ID: 954522706

View in Genome Browser
Species Human (GRCh38)
Location 3:51243232-51243254
Sequence CAGATGATGTGGAGCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 2, 1: 2, 2: 60, 3: 70, 4: 312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954522706 Original CRISPR CAGATGATGTGGAGCCCAGG GGG (reversed) Intronic
900175964 1:1291489-1291511 CAGATGACCCGGAGCCCAGCGGG + Exonic
902337241 1:15760645-15760667 CAGAGAATGTGCAGCTCAGGGGG - Intronic
902394137 1:16123239-16123261 GAGATGATCTGAGGCCCAGGAGG - Intergenic
904438194 1:30512909-30512931 CAGCTGGTGTGGAGCAGAGGTGG - Intergenic
906851039 1:49250897-49250919 CAGCTGATGTGGAGCTCACAGGG + Intronic
907583350 1:55591969-55591991 CAGATGATGAGGACCTCAGCTGG + Intergenic
907703984 1:56817176-56817198 CAGATGATATAGGGCCCTGGAGG - Intronic
907722378 1:56983989-56984011 CAGGTAACGTGGAGCCAAGGAGG + Intergenic
907911188 1:58828158-58828180 GAGAGGAGGTGGAGCTCAGGTGG - Intergenic
908818318 1:68057013-68057035 CAGCTGATGTGGAGCACAGAGGG + Intergenic
909203510 1:72724941-72724963 CAGCTGATGTGGAGCCCAGCGGG + Intergenic
910200336 1:84691648-84691670 TAGCTGCTGTTGAGCCCAGGTGG + Intergenic
912228085 1:107758754-107758776 CAGATCATGAGGAGTCTAGGAGG - Intronic
912250766 1:108010443-108010465 CAGACTATGTGGAGTACAGGAGG + Intergenic
912887220 1:113488234-113488256 CAGCTGATGTGGATCCCAAAGGG + Intronic
913974406 1:143443033-143443055 CAGAGAATGTTGAGCCCATGTGG - Intergenic
914068796 1:144268647-144268669 CAGAGAATGTTGAGCCCATGTGG - Intergenic
914110359 1:144697707-144697729 CAGAGAATGTTGAGCCCATGTGG + Intergenic
915049102 1:153049186-153049208 CAGCTGATGTGGAGCCTAAAGGG + Intergenic
915051851 1:153083818-153083840 CAGCTGACGTGGAACCCAAGGGG + Intergenic
915053447 1:153102799-153102821 CAGCTGATGTGGAGCCTAAAGGG + Intronic
915284195 1:154842454-154842476 CAGGTGATGTGAAGCTCAGGAGG - Intronic
915302480 1:154959437-154959459 CAGATGATGCCGGGCCCAGTGGG - Exonic
917252685 1:173079133-173079155 CAGACTATGTGGAGCTCAGATGG + Intergenic
917995894 1:180438047-180438069 CACAGGAGGTGGAGCTCAGGTGG - Intronic
918126160 1:181585855-181585877 CAGATCATGTGGAGCCCTGAAGG + Intronic
919207551 1:194437127-194437149 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
920699184 1:208204804-208204826 CAGATGCTGTGGGGTCTAGGAGG + Intronic
920787004 1:209051310-209051332 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
920843149 1:209571689-209571711 CAGATGTTGTGGAGTAAAGGAGG + Intergenic
921017601 1:211206864-211206886 CAGAAGCTGTGGGGGCCAGGAGG + Intergenic
921404670 1:214765480-214765502 CAGCTGATGTGGGGCCCAGAGGG - Intergenic
921462538 1:215445445-215445467 AAGATGATATGGAGCCTAGAGGG - Intergenic
921713416 1:218395269-218395291 CACCTGATGTGGAGACCTGGGGG - Intronic
921800813 1:219399916-219399938 CAGCTGATGTAGAGACCAGCGGG - Intergenic
922050837 1:221989348-221989370 CAGATGAGGTGGAGGGCAGGTGG - Intergenic
922051352 1:221993600-221993622 CACAGGAGGTGGAGCTCAGGTGG + Intergenic
922538583 1:226402040-226402062 CAGATGATGCTGAGTCCAGGAGG + Intronic
923400732 1:233613917-233613939 CAGATGATGTGGCGCTGACGTGG - Intergenic
923855208 1:237838751-237838773 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
924713900 1:246554423-246554445 GAGAGGAGGTGGAGCTCAGGCGG - Intronic
1063160162 10:3412974-3412996 CAGCTGATGGGGAGCTCCGGAGG - Intergenic
1063819538 10:9819132-9819154 CAGCTGATGCAGAGCCCAGAGGG + Intergenic
1067269978 10:44783160-44783182 CAGATCAGGAGGAGTCCAGGTGG - Intergenic
1068585395 10:58792530-58792552 CACAGGAGGTGGAGCTCAGGCGG - Intronic
1068745221 10:60522576-60522598 CAGAGGATCTGGAACCCAGCAGG - Intronic
1069806071 10:71125807-71125829 CAGCTGATATGGAGCCCAGGGGG - Intergenic
1069845086 10:71365444-71365466 CAGTTAGTGTGGAGCACAGGGGG + Intergenic
1071091481 10:81924042-81924064 CAGGTGATTGGGAGCCCAGTAGG + Intronic
1071736143 10:88303226-88303248 CAGCTGATGTGGAGCCCAGATGG + Intronic
1074794827 10:116932302-116932324 CTGACGAGGTGGAGCTCAGGCGG - Intronic
1077841718 11:5982704-5982726 CAGTCTATGTGGAGCCCAGAGGG - Intergenic
1078858324 11:15224724-15224746 CAGATTCTGTGGAGCCCATGGGG + Intronic
1079668295 11:23135000-23135022 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1080224921 11:29949867-29949889 CAGCTGATGTGGAGCACAGAGGG + Intergenic
1082193982 11:49279748-49279770 CAGATGAAGTGCAACCCAGCAGG - Intergenic
1083720659 11:64602058-64602080 CAGAGGATGTGGCGGGCAGGTGG - Exonic
1084691812 11:70731983-70732005 CAGAGGATGGGGAGCTGAGGAGG - Intronic
1085022259 11:73217286-73217308 CAGCTGATATGGAGCCCAAGAGG + Intergenic
1085815040 11:79728199-79728221 TAGCTGATGTGGAGCCTAGAGGG - Intergenic
1085856530 11:80181852-80181874 CCGCTGATGTGGAGCCCACAGGG - Intergenic
1086462854 11:87022855-87022877 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1086672167 11:89561306-89561328 CAGATGAAGTGCAACCCAGCAGG + Intergenic
1087039576 11:93785224-93785246 CAGATCATGTAGAACCCAGTAGG + Intronic
1087283068 11:96233911-96233933 CAGAAGAAGTGGTGGCCAGGTGG + Intronic
1087337558 11:96863697-96863719 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1087597534 11:100272906-100272928 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1087619828 11:100528644-100528666 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1087868930 11:103267004-103267026 CAGCTGATGTGGAGCCCAGGGGG - Intronic
1088806622 11:113358679-113358701 CAGTTGATGTGGAGCCCAGAGGG - Intronic
1089602942 11:119626390-119626412 CTGATGATGTGCTTCCCAGGGGG + Intronic
1090194860 11:124806057-124806079 GAGAGGAGGTGGAGCTCAGGTGG - Intergenic
1090684434 11:129100122-129100144 CAGTTGATGTGGAGCCCAGAAGG + Intronic
1091037552 11:132247120-132247142 AAGTTCATGGGGAGCCCAGGAGG - Intronic
1091529499 12:1340399-1340421 CAGCTGAGGTGGAACCCAGAGGG - Intronic
1091850591 12:3693868-3693890 CAGCTGATGCAGAGCCCAGAGGG - Intronic
1093923321 12:24883888-24883910 GAGATGAGATGGAGCTCAGGTGG + Intronic
1094765442 12:33589116-33589138 CAGATGATGTAGATCCTAGTAGG + Intergenic
1095431271 12:42137477-42137499 CAGATGCTCTGTCGCCCAGGCGG - Intronic
1095542807 12:43330314-43330336 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1097905194 12:64912456-64912478 AATATGCTGTGGAGCCCAGCTGG - Intergenic
1098583172 12:72125857-72125879 CAGAACATGGGGAACCCAGGAGG + Intronic
1098678498 12:73321264-73321286 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1099126418 12:78763751-78763773 CAAATGATGTTGAGCCTATGGGG + Intergenic
1099446627 12:82760716-82760738 CACAGGAAGTGGAGCTCAGGGGG - Intronic
1100888906 12:99102228-99102250 CAGCTCATGAGGACCCCAGGAGG + Intronic
1101220289 12:102632045-102632067 GTGATCATGTGGAGCCCAGAAGG + Intergenic
1102243138 12:111338110-111338132 CACCTGATGTGAAGCCGAGGGGG - Intronic
1102533233 12:113562079-113562101 CAGATGAAGTGGAGGCATGGGGG - Intergenic
1102919518 12:116781338-116781360 CAGCTGATGGGAAGCCCAAGAGG + Intronic
1104654509 12:130563914-130563936 CAGGTTATGTAGAGCCCAGCAGG - Intronic
1104933785 12:132353936-132353958 CAGATGATGTTGAGCTGTGGAGG - Intergenic
1105396857 13:20044191-20044213 CAGCTGATCTGGAGCCCACAGGG - Intronic
1106520587 13:30494130-30494152 CAGATGATTAGGAGCTCAGTTGG - Intronic
1108095391 13:46895408-46895430 CAGATGAGATGGGGCTCAGGGGG - Intronic
1109326206 13:60870378-60870400 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1109667133 13:65553746-65553768 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1111080605 13:83302052-83302074 GAGAGGAGGTGAAGCCCAGGTGG + Intergenic
1111113711 13:83749450-83749472 CAGCTGATGCGGAGCCCAGAGGG + Intergenic
1111526415 13:89476665-89476687 CAGCTGATGTGAAGCCCAGAAGG - Intergenic
1113016284 13:105832095-105832117 CAGACAGAGTGGAGCCCAGGTGG + Intergenic
1113356036 13:109581039-109581061 CATGTGATATGGAGCCCAAGAGG - Intergenic
1113669462 13:112165821-112165843 CAGCTGATGTGAAGCCCAGTGGG + Intergenic
1114059059 14:19002290-19002312 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1114103484 14:19399464-19399486 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
1114377596 14:22164847-22164869 TAGAGGATGAGGAGCCCAGTTGG + Intergenic
1115601031 14:34956169-34956191 CACCTGATGTGGAGACCAGAGGG + Intergenic
1115883373 14:37945421-37945443 CAACTGATGTGGAGCCCAGATGG + Intronic
1116243483 14:42378771-42378793 CAGCTGATGTGTAGCCCAGAAGG + Intergenic
1117161559 14:52995010-52995032 GACATGAGGTGGAGCTCAGGCGG + Intergenic
1117458123 14:55918189-55918211 GAGAGGAGGTGGAGCTCAGGCGG - Intergenic
1118175955 14:63440227-63440249 GAGGTGAGGAGGAGCCCAGGAGG - Intronic
1118478488 14:66141177-66141199 CAGCTGATGTGAAGCCCAGAGGG + Intergenic
1118540042 14:66813625-66813647 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1119189431 14:72670361-72670383 CGGAGGAGGAGGAGCCCAGGAGG + Exonic
1119345921 14:73924300-73924322 CAGGAGAGGTGGAGCTCAGGTGG + Intronic
1122151744 14:99729581-99729603 CAGAGGCTGAGGAACCCAGGAGG - Intergenic
1122864616 14:104597919-104597941 CAGAGCATGGGGAGCGCAGGAGG + Intronic
1123433703 15:20239404-20239426 TGGATGATGTGGAGTCCAGGAGG + Intergenic
1123496752 15:20834341-20834363 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1123553986 15:21407933-21407955 CAGCTGATGTGGAGCCTGGAGGG - Intergenic
1123590231 15:21845298-21845320 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1125367403 15:38932669-38932691 CAGCTCATGTGGAACCCAGAGGG - Intergenic
1126506263 15:49407160-49407182 CAGCTGATGTGGAGCCCAGAGGG - Intronic
1127565795 15:60186975-60186997 GACAGGAGGTGGAGCCCAGGCGG - Intergenic
1129184819 15:73899607-73899629 GAGATGACAGGGAGCCCAGGCGG + Intergenic
1129235260 15:74219973-74219995 GTGCTGAAGTGGAGCCCAGGTGG + Intergenic
1130445900 15:84001713-84001735 CAGGTGAGGTTGAGCCCTGGAGG - Intronic
1130715552 15:86329966-86329988 CAGAGGACTTGGAGCCTAGGAGG + Intronic
1131520733 15:93112701-93112723 TAGGTGATGAGGTGCCCAGGAGG - Intergenic
1202962334 15_KI270727v1_random:135129-135151 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1132535025 16:474512-474534 CTGAGCAGGTGGAGCCCAGGGGG + Intronic
1132563619 16:610396-610418 CAGATGAGGAGGAGAGCAGGGGG + Intronic
1134848476 16:17461088-17461110 CAGATGCTGTGGGGCCTGGGAGG - Intronic
1135165379 16:20134432-20134454 CAGATGATGTGGTCACCAGGTGG + Intergenic
1135465315 16:22679870-22679892 GAGAGGATGTGGAGCTAAGGAGG - Intergenic
1136402138 16:30024796-30024818 CGGGTGATGGGGAGCCCTGGGGG + Exonic
1136850916 16:33611706-33611728 CGGATGATGTGGAGTCCAGGAGG - Intergenic
1138667411 16:58583575-58583597 CACAGGAAGTGGAGCCCAAGCGG - Intronic
1140070585 16:71646087-71646109 CAGAGGATGTGTTCCCCAGGTGG - Exonic
1140149597 16:72348811-72348833 GACAGGATGTGGAGCTCAGGTGG + Intergenic
1141182800 16:81765857-81765879 CAGCTGCTGTGTAGCCAAGGTGG + Intronic
1141470587 16:84235798-84235820 AAGATGATGGGCAGCCCTGGGGG + Intronic
1142212967 16:88817085-88817107 CAGCTGATGTGGGTCCCAGCAGG - Intronic
1203112519 16_KI270728v1_random:1460163-1460185 CGGATGACGTGGAGTCCAGGAGG - Intergenic
1143096969 17:4483361-4483383 CAGAAGCTGGAGAGCCCAGGGGG - Intronic
1145930495 17:28681897-28681919 CAGAAGATGAGGAGCAGAGGGGG + Exonic
1149856596 17:60088244-60088266 AAGATGATGAGGATCACAGGAGG + Intergenic
1150337866 17:64343403-64343425 AACATGCTGTGGAGCTCAGGGGG - Intronic
1150533128 17:66006770-66006792 CTGAGGATGCAGAGCCCAGGTGG + Intronic
1151242433 17:72768616-72768638 GAGATAATGTGGGGCCCAGAGGG - Intronic
1151307782 17:73274529-73274551 CAGAGGATGAGGAGTCCGGGAGG - Intergenic
1151532183 17:74713637-74713659 CAGATGCTTGGGAGCCCAGAAGG + Intronic
1152163976 17:78689492-78689514 GACAGGATGTGGAGCTCAGGAGG + Intronic
1152532138 17:80924872-80924894 AAGAGGATGTGGAGCTGAGGAGG - Intronic
1153595510 18:6721189-6721211 CAGGTGGTGCAGAGCCCAGGAGG + Intergenic
1153677120 18:7465664-7465686 GACAGGAGGTGGAGCCCAGGGGG + Intergenic
1154454659 18:14510025-14510047 CAGCTGATGTGGAGCCTGGAGGG - Intronic
1155034850 18:22017613-22017635 CAGATGTTGCAGAACCCAGGAGG - Intergenic
1155078853 18:22387826-22387848 CAGATGAAGCTGAGCCCAGTTGG + Intergenic
1156076193 18:33282286-33282308 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1160516339 18:79481142-79481164 CAGACGATGGGGAGCCCCAGAGG - Intronic
1161077779 19:2294650-2294672 CAGATGACATGGAGCCGTGGTGG + Intronic
1162602025 19:11676783-11676805 CAGACGGGGTGGAGGCCAGGCGG + Intergenic
1165029916 19:32990516-32990538 TGGATGATGTGGAGTCCAGGAGG + Exonic
1166064884 19:40351789-40351811 AGGAGGATGTGGAGCCGAGGAGG + Intronic
1202636317 1_KI270706v1_random:47535-47557 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
925553854 2:5106752-5106774 CAGATGATGTGCAACCCAAAGGG - Intergenic
925940414 2:8811845-8811867 GAGATGATGTGAAGCTGAGGAGG + Intronic
927154880 2:20215817-20215839 GAGGTGTTGTGGAGGCCAGGAGG - Intronic
927914853 2:26929071-26929093 GACAGGAGGTGGAGCCCAGGGGG - Intronic
928490425 2:31777884-31777906 CAGATAAAGTGGAACCCAGAGGG + Intergenic
928799346 2:35068006-35068028 CAGATAATTTGGGGCTCAGGAGG + Intergenic
928933346 2:36648372-36648394 CAGCTGATGGTGAGACCAGGTGG + Intergenic
930930300 2:56874579-56874601 CAGCTGTTGTGGAGCCCAGAGGG + Intergenic
931489270 2:62726176-62726198 CAGCTGATGTGGAGCTCAGAGGG - Intronic
932166645 2:69513943-69513965 CAGATGCTCTGGTACCCAGGGGG + Intronic
932539613 2:72638734-72638756 CAGCTCATGTGGAGCCTAGAGGG + Intronic
932632940 2:73362341-73362363 CAGATGATGTGAAGGCCATAAGG + Intergenic
933555335 2:83823929-83823951 CAGCTGATGTGAAGCCTAGATGG - Intergenic
933599372 2:84314492-84314514 CAGGTGATGCGAATCCCAGGGGG + Intergenic
933647690 2:84825783-84825805 GAGAGGATGTGGAGCTCAGGTGG - Intronic
933977787 2:87525764-87525786 CAGATGATGGTGTGACCAGGAGG - Intergenic
934099614 2:88640733-88640755 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
934179111 2:89604008-89604030 CAGAGAATGTTGAGCCCATGTGG - Intergenic
934289395 2:91678278-91678300 CAGAGAATGTTGAGCCCATGTGG - Intergenic
934915302 2:98296652-98296674 CACATGCCGTGGAGCCCAGCGGG + Intronic
935164611 2:100559835-100559857 GAGAGGATCTGGAGCACAGGTGG + Intergenic
935449171 2:103189761-103189783 CAGCTGATGTGGAGCCCAAAAGG + Intergenic
935847944 2:107187310-107187332 CAGCTGATTAGGAGCCCAGAGGG + Intergenic
935888301 2:107648502-107648524 CAGCTGATGTGGAGCCCAGAAGG + Intergenic
936316043 2:111425043-111425065 CAGATGATGGTGTGACCAGGAGG + Intergenic
936806938 2:116345531-116345553 CACATGATGAGGAACCCAGCTGG - Intergenic
936909150 2:117572449-117572471 CTGCTGAGGTGGAGCCCAAGGGG - Intergenic
937128470 2:119489299-119489321 GAGATGAGGTGGAGCCTTGGAGG - Intronic
937195857 2:120156030-120156052 CAGCTGATGTGGAGCCCAGAGGG + Intronic
937569105 2:123334358-123334380 TAGTTGATGTGGAGCCCAGAGGG + Intergenic
938477530 2:131629549-131629571 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
938776038 2:134542533-134542555 GACAGGAGGTGGAGCCCAGGCGG - Intronic
939199768 2:139018779-139018801 CAGCTGATGTGAAGCCCAGAGGG - Intergenic
939658155 2:144853145-144853167 GACATGAGGTGGAGCTCAGGCGG - Intergenic
941200626 2:162504610-162504632 AATCTGATGTGGATCCCAGGAGG + Exonic
941929601 2:170926769-170926791 GGGATGATTTTGAGCCCAGGAGG + Intergenic
941949591 2:171139986-171140008 CACAGGAGGTGGAGCTCAGGCGG + Intronic
943092438 2:183390568-183390590 CAGCTGATATGGAGCCCAGATGG - Intergenic
943153125 2:184138781-184138803 CAGCTGGTGTGGAGCCCAGAGGG - Intergenic
943386315 2:187207793-187207815 CAGCTAAAGTAGAGCCCAGGGGG + Intergenic
944696670 2:202207760-202207782 GAGCTGAGGTTGAGCCCAGGAGG - Intronic
946664655 2:222036084-222036106 CAGATGCTCTGCAGCCCAGTTGG + Intergenic
947855830 2:233323896-233323918 CAGATGCTGTGGAGAACAAGAGG + Intronic
948701576 2:239764006-239764028 CAGAAAATGTGGAGAACAGGGGG - Intronic
1168768407 20:397692-397714 CAGATTACCTGGAGCCCAGTGGG + Intergenic
1169161530 20:3383210-3383232 GAGATGATGAGGAGACCAGGTGG - Intronic
1169671362 20:8106251-8106273 CAGAGAATTTGGAGCCAAGGAGG + Intergenic
1170232707 20:14068272-14068294 CAGAAACTGTGGAGCACAGGGGG - Intronic
1170823124 20:19771059-19771081 CAGATGAAGAGAAGCACAGGGGG + Intergenic
1171041798 20:21770878-21770900 GAGATGAGGTGGGGACCAGGAGG + Intergenic
1171053515 20:21883568-21883590 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1171936591 20:31280085-31280107 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1173389708 20:42621200-42621222 CAGGCGATCTAGAGCCCAGGGGG - Intronic
1176379814 21:6106580-6106602 GAGAAGAGGTGGAGCCCCGGCGG - Intergenic
1176792918 21:13341586-13341608 CAGAGGATTTGGAGTCCAAGAGG + Intergenic
1176819507 21:13643283-13643305 CAGCTGATGTGGAGCCCGGAGGG + Intergenic
1177452582 21:21290610-21290632 CACATGATTTGCAGCCCATGAGG - Intronic
1179743660 21:43431657-43431679 GAGAAGAGGTGGAGCCCCGGCGG + Intergenic
1180135843 21:45861250-45861272 CAGCAGATGTGAGGCCCAGGTGG - Intronic
1180364549 22:11926781-11926803 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1180477543 22:15724906-15724928 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1181458141 22:23070908-23070930 CGGCTGATGCGGAGCCCGGGCGG + Intronic
1183371083 22:37432910-37432932 CACAGGGGGTGGAGCCCAGGAGG + Intergenic
1184876151 22:47277059-47277081 CAGATGCTGAGGACACCAGGTGG - Intergenic
949842014 3:8330026-8330048 CAGATGACGTGCAGCCCCTGGGG + Intergenic
950166479 3:10804245-10804267 CAGATGACGTGCTTCCCAGGTGG - Intergenic
950213771 3:11143114-11143136 CAGATGATGTGAAGCCTTGTAGG + Intronic
950401888 3:12775366-12775388 CAGAAGAAGTGGGGCCCAGAAGG + Intergenic
950774913 3:15341149-15341171 CAGATGAGGTGGGGCCTGGGAGG - Intronic
950923158 3:16715685-16715707 CAGCTGATGTGGAGCACAGGTGG - Intergenic
951258750 3:20482008-20482030 CAGCCAATGTGGAGCCCAGAGGG + Intergenic
951822367 3:26827141-26827163 CAGCTGATGAGCAGCCCAGAGGG + Intergenic
952500775 3:33959811-33959833 CAGATCATGTAGAGCCCTGCAGG + Intergenic
952595214 3:35009362-35009384 CACATGATGTGGATTACAGGGGG - Intergenic
954135398 3:48579963-48579985 GACATGATGTGGAGCCAAAGGGG + Intronic
954138668 3:48594092-48594114 CTGGAGATGGGGAGCCCAGGAGG - Intronic
954522706 3:51243232-51243254 CAGATGATGTGGAGCCCAGGGGG - Intronic
955937200 3:64113181-64113203 CAGCTGATGTGTAGCCCAGAGGG + Intronic
956785448 3:72638490-72638512 CAGATCCAGGGGAGCCCAGGGGG - Intergenic
958464589 3:94442520-94442542 CTACTGATGTGGAGCCCAGAGGG + Intergenic
958768767 3:98402015-98402037 CAGCTGAGGTGAAGCCCAGAGGG + Intergenic
959041062 3:101423937-101423959 CAGCTGATGTGGAGCCCAGAAGG + Intronic
959169728 3:102830374-102830396 CAGTTGATATGGAGCCCAGAGGG + Intergenic
959421520 3:106135363-106135385 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
960201122 3:114837800-114837822 TAGAGGATGTGGAGATCAGGTGG + Intronic
960624994 3:119673967-119673989 CAGATGGGGTGGTGGCCAGGCGG - Intronic
961317357 3:126049679-126049701 CAGATCATGTGGAGCCTTGTGGG - Intronic
961508994 3:127389929-127389951 CAGATGTGGGGGAGCCCTGGTGG + Intergenic
961987972 3:131157922-131157944 CAGCTGATGTGAAGTCCAGAGGG + Intronic
962335693 3:134527980-134528002 CAGCTGATATGGAGCCCAGAGGG - Intronic
962486408 3:135847131-135847153 CAGCTGAACTGGATCCCAGGAGG - Intergenic
962655813 3:137542911-137542933 CAGCCTATGTGGAGCCCAGAGGG - Intergenic
963914185 3:150842406-150842428 CAGCTGATGTGGAGACTAGAGGG - Intergenic
963936642 3:151060603-151060625 CACATGATGTGGAGCACAAAGGG + Intergenic
965610551 3:170539111-170539133 CAGATTATGTAGGGCCCTGGAGG - Intronic
966320898 3:178699792-178699814 CAGCTGATGTGAAGCCCAGAGGG - Intronic
966714358 3:183000697-183000719 CAGCTGATGTGGAGCCCAAAAGG - Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967523646 3:190466522-190466544 CAGCTGATATGGAGCCCAGAGGG + Intergenic
968002011 3:195212575-195212597 GACAGGAGGTGGAGCCCAGGTGG - Intronic
969221410 4:5761271-5761293 CAGGAGATGTTGAGCCCAGTGGG + Intronic
969279738 4:6161798-6161820 TAGATGAGGTAGAACCCAGGAGG + Intronic
969424350 4:7115569-7115591 CAGGTGATGTGGAGGTGAGGAGG + Intergenic
970101131 4:12524115-12524137 CAGCTGATTTGGACCCCAGAGGG + Intergenic
972830636 4:42810129-42810151 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
972835289 4:42862937-42862959 CAGATGCTGTGGAGCCCAGCAGG + Intergenic
973200827 4:47500325-47500347 CAGATCATATGGAGCACTGGAGG + Intronic
973366116 4:49210906-49210928 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
973394481 4:49581530-49581552 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
974024323 4:56719873-56719895 AAGATGATGTTTAGCCCATGGGG - Intergenic
975022182 4:69503025-69503047 CAGCTGATGTGAAGCCAAGAGGG + Intronic
975403670 4:73965545-73965567 CAGCTGATGTGGAGCCCAGAAGG - Intergenic
976127401 4:81848719-81848741 CAGATGGCCTGGAACCCAGGGGG - Intronic
979010080 4:115355778-115355800 CAGCTGATGTGCAGCCCAGGAGG - Intergenic
979108379 4:116717289-116717311 CAGATTATGTGGAGTCCAATAGG + Intergenic
979158651 4:117429970-117429992 CAGCTGATGTGGATCCCAGAGGG - Intergenic
979464017 4:121015852-121015874 AAGATGAAGTCCAGCCCAGGAGG + Intergenic
980148261 4:129015609-129015631 CAGCTCATGTGGATCCCAGAGGG - Intronic
980257753 4:130403573-130403595 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
980520679 4:133929348-133929370 CAGATCATGTATTGCCCAGGTGG - Intergenic
981454132 4:144933839-144933861 TAGTTGATGTGGAGCCCAGAGGG - Intergenic
981849978 4:149218680-149218702 CAGCTGACATGGAGCCCAGAGGG + Intergenic
982646260 4:158027723-158027745 CAGATGATATGGAACCCAGAGGG + Intergenic
983420260 4:167507391-167507413 CACCTGATGTGGAGCCCAGAGGG - Intergenic
1202763633 4_GL000008v2_random:133402-133424 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
986754707 5:10824329-10824351 CAGATGATGTGGGGCCCAGAGGG - Intergenic
986952079 5:13101016-13101038 GACAGGAGGTGGAGCCCAGGCGG - Intergenic
987366347 5:17152475-17152497 CAGTTGCTCTGGAGGCCAGGCGG - Intronic
988252760 5:28781748-28781770 CAGATGGTGTGGCTCCCAGGTGG - Intergenic
988336340 5:29913599-29913621 CAGCTGATGTGGGGCCCAGAGGG + Intergenic
988507782 5:31838983-31839005 CAGATGATCTGGAGGGCAGGAGG - Intronic
989693348 5:44171015-44171037 CAGCTGATGTGGACTCCAGAGGG + Intergenic
991577653 5:68122017-68122039 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
991633476 5:68680167-68680189 CACAGGAGGAGGAGCCCAGGAGG + Intergenic
993311371 5:86337587-86337609 CAGGTGATGTAGAGCCCACAGGG + Intergenic
995187897 5:109290558-109290580 CAGCTGATGTGGAGCCCAAAGGG + Intergenic
995691329 5:114829544-114829566 CAGCTGATGTGGTGCCCAGAGGG + Intergenic
996626872 5:125580552-125580574 GACAGGAGGTGGAGCCCAGGCGG - Intergenic
996663075 5:126027117-126027139 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
996954325 5:129164674-129164696 CAGCTGATGTGGAGCCCAGGGGG - Intergenic
998756025 5:145380072-145380094 CAGCTGATGTAGAGCCCAGAGGG - Intergenic
999148483 5:149411244-149411266 CAGGTGATGAGGGGACCAGGCGG + Intergenic
1000406323 5:160892212-160892234 CAGATCACGTGAATCCCAGGAGG - Intergenic
1002043618 5:176530540-176530562 CAGCTGCCCTGGAGCCCAGGTGG + Intronic
1003276559 6:4658884-4658906 CAGATGAGGTGGTGCCGTGGAGG + Intergenic
1003352649 6:5332755-5332777 CACATGATATTGTGCCCAGGGGG + Intronic
1006246955 6:32745877-32745899 CAGGTGATGTTGACCACAGGAGG - Exonic
1006389586 6:33750721-33750743 CAGAGCATGGCGAGCCCAGGAGG - Intergenic
1006613603 6:35310433-35310455 CAGCTGATTTGCAGCCCTGGTGG + Intronic
1007091374 6:39186904-39186926 CAAATAATGGAGAGCCCAGGTGG + Intergenic
1007314939 6:40979594-40979616 CAGGTAGTGTGGAGCCCAGAGGG - Intergenic
1007711276 6:43825851-43825873 CAGGTGGTGTGGAGCTCTGGGGG + Intergenic
1008332462 6:50260682-50260704 CAGCTGATGTGAAGACCAGAGGG - Intergenic
1009049115 6:58257973-58257995 CAGATGAGGTGGCGGCCGGGCGG - Intergenic
1009596743 6:65745860-65745882 CAACTGATGTGGAGCCCACAGGG + Intergenic
1010547186 6:77173021-77173043 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1011009540 6:82688093-82688115 CAGATGCTGTGGACACCGGGAGG - Intergenic
1011349247 6:86404326-86404348 CAGGTTATATGGAGCCCAGGTGG + Intergenic
1011694112 6:89896562-89896584 CGGAGGATGTGGAGCAGAGGAGG + Intergenic
1012616478 6:101284432-101284454 CAGCTGATGTGGAGCCCAGTGGG + Intergenic
1013289566 6:108708678-108708700 CTGAGGATGGGGGGCCCAGGAGG - Intergenic
1014183347 6:118408363-118408385 CAGCTAATGTGGAGCCCAGAGGG + Intergenic
1014720498 6:124911860-124911882 CACAGGAGGTGGAGCTCAGGTGG + Intergenic
1014755657 6:125299704-125299726 CAGATGAAGTGGAACTGAGGAGG - Intronic
1016350847 6:143165556-143165578 CAGACGATGTGAGGCGCAGGTGG - Intronic
1016378657 6:143450546-143450568 CACATGGTGAGGAGCCCGGGAGG - Exonic
1016878956 6:148891236-148891258 CAGGTGAAGTGAAGCCAAGGAGG - Intronic
1017980658 6:159398393-159398415 GAGGAGATTTGGAGCCCAGGAGG + Intergenic
1018787707 6:167121231-167121253 CAGATGCTGAGGGACCCAGGAGG - Intergenic
1019311679 7:364959-364981 CAGCTGATGTACAGCTCAGGAGG - Intergenic
1021351233 7:19596150-19596172 CAGCTGATGTGGAGCCCAGAAGG - Intergenic
1021967291 7:25933007-25933029 CAGTCGATGTAGAGCCCAGAGGG + Intergenic
1022102288 7:27175664-27175686 CAGATCCAGTGGAGCCCGGGAGG + Intronic
1022507658 7:30916558-30916580 CACATGGAGTGGTGCCCAGGGGG + Intronic
1023241327 7:38151078-38151100 CAGCTGATACGGAGCCCAGAGGG + Intergenic
1023805797 7:43872191-43872213 GAGGTGGTGTGGAACCCAGGGGG - Intronic
1025054983 7:55758020-55758042 GACAGGATGTGGAGCTCAGGTGG + Intergenic
1025158953 7:56636373-56636395 CAGCTCATGTGGTGCCCAGAGGG + Intergenic
1026176674 7:68003675-68003697 GACAGGAGGTGGAGCCCAGGCGG + Intergenic
1027053859 7:75036925-75036947 CAGTTGATGTGCATTCCAGGAGG - Intronic
1028008821 7:85614589-85614611 CAGCTTATGTGGAGCCCAGAAGG + Intergenic
1028082972 7:86600398-86600420 CAGCTGATGTTGAGCCCAGAGGG + Intergenic
1028479780 7:91292149-91292171 CACAGGAGGTGGAGCTCAGGTGG - Intergenic
1029733699 7:102454044-102454066 CAGATGCTGCAGAGCCCTGGTGG + Exonic
1029809822 7:103036019-103036041 CTGATGAGGTGGAGCTCAGGAGG - Intronic
1032433303 7:131880347-131880369 AAGCTGGAGTGGAGCCCAGGAGG - Intergenic
1034257736 7:149733721-149733743 GAGCTGCAGTGGAGCCCAGGAGG - Exonic
1034512365 7:151546508-151546530 CAGGTGAAGAGGAGCACAGGCGG + Intergenic
1035167683 7:157001129-157001151 CAGCTACTGCGGAGCCCAGGCGG - Intronic
1035684975 8:1517331-1517353 GAACGGATGTGGAGCCCAGGAGG + Intronic
1035777900 8:2203573-2203595 CAGGTGATGTGCTGTCCAGGTGG + Intergenic
1037319793 8:17631725-17631747 CAGGTGAGGTGGAATCCAGGAGG - Intronic
1037373669 8:18206045-18206067 CAGCCGATGTGGAGCCCAGAGGG - Intronic
1037657179 8:20894932-20894954 CAGAAGATGTGCAGCAGAGGAGG - Intergenic
1037923329 8:22824797-22824819 GACAGGAGGTGGAGCCCAGGTGG + Intronic
1038483259 8:27915987-27916009 CAGAGGAGAAGGAGCCCAGGAGG - Intronic
1039594496 8:38779086-38779108 CAGCTAATCTTGAGCCCAGGAGG - Intronic
1039847348 8:41335069-41335091 AAGAGGATGTGAAGCCGAGGAGG + Intergenic
1040087898 8:43364897-43364919 CAGCTGATGCGGAGCCCAAAGGG + Intergenic
1040372241 8:46788416-46788438 CAGCTCATGTGGTGCCCAGAGGG - Intergenic
1040380615 8:46868432-46868454 CAGCTCATGTGGTGCCCAGAGGG + Intergenic
1040482694 8:47841221-47841243 CAGCCTATGTGGAGCCCAGCAGG + Intronic
1041022104 8:53648382-53648404 AAGCTGGTGTGGAGGCCAGGAGG - Intergenic
1041404542 8:57483552-57483574 CAAATAATGTGGAGCCCAGAGGG + Intergenic
1042727039 8:71889754-71889776 CAGAAGATGTGGAACCCAAAGGG - Intronic
1042976820 8:74478717-74478739 CAGCTGGTGCGGAGCCCAGAGGG - Intronic
1043024957 8:75055045-75055067 CATAAAATGTGGAGCTCAGGAGG - Intergenic
1043213855 8:77560165-77560187 CAGAGGCTGTGGAGGACAGGGGG + Intergenic
1043656483 8:82674204-82674226 CAACTGATGTGGAGCCCAGAGGG + Intergenic
1043698472 8:83251818-83251840 CAGCTGATATGGAGCCCAGAAGG - Intergenic
1044127283 8:88474192-88474214 CATCTGACGTGGAGCCCAGAGGG + Intergenic
1044313699 8:90726175-90726197 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1045006651 8:97921948-97921970 CACAGGAGGTGGAGCTCAGGTGG - Intronic
1045040622 8:98220498-98220520 GAGAGGATCTTGAGCCCAGGAGG - Intronic
1046895024 8:119463249-119463271 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1048813871 8:138312824-138312846 CAGTTGAAGTGGAGACCATGTGG + Intronic
1049047758 8:140166079-140166101 CAGGTGGTGTGGAGTCCAGCTGG + Intronic
1049128027 8:140810226-140810248 CAGCTGAGGTGGAGCCCAGAGGG + Intronic
1049243447 8:141550096-141550118 GAGACGACGTGGAGCCCTGGGGG - Intergenic
1050424761 9:5501807-5501829 CAGGTGATGTGGAGCCCAGTAGG + Intergenic
1050800315 9:9603550-9603572 CACAGGAGGTGGAGCTCAGGTGG - Intronic
1051097010 9:13477637-13477659 CAGCCTATGTGGAGCCCAGAGGG - Intergenic
1051116325 9:13698154-13698176 CAGCTGATGTGTAGCCCAGAGGG - Intergenic
1051359510 9:16269537-16269559 AAGATGATGTGGAACCAAGAAGG - Intronic
1051602656 9:18890372-18890394 CAGAGGATGAGGTGCACAGGGGG - Intronic
1051766952 9:20535134-20535156 GAGAGGAGGTGGAGCTCAGGCGG - Intronic
1051899659 9:22025094-22025116 CAGCTGATGTGGAGCCCAGAGGG - Intronic
1051959595 9:22742524-22742546 CAGATGATATAGTGCCAAGGTGG - Intergenic
1052206514 9:25847883-25847905 CTGATGATATGGACCCAAGGTGG - Intergenic
1052534116 9:29726352-29726374 CAGCTGATGTGGAGCCCAGAAGG + Intergenic
1055316282 9:75037621-75037643 GAGAGGAGGTGGAGCTCAGGAGG - Intergenic
1056208956 9:84347114-84347136 CAGAATATCTTGAGCCCAGGAGG + Intergenic
1056258603 9:84825280-84825302 AAGATAATGTGGGGCTCAGGGGG - Intronic
1056891474 9:90497781-90497803 CAGATGGTGTGGGACCCAGATGG + Intergenic
1057108567 9:92445089-92445111 CAGCTGGTGTGGAGCCCAGAGGG - Intronic
1057725455 9:97564991-97565013 CAGAGCATGGGGAGGCCAGGTGG - Intronic
1058539102 9:105993403-105993425 CAGAGGCTGGAGAGCCCAGGAGG + Intergenic
1059981716 9:119779706-119779728 AAGATGAGATGGAGCACAGGAGG + Intergenic
1060539292 9:124419005-124419027 CAGACGGTGTGGAGCCCATCGGG + Intergenic
1060603525 9:124894484-124894506 CAGCTGCTTGGGAGCCCAGGAGG - Intronic
1062643696 9:137535194-137535216 GAAATAATGTGGAGCCCAAGAGG - Intronic
1203527851 Un_GL000213v1:106287-106309 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1203544387 Un_KI270743v1:118275-118297 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
1186685724 X:11922729-11922751 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1187147255 X:16648282-16648304 CAGATGCTGAGGTGCTCAGGGGG + Intronic
1187930410 X:24288531-24288553 CAAAGGGTGTGGATCCCAGGAGG + Intergenic
1188492997 X:30755821-30755843 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
1188852589 X:35150550-35150572 CAGCCAATGTGGAGCCCAGAGGG + Intergenic
1188855405 X:35188377-35188399 CAGAGTTTGTGGACCCCAGGAGG - Intergenic
1189432797 X:40963912-40963934 CAGATTATTTGGAGGGCAGGAGG + Intergenic
1190085704 X:47393648-47393670 CAGCTGGGTTGGAGCCCAGGAGG - Intronic
1191137581 X:57082602-57082624 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1191155302 X:57266808-57266830 CAGATGATGTGGAGCCCAGGGGG + Intergenic
1191933898 X:66405266-66405288 CAGCTAATGTGGAACCCAGAGGG - Intergenic
1192261309 X:69507119-69507141 CAGATGACAAGGAGACCAGGAGG + Intronic
1192493523 X:71597390-71597412 CCGAGGATGAGGACCCCAGGGGG + Intronic
1192926475 X:75759619-75759641 CAGCTGATATGGAGCCCAGAGGG + Intergenic
1193580711 X:83259740-83259762 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1193614121 X:83667217-83667239 TAGCTGATGTAGAGCCCAGAAGG - Intergenic
1193703338 X:84790758-84790780 CAGAGGAAGCAGAGCCCAGGGGG + Intergenic
1193790319 X:85808700-85808722 CAGTTGAGGTGGAGCCCAGAGGG - Intergenic
1193823444 X:86194713-86194735 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1193960029 X:87914260-87914282 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1194247983 X:91538315-91538337 CAGATGATATGGAGCCCAGAGGG + Intergenic
1194310623 X:92301452-92301474 CAGCCTATGTGGAGCCCAGAAGG - Intronic
1194549100 X:95274052-95274074 CCGCTGATGTGGAGCCCAGAGGG + Intergenic
1194781403 X:98029034-98029056 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1195548307 X:106138392-106138414 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1196899249 X:120367004-120367026 CAACTGATGTTGAGCCCAGTGGG - Intronic
1197076901 X:122363922-122363944 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1197378797 X:125713545-125713567 CAGCTAATGTGGAGCCCAAAGGG + Intergenic
1198102254 X:133432473-133432495 CATATGATATTCAGCCCAGGAGG - Intergenic
1198591790 X:138191162-138191184 AAGATGATGTGGAACCAAGGTGG - Intergenic
1199400094 X:147389273-147389295 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1199851798 X:151729153-151729175 CTGAAGATATGGAGCTCAGGAGG + Intergenic
1200077662 X:153559624-153559646 CTGGTGATGTGGACCCCATGAGG + Intronic
1200566998 Y:4779844-4779866 CAGATGATATGGAGCCCAGAGGG + Intergenic
1200618905 Y:5415738-5415760 CAGCCTATGTGGAGCCCAGAAGG - Intronic
1201238867 Y:11938595-11938617 GAGAGGAGGTGGAGCTCAGGTGG - Intergenic