ID: 954524862

View in Genome Browser
Species Human (GRCh38)
Location 3:51261260-51261282
Sequence GAGGGCAAGCAGAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2788
Summary {0: 1, 1: 75, 2: 303, 3: 659, 4: 1750}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954524849_954524862 23 Left 954524849 3:51261214-51261236 CCCGGCTCATCTCATTGGGACTG 0: 115
1: 648
2: 1025
3: 746
4: 892
Right 954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG 0: 1
1: 75
2: 303
3: 659
4: 1750
954524850_954524862 22 Left 954524850 3:51261215-51261237 CCGGCTCATCTCATTGGGACTGG 0: 109
1: 348
2: 415
3: 240
4: 289
Right 954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG 0: 1
1: 75
2: 303
3: 659
4: 1750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954524862 Original CRISPR GAGGGCAAGCAGAAGGAGGG TGG Intronic
Too many off-targets to display for this crispr