ID: 954530122

View in Genome Browser
Species Human (GRCh38)
Location 3:51311173-51311195
Sequence GCTGCTCTTGCAGGACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954530122_954530127 29 Left 954530122 3:51311173-51311195 CCAGCTTGTCCTGCAAGAGCAGC 0: 1
1: 0
2: 1
3: 18
4: 191
Right 954530127 3:51311225-51311247 TTTTTCACCCCCTCTAGTGGTGG 0: 1
1: 0
2: 1
3: 7
4: 99
954530122_954530126 26 Left 954530122 3:51311173-51311195 CCAGCTTGTCCTGCAAGAGCAGC 0: 1
1: 0
2: 1
3: 18
4: 191
Right 954530126 3:51311222-51311244 AAATTTTTCACCCCCTCTAGTGG 0: 1
1: 0
2: 1
3: 10
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954530122 Original CRISPR GCTGCTCTTGCAGGACAAGC TGG (reversed) Intronic
900408324 1:2502099-2502121 CCTTCTCTTGCAGGTCAAGCAGG + Exonic
900899446 1:5506885-5506907 GGTGGTGTTGCGGGACAAGCTGG - Intergenic
903320363 1:22539321-22539343 GCTGCGCTTGCAGGACTGGGGGG - Intergenic
904035875 1:27558242-27558264 GGTGCCCTTGCAGGACAGGGAGG - Intronic
904047112 1:27615497-27615519 GCTGCTGCGGCACGACAAGCTGG - Exonic
904723146 1:32526104-32526126 GCTGCTCTTGCAGCTCAGCCTGG - Intronic
908424567 1:63993766-63993788 TCTGCTATTGCTGGACAAGTAGG + Intronic
911153745 1:94619726-94619748 GATGCACATGCAGGACAGGCAGG + Intergenic
911270006 1:95789712-95789734 GCTGCTCTTGCAACAATAGCAGG - Intergenic
912985104 1:114419751-114419773 GCTGCTCTTACAGGAGCAGGGGG + Intronic
913006710 1:114640027-114640049 GCTGCTTTTGTAGCAAAAGCTGG + Intronic
913091756 1:115480844-115480866 GCTGCTGATGCTGGACAAGCAGG + Intergenic
914394282 1:147250370-147250392 GCTGCTCTGGCAGGGGAAGAGGG + Intronic
916166477 1:161970839-161970861 GCTGCCATGGCAGCACAAGCCGG - Intergenic
1066429456 10:35337280-35337302 GCTGCTCTTGCTTGCCCAGCCGG + Intronic
1067508494 10:46876320-46876342 GCTTCCCTTGGAGGACAAGTGGG + Intergenic
1067653754 10:48175529-48175551 GCTTCCCTTGGAGGACAAGTGGG - Intronic
1067720364 10:48723420-48723442 TCTTCTCTTGCAGGAGACGCTGG + Exonic
1068590125 10:58844733-58844755 GCTCATCTTGCAGGGCCAGCTGG - Intergenic
1069688787 10:70336013-70336035 GCTGATCTTGCAGGGGAGGCAGG - Intronic
1069813720 10:71180357-71180379 GGTGCTCTGGCAGGAGGAGCTGG - Intergenic
1069950312 10:72014229-72014251 GCAGCTCTTGGGAGACAAGCAGG - Intergenic
1073244669 10:102081263-102081285 ACTGCTCTGCCAGGCCAAGCTGG + Intergenic
1075014953 10:118903796-118903818 GCTGCCCTTCCAGGCCATGCTGG - Intergenic
1075158577 10:120002450-120002472 GCTGCCCTGGAAGGACAGGCAGG - Intergenic
1076497473 10:130906285-130906307 GCTGTTCCTGCAGCATAAGCTGG + Intergenic
1081187148 11:40057837-40057859 TCTGAATTTGCAGGACAAGCTGG - Intergenic
1081911216 11:46701065-46701087 GCTGCTCTTGGAGGGGAAGAAGG + Exonic
1083320840 11:61845458-61845480 GGGGCTCTTGAAGGACAAGCAGG + Intronic
1084530225 11:69722944-69722966 GCTTCTCCTGCTGGAGAAGCAGG + Intergenic
1085304570 11:75477786-75477808 CTTCCTCCTGCAGGACAAGCTGG - Exonic
1085306765 11:75490728-75490750 GCTGCTTTAGAAGAACAAGCTGG - Intronic
1085529481 11:77183052-77183074 GCTGGGCCTGCAGGACCAGCAGG - Exonic
1089567211 11:119378148-119378170 GCTGACCTTGAAGGACAAGGTGG + Intronic
1091788566 12:3257898-3257920 GATGGTTCTGCAGGACAAGCAGG + Intronic
1092888742 12:12949436-12949458 GGTGCTCCTACAGGAGAAGCAGG - Intronic
1096590051 12:52652008-52652030 GCGGCTCAAGCAGGAGAAGCTGG + Exonic
1099051545 12:77787122-77787144 GCTGGTCTTAAAGGACAAGTGGG - Intergenic
1100815110 12:98379379-98379401 GTTGCTCTGGCAGTACATGCTGG - Intergenic
1101303346 12:103503664-103503686 TCTGCTCCTGCAGCACCAGCAGG - Intergenic
1102056993 12:109904012-109904034 GCAGCTCATGCAGGAGGAGCAGG + Exonic
1102667125 12:114584242-114584264 GCTGGTCTTACAGGAAAAGCAGG - Intergenic
1102877841 12:116461563-116461585 GGTGCTCTCGCAGGCCCAGCTGG - Intergenic
1104592871 12:130098728-130098750 GCTGCTGTTCCAGGGCATGCTGG - Intergenic
1104738503 12:131154797-131154819 GCTGTTCTTGCAGGTGGAGCTGG - Intergenic
1107425740 13:40291082-40291104 GCTGATCTCTCAGGAGAAGCAGG + Intergenic
1112580158 13:100671616-100671638 TCTGCTCTTGCAGGGACAGCAGG + Intronic
1113849104 13:113407901-113407923 GCTGATCTCCAAGGACAAGCAGG - Intergenic
1118321661 14:64757041-64757063 GCCCCTCTTGGAGGAAAAGCAGG - Intronic
1120736425 14:88057950-88057972 GCTGCTCTTTCTGTCCAAGCAGG + Intergenic
1121095766 14:91217078-91217100 GCCCCTCTTGGAGGAGAAGCTGG + Intronic
1123466476 15:20520100-20520122 GCTGCTCTGTAAGGACAAGAAGG - Intergenic
1123651638 15:22480937-22480959 GCTGCTCTGTAAGGACAAGAAGG + Intergenic
1123742059 15:23289801-23289823 GCTGCTCTGTAAGGACAAGAAGG + Intergenic
1123744937 15:23312757-23312779 GCTGCTCTGTAAGGACAAGAAGG - Intergenic
1124277205 15:28336078-28336100 GCTGCTCTGTAAGGACAAGAAGG - Intergenic
1124305496 15:28575528-28575550 GCTGCTCTGTAAGGACAAGAAGG + Intergenic
1124838051 15:33214754-33214776 GCTGCTCTTGGAGAAGAAGGAGG + Intergenic
1125749470 15:42018940-42018962 TCTGCTCTGGCAGGCCCAGCTGG + Intronic
1130977169 15:88785496-88785518 GCTGATCTAGCAGGGGAAGCTGG + Intergenic
1131266308 15:90917489-90917511 GCTGTTCAGGCAGGACATGCTGG + Intronic
1131872386 15:96775937-96775959 CCTGCTCTTGAAGGATATGCAGG - Intergenic
1133147625 16:3801638-3801660 GTTGCTCTTGTTGCACAAGCTGG - Intronic
1133969360 16:10556454-10556476 GCTGCTGTCACAGGACAAGTAGG + Intronic
1136656990 16:31715370-31715392 GCTGCTCTTGAAGAACAAAAAGG + Intronic
1136946163 16:34653906-34653928 ACTGCTCTTGAAGGTGAAGCAGG - Intergenic
1137454381 16:48607238-48607260 GCAGGTCTGGCAGGACCAGCAGG + Intronic
1138541685 16:57691462-57691484 GCTGCTTTTGCAGGAACCGCAGG - Intergenic
1139551491 16:67675457-67675479 GCTGCTCTTGAGGGACTCGCTGG - Exonic
1141125916 16:81401124-81401146 GCAGCTCTTCCAGGATCAGCTGG - Intergenic
1141941446 16:87278727-87278749 GCAGCATTTTCAGGACAAGCAGG + Intronic
1145882393 17:28361727-28361749 GCTCCTCTTCCAGCACAAACTGG - Exonic
1147135917 17:38434214-38434236 GCTCCTCCTCCAGGAGAAGCTGG - Intronic
1149993229 17:61394207-61394229 GCTGAGCTTGCAGGACAATCTGG + Intergenic
1150746194 17:67818800-67818822 GATGCTTTACCAGGACAAGCTGG + Intergenic
1151155869 17:72122767-72122789 GCTGCGCGTGCAGCACAAGAAGG + Exonic
1153001846 18:463010-463032 GCTGTTCTCTCAGGAGAAGCGGG + Intronic
1155017784 18:21862871-21862893 GCTGCTCTTGCATAAAAAGAAGG - Intronic
1156799022 18:41086063-41086085 CCTACTCCTGCAGTACAAGCAGG + Intergenic
1157470000 18:47981864-47981886 GCTCCTCTCGCAGGACATGCTGG + Intergenic
1157922919 18:51732199-51732221 GCTGATGTTCGAGGACAAGCTGG + Intergenic
1159885714 18:73903203-73903225 GCTGCTCTTGCAGGAGAAGGTGG - Intergenic
1160456188 18:79003087-79003109 GCTGCTGCAGCAGAACAAGCAGG + Intergenic
1161125539 19:2555402-2555424 GCTTCTCTTGCTGGACAACAGGG + Intronic
1162761609 19:12891859-12891881 GCTGCTCCTCCAGCACCAGCGGG - Exonic
1163678692 19:18668576-18668598 GCTGCGCCTGCAGGCCATGCAGG + Exonic
1164430843 19:28187422-28187444 GGTGCTCTTGCAGTACCATCAGG + Intergenic
1164699802 19:30276930-30276952 GTTGCTTTTGCACAACAAGCAGG + Intronic
1164785384 19:30926421-30926443 GAGGCTCTGGCAGGACATGCTGG - Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166385067 19:42376238-42376260 GCTCCTCTGGAAGGCCAAGCAGG + Exonic
1167233974 19:48302799-48302821 GCTGCTCCTGCAGCAAATGCTGG + Exonic
1167330620 19:48853717-48853739 GCGCCTCTTGCAGGACCGGCTGG - Exonic
925650108 2:6080786-6080808 GTTGCTCATGCAGCACCAGCTGG + Intergenic
932187227 2:69708622-69708644 GCTCATCCTGCAGGACCAGCAGG + Intronic
933742516 2:85546052-85546074 TCTACATTTGCAGGACAAGCTGG - Exonic
933749347 2:85593159-85593181 GCTTCTCCTTCAGGACCAGCTGG - Exonic
936981054 2:118265729-118265751 GCTGCTGATGCACAACAAGCAGG - Intergenic
937033807 2:118764000-118764022 TCTGCTCAGGCAGGAGAAGCAGG - Intergenic
941013187 2:160324630-160324652 GCTGCTCCTGAAGGACAAACAGG + Intronic
942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG + Intergenic
942967919 2:181919377-181919399 GCTGCTCCTCCAGGCCCAGCAGG - Exonic
947255722 2:228161666-228161688 GGTGCACGTGCAGGACATGCAGG - Intronic
948456408 2:238106525-238106547 GCTGCTCCAGCAGGAGGAGCTGG - Intronic
948835110 2:240622674-240622696 GCAGCTCTAGCTGGAGAAGCAGG + Intronic
948854234 2:240722614-240722636 CCTGCTCCTGCGGGAGAAGCTGG - Exonic
1168807671 20:682093-682115 GCCACTCTTCCAGGACAGGCCGG - Intergenic
1169221262 20:3824393-3824415 GCTGCTATACCAGGACAAGTGGG + Exonic
1170530660 20:17287930-17287952 GCTGCTCTTTCAGGGTGAGCTGG - Intronic
1170948031 20:20909567-20909589 GCTGCTGTTGTAGGAAAACCCGG + Intergenic
1171006663 20:21472760-21472782 GCAGCTTTTGAAGGAAAAGCTGG - Intergenic
1172302118 20:33857675-33857697 GCAGCTTTTGCAGGACAGGGAGG - Intergenic
1172887458 20:38240830-38240852 GCTGCAGCTGCAGGAGAAGCTGG + Exonic
1173934585 20:46850253-46850275 GATGCTTTTCCAGGACAAGATGG + Intergenic
1179231081 21:39504370-39504392 GCTGCCCTTGCAGGTCACGCTGG + Intronic
1179993098 21:44958759-44958781 GCTGCTCCTGCAGGAGGAGAGGG - Intronic
1180088281 21:45517901-45517923 GCAACTCCTGCAGGTCAAGCGGG - Intronic
1180948171 22:19708208-19708230 GCTGCTTTTGCAGGAAAGGAGGG - Intergenic
1181344852 22:22211573-22211595 GCTGCTCTTCCTGGAGAAGAAGG + Intergenic
1183083309 22:35471136-35471158 GCTGCTGTTGCAGAGCAGGCTGG + Intergenic
1183524122 22:38313884-38313906 GCTCCTCTCGCAGGCCAGGCTGG - Intronic
1184152130 22:42645416-42645438 TGTGCTCTTGGAGGACAAGCGGG - Intronic
1184173764 22:42774580-42774602 TGTGCTCTTGCGGGGCAAGCAGG + Intergenic
1184857006 22:47151801-47151823 GCTGCTCTTTCCCGACAGGCCGG - Intronic
1184882590 22:47319947-47319969 CCTGTTCTTGCAGGACGTGCTGG + Intergenic
1184913934 22:47554051-47554073 TCTGCTTCTTCAGGACAAGCCGG - Intergenic
1185149217 22:49154514-49154536 GCTGGTTTTCCAGGACAAGAAGG + Intergenic
950500076 3:13358224-13358246 GCTGCTGCAGCAGAACAAGCAGG - Exonic
950863942 3:16174268-16174290 GCTGCTCTTGTGGGAGAAGAAGG + Intergenic
953359171 3:42280060-42280082 GCTGCTGTTCCAGCTCAAGCTGG + Intergenic
954530122 3:51311173-51311195 GCTGCTCTTGCAGGACAAGCTGG - Intronic
959304169 3:104639038-104639060 TATGCTCTTGAAGGACAAGTGGG + Intergenic
959530846 3:107431911-107431933 GCTTTTCTTCCAGGACAATCGGG + Intergenic
961368638 3:126416405-126416427 GCTGCAGCTGGAGGACAAGCAGG + Exonic
963100670 3:141600542-141600564 GCTGATCCTGAAGGCCAAGCTGG - Intronic
966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG + Intronic
967890116 3:194358984-194359006 GCTGTTCTTGGAGGACAGGTGGG + Exonic
967971644 3:195003806-195003828 GCTGCTGTTGCAGGACCACCTGG + Intergenic
969630740 4:8334516-8334538 GCTGCTCTTGCAGGACAGCAAGG - Intergenic
969833414 4:9817829-9817851 GCTGCTCTTGCAGAACAGGATGG - Intronic
969834773 4:9831707-9831729 GCTGACCTTGAAGGGCAAGCTGG + Intronic
971146065 4:23977649-23977671 GATACACGTGCAGGACAAGCAGG - Intergenic
971918965 4:32911491-32911513 GGAGCTCTTGCAAGACAGGCAGG - Intergenic
972149008 4:36065215-36065237 CCTGCTCTTGCAGGTGGAGCGGG + Intronic
973231048 4:47838676-47838698 GCTGCTTTTGAATGACAGGCAGG - Intergenic
974052306 4:56952422-56952444 TGTGCTCTGGCAGGACAAGCGGG + Intergenic
976207399 4:82636191-82636213 GCTCCTCTGGCAGGCCAAGGAGG + Intronic
978659627 4:111108963-111108985 GATGCTCTTCCAGGACAGGAAGG + Intergenic
982291676 4:153788722-153788744 GCTGCGCTTGTAGGAGAAGTCGG + Exonic
983371785 4:166869159-166869181 CCTGATCTTGCAGGATCAGCAGG + Intronic
985794262 5:1950269-1950291 GCTGCACTCTCAGGACCAGCTGG - Intergenic
989721057 5:44528642-44528664 GCTGCTCTTGAAGTAAAAGGAGG + Intergenic
991674106 5:69075187-69075209 GCAGCTCCTCCAGGACAGGCGGG - Intergenic
993118398 5:83744994-83745016 CTTCCTCTTGCATGACAAGCTGG - Intergenic
994248606 5:97510468-97510490 GCTGCTTTTGCAGGAAAAGTGGG - Intergenic
995251511 5:109998406-109998428 TTTGCTTTTGCAGGACAAGTAGG + Intergenic
997253950 5:132412261-132412283 GCTGCTCTTGCCGGGCACGGTGG + Intronic
1000398055 5:160796795-160796817 CCTGCACTTGGAGGACAAGAAGG + Intronic
1001462871 5:171933702-171933724 GCTTCCTTTGCAGGATAAGCAGG - Intronic
1001551082 5:172602806-172602828 GCCACTCTGGCAGGACAAGGAGG - Intergenic
1002169267 5:177366316-177366338 GCGGCTGTTGCAGGACCCGCTGG + Exonic
1003171230 6:3723458-3723480 GCTCCACTTGCAGGACACCCAGG + Exonic
1004874943 6:19941804-19941826 GCTGCATTTGCAGGAAAATCAGG + Intergenic
1007152502 6:39708044-39708066 CCTGCTCTTTCAAGACAAGGAGG - Intronic
1007806602 6:44454855-44454877 GCTGCTCTTGCCACACAAGAAGG + Intergenic
1011672878 6:89700847-89700869 GTTGTTGTTTCAGGACAAGCTGG - Exonic
1013761045 6:113518350-113518372 CCTGCACTTGATGGACAAGCTGG + Intergenic
1015516216 6:134085111-134085133 TTTGCTCTTGCTGCACAAGCTGG - Intergenic
1016546134 6:145226623-145226645 CCTGCGCTTGGAGGAAAAGCAGG + Intergenic
1017396851 6:154010825-154010847 GCTGCAATTACAGGAAAAGCAGG - Exonic
1018859132 6:167698451-167698473 CCTGCTCTTGCCTGACACGCAGG - Intergenic
1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG + Exonic
1020033947 7:4952440-4952462 GCTGTTCTTTCAGCACCAGCAGG - Intronic
1020490528 7:8777949-8777971 GCTGCTCTTGCAGCAGAATAAGG + Intergenic
1021928995 7:25561264-25561286 GCTCCCCTGGCATGACAAGCAGG + Intergenic
1022146910 7:27553498-27553520 GTTGCTCTTTCAGCATAAGCAGG - Intronic
1026867696 7:73833520-73833542 GCTGGGCTTTCAGGACGAGCAGG - Intergenic
1027933318 7:84568684-84568706 CCTGGCCTAGCAGGACAAGCTGG - Intergenic
1029911191 7:104150268-104150290 GAAGCTCCTCCAGGACAAGCAGG - Intronic
1033556165 7:142490047-142490069 GGAGCTCTGGCAGGACAGGCTGG + Intergenic
1034927620 7:155135127-155135149 GCAGCTCTTGGAGGACGAGCCGG - Intergenic
1035337581 7:158139759-158139781 GTTGTTCTTACAGGACATGCAGG - Intronic
1036022466 8:4860866-4860888 GTTTCTCTAGCAGGAGAAGCAGG - Intronic
1036663946 8:10726583-10726605 GCTGCGCCTGCAGCACATGCAGG - Exonic
1039443931 8:37615186-37615208 GCTGCTGGTTCAGGAAAAGCAGG + Intergenic
1041107845 8:54459119-54459141 GCTGCGCGTGCAGCACATGCAGG + Exonic
1042535380 8:69853392-69853414 ACTGATCTTTCAGGAAAAGCTGG + Intergenic
1043200668 8:77365514-77365536 GGAGCTCTTGTAGGGCAAGCTGG - Intergenic
1047166314 8:122442916-122442938 TCTGCTCATGCAGGACATTCTGG - Intergenic
1047249952 8:123174516-123174538 GCTGCTCCTGGAGGTCAAACAGG + Intergenic
1047271969 8:123369112-123369134 CTTGGTCTTGCAGGAGAAGCTGG + Exonic
1047982368 8:130196477-130196499 GCTGCTCCAGCAGGACAGGGTGG - Intronic
1049003643 8:139841470-139841492 GCTGCTTCTGCCAGACAAGCAGG - Intronic
1049681817 8:143922248-143922270 GCAGCTCTTCCAGGACGAGGTGG - Exonic
1052666421 9:31500439-31500461 GCTGCACTGGCAGGACAGACAGG + Intergenic
1052944017 9:34152988-34153010 CTTGCTCTTGTAGCACAAGCTGG - Intergenic
1055719751 9:79158837-79158859 GCTGTTCTTGGATGAAAAGCAGG + Intergenic
1055848035 9:80591290-80591312 GCTGCTAATGAAGCACAAGCAGG - Intergenic
1056958973 9:91105126-91105148 GTTGCTCTTCCTGGACAGGCCGG - Intergenic
1060242870 9:121919639-121919661 GCCCCACTTGCAGGACAAGCTGG - Intronic
1062006134 9:134239467-134239489 CCTGCTCTTCCAGGCCAAGAGGG - Intergenic
1062609250 9:137366599-137366621 ACTGCTCCTCCAGGACAAGGTGG - Exonic
1186855050 X:13618334-13618356 ACTGCCCTTGCAGGACTAGCAGG - Intronic
1187392311 X:18894200-18894222 GCTGTTCTTGCAGGACCAGGTGG - Exonic
1189418205 X:40833017-40833039 GCGGCGCCTGCAGGACCAGCTGG - Intergenic
1192937758 X:75878911-75878933 CCTGCTCTTGCATGACAACTGGG - Intergenic
1195327765 X:103771819-103771841 TCTGCTGTGGCAAGACAAGCTGG - Intergenic
1195758209 X:108220133-108220155 ACTGCTATTCCAGGATAAGCAGG - Intronic
1196336961 X:114548640-114548662 GATACACGTGCAGGACAAGCAGG + Intergenic
1199766222 X:150943428-150943450 GCTGCCCTTGCTGGACTACCTGG + Intergenic
1200141640 X:153905556-153905578 GCTGCTGTTGCTGGGCAGGCTGG - Exonic