ID: 954533332

View in Genome Browser
Species Human (GRCh38)
Location 3:51339316-51339338
Sequence GAACCTGGTGCACCAGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954533332_954533336 29 Left 954533332 3:51339316-51339338 CCAAATTCTGGTGCACCAGGTTC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 954533336 3:51339368-51339390 ATGAACAGAGAGCCTTTTTTAGG 0: 1
1: 0
2: 0
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954533332 Original CRISPR GAACCTGGTGCACCAGAATT TGG (reversed) Intronic
900698330 1:4026934-4026956 GAAGCTGGGGCACCAGATTAGGG + Intergenic
903389977 1:22956725-22956747 GAAGCTGGGGCACGGGAATTGGG - Intronic
904351234 1:29908135-29908157 GAACCAGGTGCACCCGATTGAGG + Intergenic
905277072 1:36825254-36825276 GCACCTGGTGCAGCAGACTCAGG - Intronic
911084480 1:93965069-93965091 GAGGATGGTGCACCAGAAATGGG - Intergenic
911503193 1:98714646-98714668 AACACTGGTGCTCCAGAATTTGG - Intronic
915284709 1:154845426-154845448 GAACCAGATGCACCTGCATTTGG + Intronic
915654247 1:157346060-157346082 GAATCTGGTGCTCCTGTATTGGG + Intergenic
918773330 1:188593165-188593187 GAAACTGGTGCTGCAGAATGGGG + Intergenic
918975018 1:191472856-191472878 GAATCTGGTGCTCCTGTATTTGG - Intergenic
919233721 1:194809480-194809502 GAGCCTGATGCAGCAGAATTCGG + Intergenic
924171713 1:241349254-241349276 GAAGCATGTGCACTAGAATTGGG - Intronic
1062908433 10:1195614-1195636 GATCCTGGTTCAGAAGAATTGGG + Intronic
1064331681 10:14400195-14400217 GAACTAGGTGCAAGAGAATTGGG - Intronic
1067260431 10:44685093-44685115 GAACCAGGTGAACCAGAGTTGGG + Intergenic
1068609711 10:59045564-59045586 CAACATGGTCCACCAGAAATGGG + Intergenic
1069397967 10:68010320-68010342 GAGCCTGGGGCACCAAAATGGGG + Intronic
1070873200 10:79776655-79776677 AAACCTGGTGTTCCAGAGTTAGG + Intergenic
1071524316 10:86349312-86349334 TAAGCTTGTGCACCAGAACTTGG - Intronic
1071796828 10:89016676-89016698 GAACCAGGTTCACCAGAATGAGG - Intergenic
1077843011 11:5994998-5995020 GAAGCTGGTGGACCAGAACATGG + Intergenic
1079228501 11:18629042-18629064 GTACCAGGTATACCAGAATTTGG - Intronic
1080031683 11:27667738-27667760 GAATCTGGTGCTCCTGTATTAGG - Intronic
1081656239 11:44859273-44859295 GGACCTGGAACACCAGACTTGGG - Intronic
1091438574 12:494740-494762 GAGCCTGGTGCTCCAGTTTTTGG - Intronic
1092316596 12:7422800-7422822 GAATCTGGTGCTCCTGTATTGGG - Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1096289558 12:50330092-50330114 GAATCTGGTTCAACAGATTTTGG + Intronic
1097315209 12:58164503-58164525 GAACCTTGTAGACCAGATTTGGG + Intergenic
1099186913 12:79525006-79525028 CAACCTGGTGGTCCCGAATTGGG + Intergenic
1103739827 12:123083708-123083730 GGTCCTGGAACACCAGAATTTGG + Intronic
1114528288 14:23379642-23379664 GAGCCTGGTGCTCCAGGATGTGG + Exonic
1114701875 14:24686929-24686951 GTACCTGGTTCAGCAGAGTTGGG - Intergenic
1114980916 14:28162931-28162953 GAACCTTGGGAGCCAGAATTTGG - Intergenic
1118336797 14:64860346-64860368 CATCCTGGTGCCCCAGAATGGGG + Intronic
1128661575 15:69505074-69505096 GAACCTGGTGCTGCAGAGTGAGG + Intergenic
1134261165 16:12652062-12652084 GATCCTGGGGAACCAGAAATTGG - Intergenic
1134615656 16:15649732-15649754 GAACGTAGTGCACCAGAATTTGG - Intronic
1137491647 16:48938033-48938055 GAACCTGGGCCTCCAGAATGTGG + Intergenic
1137550758 16:49435940-49435962 GAACCTGGGGTACCAGAGTAAGG - Intergenic
1138410911 16:56839535-56839557 GAAGCTGGTGCCCCTGAATCAGG + Exonic
1140296432 16:73713512-73713534 GAAGCTGGCGCAGCAGCATTCGG + Intergenic
1143180488 17:4981285-4981307 ACACCTGGTGCAGCAGATTTTGG - Exonic
1146637863 17:34519432-34519454 GAACCTGGTGGTCCAGGACTTGG + Intergenic
1150646006 17:66977875-66977897 GACCCTGGGGCACCAGCAGTAGG + Intronic
1151550841 17:74821744-74821766 GGAGCTGGAGCACCAGACTTAGG - Intronic
1153523179 18:5971001-5971023 GCACCTGGAGCATAAGAATTGGG - Intronic
1153674699 18:7446454-7446476 GGACAAGGTACACCAGAATTGGG + Intergenic
1155341129 18:24815256-24815278 GACCCTGGTGGATAAGAATTAGG - Intergenic
1161700045 19:5789518-5789540 GAACCTGGTGCAGGAGGAGTTGG - Exonic
1166048479 19:40243543-40243565 GAAGCTGGTGGACAAGAAGTAGG + Intronic
1168147694 19:54429177-54429199 GAGCCTGGAGGATCAGAATTAGG - Intronic
925676303 2:6365468-6365490 GATCCTGATGGACCAGAATGTGG - Intergenic
926800345 2:16654585-16654607 GAAAATGGGGCACCAGGATTTGG - Intronic
930792010 2:55342670-55342692 GTACATGGGGCCCCAGAATTTGG + Intronic
932196332 2:69787279-69787301 GAACCTGTAGTACCATAATTTGG - Intronic
937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG + Intergenic
938699715 2:133865331-133865353 GAAGCAGGTGCAACAGAATCTGG - Intergenic
942093888 2:172519979-172520001 ACAGCTGGTGCACCAGAATGCGG + Intergenic
945678538 2:212884913-212884935 GAATCTGGTGCTCCTGTATTGGG - Intergenic
1168802173 20:650641-650663 GAACCTGGCACACCTGACTTTGG + Intronic
1169058734 20:2644823-2644845 GAACTTGGTGCTCCAGCTTTGGG - Intergenic
1169682445 20:8230898-8230920 CAACCTGGTGCACCATGGTTTGG - Intronic
1172662734 20:36578636-36578658 GAGCCTGGGACACCAGAAATGGG - Intronic
1173313470 20:41921529-41921551 GAACCAAGTGAACCAGAGTTTGG - Intergenic
1179992666 21:44956758-44956780 GAACCAGGCTCACCAGAGTTGGG - Intronic
1181159182 22:20947116-20947138 GAACCTGGACCAGCAGAAGTAGG - Intronic
1184479187 22:44737118-44737140 GAACCTGGTGGACCAGATCCTGG + Exonic
1185253255 22:49816804-49816826 GCACCTTGGGCCCCAGAATTCGG - Intronic
950810461 3:15645594-15645616 GAATCTGGTGCCACAGAAGTGGG - Exonic
954533332 3:51339316-51339338 GAACCTGGTGCACCAGAATTTGG - Intronic
955418991 3:58718492-58718514 GCACCTGGTATATCAGAATTAGG + Intronic
957640152 3:82843056-82843078 GAATCTGGTGCTCCTGTATTGGG + Intergenic
957696593 3:83647829-83647851 GAATCTGGTGCTTCAGTATTGGG + Intergenic
961211394 3:125128763-125128785 GAACCTGCTGGATCAGAATGGGG - Intronic
962518866 3:136179507-136179529 TATCCTGGTTCATCAGAATTTGG - Intronic
963103335 3:141625282-141625304 GAACCTGGAGGACCAGGAATGGG + Intergenic
963979415 3:151520022-151520044 GAATCTGGTGAACCAAAAGTTGG - Intergenic
964291436 3:155185411-155185433 GAACCTGGTGAAGTAGATTTTGG + Intergenic
966563069 3:181345193-181345215 GCACCTTGTACACCAGACTTAGG - Intergenic
969414950 4:7052085-7052107 GAACCTGGTGCAGCAGCCATCGG + Intronic
972121614 4:35710720-35710742 GGACCAGTTGCACCAAAATTGGG - Intergenic
973257018 4:48123883-48123905 GAAGCTGGTGCAGCAGGAATTGG - Intronic
976082541 4:81372277-81372299 TATCTTGATGCACCAGAATTGGG + Intergenic
976083655 4:81384924-81384946 GAATCTGGTGCTCCTGTATTGGG - Intergenic
976091769 4:81465724-81465746 GAAGCAGGTGCACCAGGATAAGG + Intronic
976170666 4:82301210-82301232 GAATCTGGTGCTCCTGTATTGGG + Intergenic
979750456 4:124273037-124273059 GAATCTGGTGCTCCTGTATTGGG + Intergenic
983377635 4:166950406-166950428 GAATCTGGTGCTCCTGTATTGGG - Intronic
983958566 4:173725612-173725634 GAATCTGGTGCTCCTGTATTGGG + Intergenic
985620503 5:952443-952465 GAACCTGGTGCCCCTGAGTCCGG + Intergenic
989414615 5:41159282-41159304 GATCATGGTGCAGCTGAATTTGG + Intronic
990127436 5:52535693-52535715 GAATCTGGTGCTCCTGTATTGGG - Intergenic
991588800 5:68226955-68226977 GAACCTGGTGCAACAGGAAGAGG - Exonic
994265867 5:97715583-97715605 CAACCTGGTGGGCCAGAATTAGG + Intergenic
999898092 5:156056466-156056488 TCAGCTGGTGCATCAGAATTCGG - Intronic
1001692487 5:173643437-173643459 GAAGCTGATGCAACAGAATTGGG + Intergenic
1002319471 5:178366325-178366347 TAACCTGGTGCACCAGAGGATGG - Intronic
1003891568 6:10568340-10568362 GATCCTGGGGTACCAGAAGTGGG - Intronic
1005980356 6:30831614-30831636 GGACCTGGTGCCCCTGAGTTGGG + Intergenic
1007271350 6:40639665-40639687 GAACATGGTTCATCAGAGTTGGG - Intergenic
1007406189 6:41637576-41637598 GAACCTGGTCCCCGAGAATGGGG - Intronic
1011518705 6:88180860-88180882 GAACCTGGTTCAGCATGATTAGG + Intergenic
1014303144 6:119708510-119708532 GAACCTGATGGACCACCATTTGG - Intergenic
1017809787 6:157976649-157976671 TCACCTGGTGCACCAGCATGAGG + Intergenic
1020867711 7:13588343-13588365 GAATCTGGTGCTCCTGTATTGGG + Intergenic
1023143171 7:37122607-37122629 GAATCTGGTGCTCCTGTATTGGG - Intronic
1023204022 7:37728798-37728820 AATCCTGGTGCACCAGGATAGGG + Intronic
1033038353 7:137895861-137895883 GATCCTGGGTCACCAGAAATGGG - Intronic
1035936691 8:3849311-3849333 GAAGTTTCTGCACCAGAATTTGG + Intronic
1040605126 8:48923964-48923986 GAAATTGGTGCTCCATAATTAGG + Intergenic
1044931390 8:97255126-97255148 GAACCCAGTGCAACAGAAATAGG - Intergenic
1049954179 9:676513-676535 GAACTTTTTGAACCAGAATTTGG + Intronic
1050561766 9:6841437-6841459 GAACCTTGTTCCCCAAAATTAGG - Intronic
1050958941 9:11702931-11702953 GAACATGCTGCAACAGAACTAGG - Intergenic
1053164482 9:35834992-35835014 ATACCTGGGGGACCAGAATTAGG - Exonic
1058959013 9:109975318-109975340 GAACCAGGGGCACCAGAAGACGG + Intronic
1059402411 9:114078475-114078497 GGCCCTGGAGCACCAGGATTGGG + Intergenic
1059983374 9:119797560-119797582 TAAGATGGTGCACCAGAATGAGG - Intergenic
1060229513 9:121816240-121816262 GAACCTGTTGCATCAGAATGGGG - Intergenic
1061299104 9:129694609-129694631 GAATCTGGTGCATCAGGATGTGG + Intronic
1189204719 X:39227852-39227874 GAACCTGGTGCAGCAGTACCTGG + Intergenic
1192550448 X:72049274-72049296 GAACCTGGTGGCCCAGAATGCGG + Intergenic
1195661130 X:107379690-107379712 GAATCTGGTGCTCCTGTATTGGG + Intergenic