGGAGTGG - Intronic
1036295383 8:7530671-7530693 AAACTCTCCAAATCAAGGAGGGG - Intergenic
1036327187 8:7790347-7790369 AAACTCTCCAAATCAAGGAGGGG + Intergenic
1036649246 8:10631835-10631857 AGACACTGCCAGGCAAGGTCTGG + Intronic
1036793584 8:11739943-11739965 AGCCTCTCCCACAGAAGGACTGG + Intronic
1037682106 8:21106166-21106188 AGGCTCACCCAGGCATGGACTGG - Intergenic
1038606707 8:29013966-29013988 ACACTCTGCAAGTGAAGGACTGG - Intronic
1041348788 8:56928773-56928795 AAATTCTCCCAGAGAAGGACTGG + Intergenic
1043803377 8:84640004-84640026 AGACCCTCCAAGTCAGGGATGGG - Intronic
1043976909 8:86594242-86594264 AAGCTCACCCAGGCAAGGACTGG - Intronic
1045664388 8:104469347-104469369 AGACTCTTCCAATCAAGGCAGGG + Intergenic
1048143172 8:131815412-131815434 AGACTCTCAAAGTCTAGGGCAGG + Intergenic
1048866683 8:138766696-138766718 AGACACACACAGTCAGGGACAGG + Intronic
1049137556 8:140917330-140917352 AGACTCTGCCAGGAAAGGACAGG + Intronic
1049519793 8:143082242-143082264 CGCCTCACCCAGTAAAGGACAGG + Intronic
1051985190 9:23076975-23076997 AGAATTTATCAGTCAAGGACAGG + Intergenic
1053427783 9:38022408-38022430 ACCCTCTCACAGTCAATGACAGG - Intronic
1058446234 9:105057749-105057771 AGACCCTCCAAATCAAGGATGGG + Intergenic
1060051869 9:120383690-120383712 AGGCACTCCCAGTCAAGCATGGG - Intergenic
1061837520 9:133339160-133339182 AGACTCTCCCAGTCTAGCCATGG - Exonic
1062265517 9:135685034-135685056 AGACGCTCCCATAAAAGGACAGG + Intergenic
1186611644 X:11143771-11143793 GGACCCTCCCAGCCAACGACTGG + Intronic
1186904324 X:14095193-14095215 AGACTCTCCTAGTTCAGGCCTGG - Intergenic
1188098925 X:26058198-26058220 AGCATCTCCCAGTCTAGGCCTGG + Intergenic
1188504333 X:30865166-30865188 AGACTATCCCAGGCAATGAAAGG + Intronic
1192065653 X:67881932-67881954 AGACCCTCCAAATCAAGGATGGG - Intergenic
1192855777 X:75010246-75010268 AGACTTTCCCAGACAAAGAAAGG - Intergenic
1193223841 X:78958422-78958444 AGTCTCTCCTAGTCAGGGAGAGG + Intronic
1194501283 X:94684695-94684717 AGACCCTCCAAATCAAGGATGGG - Intergenic
1196099914 X:111837219-111837241 AGACTCTACCAGCCAGGGCCAGG + Intronic
1200293119 X:154890091-154890113 AGACTCTTTCTGTCAAGGGCGGG + Intronic
1200339966 X:155385823-155385845 AGACTCTTTCTGTCAAGGGCGGG + Intergenic
1200346504 X:155454865-155454887 AGACTCTTTCTGTCAAGGGCGGG - Intergenic