ID: 954535121

View in Genome Browser
Species Human (GRCh38)
Location 3:51354227-51354249
Sequence CCACCAAATAATTTTAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 287}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954535121_954535125 0 Left 954535121 3:51354227-51354249 CCCCATTTAAAATTATTTGGTGG 0: 1
1: 0
2: 2
3: 34
4: 287
Right 954535125 3:51354250-51354272 CACCCATAGCAATCACTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 91
954535121_954535129 16 Left 954535121 3:51354227-51354249 CCCCATTTAAAATTATTTGGTGG 0: 1
1: 0
2: 2
3: 34
4: 287
Right 954535129 3:51354266-51354288 TCCTTGGTAACATTGGAGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 107
954535121_954535131 17 Left 954535121 3:51354227-51354249 CCCCATTTAAAATTATTTGGTGG 0: 1
1: 0
2: 2
3: 34
4: 287
Right 954535131 3:51354267-51354289 CCTTGGTAACATTGGAGTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 88
954535121_954535133 23 Left 954535121 3:51354227-51354249 CCCCATTTAAAATTATTTGGTGG 0: 1
1: 0
2: 2
3: 34
4: 287
Right 954535133 3:51354273-51354295 TAACATTGGAGTCAGGGTCAGGG 0: 1
1: 0
2: 1
3: 24
4: 255
954535121_954535128 9 Left 954535121 3:51354227-51354249 CCCCATTTAAAATTATTTGGTGG 0: 1
1: 0
2: 2
3: 34
4: 287
Right 954535128 3:51354259-51354281 CAATCACTCCTTGGTAACATTGG 0: 1
1: 0
2: 0
3: 8
4: 104
954535121_954535132 22 Left 954535121 3:51354227-51354249 CCCCATTTAAAATTATTTGGTGG 0: 1
1: 0
2: 2
3: 34
4: 287
Right 954535132 3:51354272-51354294 GTAACATTGGAGTCAGGGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954535121 Original CRISPR CCACCAAATAATTTTAAATG GGG (reversed) Intronic
902841806 1:19079252-19079274 AAAACAAATAATATTAAATGGGG + Intronic
903078898 1:20793204-20793226 CTACCAAAGAATTTTAACTGTGG + Intergenic
904019807 1:27454636-27454658 CTACAAAAAAATTTTAAAAGTGG - Intronic
905616437 1:39403820-39403842 CGCCCAAAAATTTTTAAATGAGG - Intronic
906086652 1:43141266-43141288 ACACCAAATAATTTAAAAGTGGG + Intergenic
906343074 1:44997736-44997758 CAAACAAATAAATTTAAAGGTGG + Intergenic
906357441 1:45119117-45119139 CCACCCAAGAATTTTAAACAGGG + Intronic
908710378 1:67007818-67007840 CTACCAAATGATTCTAAATCAGG + Intronic
908816204 1:68037674-68037696 CAAGTAAATAATTTTAAATCAGG - Intergenic
909065175 1:70927549-70927571 CCAGGAAATATTTCTAAATGTGG - Intronic
909173500 1:72324097-72324119 CCAGCCAATAATTTTATATCTGG + Intergenic
909681014 1:78292373-78292395 TCAACAAATAGTTTTCAATGTGG - Intergenic
909882624 1:80899300-80899322 ACATTAAATAATTTTAAAAGAGG - Intergenic
909963860 1:81882731-81882753 CCCTCAAATAATTTTATGTGGGG + Intronic
909997661 1:82300584-82300606 CCCCCAAATAATTTATAATTAGG + Intergenic
910501740 1:87900278-87900300 CCACCGAATGGTATTAAATGGGG + Intergenic
910852220 1:91659747-91659769 TCACCAAATCATTTTAAAATAGG + Intergenic
911782123 1:101894256-101894278 GCAACAAATAGTTTTAAATTTGG + Intronic
916427506 1:164694997-164695019 CCATCAAAGAATTTTGAATAAGG - Intronic
917150483 1:171938451-171938473 CAAGCACATAATTTTAAATCTGG + Intronic
917576429 1:176326007-176326029 CCAAGAAAGAATGTTAAATGAGG + Intergenic
917674142 1:177303284-177303306 ACATCAAACAATATTAAATGAGG - Intergenic
918549357 1:185723260-185723282 CCACCAAATCATTTTTAAAGAGG - Intergenic
918848573 1:189651989-189652011 TCATCAAATAATTTTATATATGG + Intergenic
920817262 1:209346305-209346327 CCAACAAATAAATTTATATTTGG - Intergenic
921000864 1:211041426-211041448 CCACCAAATAAATATAACTCAGG + Intronic
921568351 1:216748404-216748426 ATTCCAAATAATTTAAAATGTGG + Intronic
921754094 1:218833144-218833166 CAACCAAATGAGTTTAAATTTGG + Intergenic
922020240 1:221697093-221697115 CCACCATCTAATATAAAATGGGG + Intergenic
922149591 1:222986869-222986891 CCACAATATAACTGTAAATGTGG - Intronic
923929726 1:238681525-238681547 CCAACAAAGAATTTTACATCTGG + Intergenic
924526900 1:244860879-244860901 CGACCAAATTATTTTAAAATAGG + Intronic
1063285575 10:4684067-4684089 CAATAAAATAATTTTAGATGAGG - Intergenic
1064178711 10:13097421-13097443 CCACCCAAAAATTTTAGATAAGG - Intronic
1065181440 10:23130091-23130113 CCAAGATATATTTTTAAATGTGG - Intergenic
1067719407 10:48715950-48715972 CCAACAATTATTTTTAGATGTGG + Intronic
1068401982 10:56539478-56539500 CCACCAGATTATTTTAATAGGGG - Intergenic
1068591677 10:58859421-58859443 TCACCAAATAATCATATATGAGG + Intergenic
1068863503 10:61870280-61870302 CCCCCAAATAATCTTTTATGAGG + Intergenic
1071045836 10:81375468-81375490 ACACCAATTAATTTTAGGTGTGG + Intergenic
1071756291 10:88544274-88544296 CCACCAGGTACTTTTAAATGAGG - Intronic
1072168254 10:92835084-92835106 CCTCCAAATAAATTTATATGAGG + Intronic
1073631384 10:105153507-105153529 CCACCAAATTATTCCAAAAGTGG + Intronic
1073911856 10:108354777-108354799 CCACAAAACAATATTAAGTGAGG + Intergenic
1077621847 11:3732040-3732062 CAGACAAATAATTTTAAATGGGG - Intronic
1077935243 11:6777663-6777685 CCTCCAAATATTCTTATATGAGG + Intergenic
1078368978 11:10729500-10729522 ACACCATATCATTTTGAATGGGG + Intergenic
1079414202 11:20217877-20217899 CCATGAAAAGATTTTAAATGGGG - Intergenic
1079818067 11:25088237-25088259 CCACCATAAAATCTGAAATGAGG - Intergenic
1080285351 11:30605354-30605376 CCAACAAATCAATTTAAAGGGGG + Intergenic
1081380875 11:42413354-42413376 CCACCAACTAATTTTTCCTGAGG - Intergenic
1081614452 11:44582288-44582310 CCACCCAAGAACTTGAAATGAGG - Intronic
1083848770 11:65353096-65353118 CCACAAAAAAATTTTAATTTGGG - Exonic
1085859308 11:80213560-80213582 CCACTAAAGAATTTTAAGTGAGG - Intergenic
1086127499 11:83364415-83364437 CCCCCAAATAATGTTCAATCTGG - Intergenic
1088150988 11:106744805-106744827 CCAAAATATAATTTTTAATGAGG - Intronic
1090212658 11:124933469-124933491 ACACCAAAACATTCTAAATGTGG - Intronic
1092556023 12:9562592-9562614 CCAACAAAGAATTTCTAATGAGG - Intergenic
1093545207 12:20337425-20337447 CCACTAATTACTTTTAAATTAGG - Intergenic
1093956410 12:25224437-25224459 CAAACAAAAAATTTTAAATATGG + Intronic
1093965824 12:25323990-25324012 CCTCCAGATAATTCTATATGTGG + Intergenic
1094516072 12:31128056-31128078 CCAACAAAGAATTTCTAATGAGG + Intergenic
1094690793 12:32766645-32766667 ACACCAAAACATTTTACATGAGG - Intergenic
1095241316 12:39862203-39862225 ACCCTAAATAATTTTCAATGAGG - Intronic
1097864211 12:64545760-64545782 CTACAAAAAAATTTAAAATGAGG + Intergenic
1097980299 12:65731186-65731208 TTACCAATTCATTTTAAATGGGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098198747 12:68032050-68032072 CAGCGAAATAATTTTAAAAGAGG - Intergenic
1098239499 12:68452382-68452404 TCCCCAAATAATTTTAGAGGAGG - Intergenic
1098517536 12:71395035-71395057 CCATAAAGCAATTTTAAATGTGG - Intronic
1099466223 12:82991214-82991236 ACATTAAATAATTTTAAGTGTGG + Intronic
1100419243 12:94414785-94414807 CCACAGAATAATTTTTAATGTGG - Intronic
1100470398 12:94887707-94887729 ACAAAAAATAATTTTAAATGAGG - Intergenic
1102489995 12:113284912-113284934 CCACGAAAGAGTTTTAAACGGGG - Intronic
1102972597 12:117182164-117182186 TCCCAAAATATTTTTAAATGCGG + Intronic
1104439917 12:128786270-128786292 CCAGCAGGTCATTTTAAATGAGG + Intergenic
1106365386 13:29074118-29074140 CCAACAAAGAATTTTAAAGGAGG - Intronic
1106370540 13:29128264-29128286 CCAGAAAATAATGTTCAATGAGG + Intronic
1106532907 13:30610842-30610864 TCACCACATAAGTTAAAATGGGG - Intronic
1108151703 13:47542710-47542732 TCATTAAATAATTTTAAGTGGGG - Intergenic
1108190074 13:47929266-47929288 CCTCCAAATACTTTTCAATTTGG + Intergenic
1108227894 13:48307905-48307927 CCACCAAACTATTTTAAAGCAGG + Intronic
1108743416 13:53363063-53363085 CCCCCTAATATTTTTAAATTGGG - Intergenic
1109331692 13:60938922-60938944 CCACCAGTTAATTTTAAAGCAGG - Intergenic
1109971228 13:69771412-69771434 CCTCTAAAAAATTTAAAATGAGG - Intronic
1111035004 13:82660885-82660907 CCAACACACAATTTTAAATCAGG + Intergenic
1111159815 13:84379704-84379726 CCACCCAATAATGTAAAATAAGG + Intergenic
1111254170 13:85644074-85644096 CTACCAAATAATTTTATATTAGG + Intergenic
1111484762 13:88881836-88881858 ACAACAAAACATTTTAAATGCGG + Intergenic
1111858646 13:93672863-93672885 CCCCCAAAATATTTTCAATGAGG + Intronic
1112873444 13:104004385-104004407 GCAGCAAATGATTTTAAATCTGG + Intergenic
1114942966 14:27639002-27639024 CCTCCAAACTATTTTAAATATGG + Intergenic
1115676275 14:35678615-35678637 CCACTGAAGGATTTTAAATGAGG - Intronic
1115889098 14:38007130-38007152 ACACCAAAGGATTTTAAATAAGG + Intronic
1116107906 14:40535052-40535074 AAACCAAATATTTTTACATGTGG - Intergenic
1117143311 14:52811305-52811327 CCATCAAATATTTTTCAATATGG + Intergenic
1117155124 14:52931727-52931749 CCAACAAAAAATGTTAAAAGGGG + Intronic
1117587177 14:57221387-57221409 CCACCACAGAGTTTTAAATAAGG + Intronic
1118648339 14:67863125-67863147 CCAGCATATAGTTTTAAATATGG + Intronic
1119692144 14:76682623-76682645 CTAGGAAAGAATTTTAAATGTGG - Intergenic
1119757007 14:77126317-77126339 CCACCAAATACCTTGAAATGAGG - Intronic
1120045402 14:79800025-79800047 CCACCAAATAATTTTCACAGTGG - Intronic
1120149168 14:81013939-81013961 CCCACAAATCATTTTAAGTGTGG - Intronic
1120594073 14:86412729-86412751 CCAGAAAAGCATTTTAAATGGGG + Intergenic
1120765822 14:88325867-88325889 GCCCCAAATAACTTTTAATGGGG - Intronic
1128431354 15:67597812-67597834 CCCCCAAATTTTTTTACATGAGG + Intronic
1128505791 15:68271766-68271788 CCCACAAATAATTTTAATTTGGG - Intergenic
1129014973 15:72458941-72458963 CCACAATATCATTTTAAATGGGG + Intergenic
1131837436 15:96405264-96405286 TCAACAAATAAAATTAAATGAGG - Intergenic
1132053145 15:98627517-98627539 CCACAAAAAAATTTTAAACGAGG - Intergenic
1133918761 16:10133081-10133103 CCACCAGATAATTTTGGATGAGG + Intronic
1134479009 16:14601617-14601639 CCCCAAAAAAATTTTAATTGTGG - Intronic
1134749779 16:16616841-16616863 CAAGGAAATAATTTTAAATCTGG + Intergenic
1134995694 16:18736774-18736796 CAAGGAAATAATTTTAAATCTGG - Intergenic
1135925827 16:26693298-26693320 CCACCAAATAATGTTTAAAATGG + Intergenic
1136347524 16:29685696-29685718 CCATCACAGAATTTTAAAAGAGG - Intronic
1137016084 16:35376947-35376969 ACAAAAAAAAATTTTAAATGAGG + Intergenic
1138253481 16:55528498-55528520 CCATCAAAGAATGTTGAATGAGG - Exonic
1138927085 16:61605456-61605478 CCACAGAAAGATTTTAAATGGGG + Intergenic
1139618470 16:68116281-68116303 CAAACTAATGATTTTAAATGTGG + Intronic
1140747445 16:77993634-77993656 CCTCCATAGAATTTTTAATGTGG + Intergenic
1143969100 17:10780047-10780069 CAACAAAATAATTTTAAAATGGG - Intergenic
1143985795 17:10912787-10912809 ACTCCAAATACTTTTAAAAGCGG + Intergenic
1145965863 17:28916683-28916705 CCACCAAATGCTTTTCAAGGAGG + Intronic
1146726117 17:35157500-35157522 CCAGGAAATAATTATAAATGTGG - Intronic
1150190791 17:63236119-63236141 CAAGGAAATAAATTTAAATGAGG + Intronic
1150449370 17:65253160-65253182 TCACCAAAAGATTTTAAATCAGG + Intergenic
1150516562 17:65817088-65817110 ACACAAAATATTTTTAAGTGAGG - Intronic
1151002509 17:70394485-70394507 CAAGCAAATAATTTTAGTTGAGG + Intergenic
1152651569 17:81496393-81496415 CTGCCAAGTAATTTCAAATGAGG - Intergenic
1153867168 18:9281525-9281547 CTACCAAATAGTTTCTAATGTGG + Exonic
1155081920 18:22418936-22418958 CCAGCAAATCATTTTTGATGAGG + Intergenic
1155709195 18:28854840-28854862 ACACCAAATTTTTTTAAAGGGGG - Intergenic
1156875782 18:42009365-42009387 ACACCAAATAATTTTTAAAAAGG - Intronic
1157987624 18:52457679-52457701 TGAACAAATATTTTTAAATGTGG + Intronic
1164552453 19:29222787-29222809 CTATGATATAATTTTAAATGAGG - Intergenic
1165647512 19:37454916-37454938 CAACCAAGTAATCTTAAATCTGG - Intronic
1167020582 19:46872198-46872220 ACACAAAATAAAATTAAATGTGG + Intergenic
1168316675 19:55487646-55487668 CCAACAATTAATGTTAACTGGGG - Intergenic
925338908 2:3119749-3119771 CCAGCAAACATTTTTTAATGTGG + Intergenic
926497049 2:13603728-13603750 TCACCAAATATTTTTAAATGAGG - Intergenic
927675711 2:25104496-25104518 CCCTCAAATAATTTTAAGTGGGG + Intronic
927806025 2:26147482-26147504 CCAAGAAATATTGTTAAATGAGG + Intergenic
928067425 2:28179737-28179759 CCACCAAAAAATCTTAGCTGTGG + Intronic
928490757 2:31780093-31780115 CCAACCAATAATTTTACATCTGG + Intergenic
929600509 2:43201539-43201561 CCTCCAAATGATTTTAGCTGAGG + Intergenic
930585308 2:53260629-53260651 TCATCAAATAATATTCAATGTGG - Intergenic
930699879 2:54448695-54448717 CCAGCAAATGATGTCAAATGTGG + Intergenic
931670495 2:64642959-64642981 CCACAAAATGACTTTAAAAGGGG + Intronic
932746861 2:74341002-74341024 CCACCGAATAAATGTAAAAGAGG + Intronic
932950368 2:76286256-76286278 CCACTATGTAATTTTAAATGAGG + Intergenic
933090375 2:78110055-78110077 CCAGCAAATGATATTAATTGGGG + Intergenic
933203096 2:79473268-79473290 CAGATAAATAATTTTAAATGTGG - Intronic
933468169 2:82683050-82683072 CAATCAGAAAATTTTAAATGTGG + Intergenic
933767912 2:85723139-85723161 AGACCCAATAATTTAAAATGGGG - Intergenic
934585304 2:95487549-95487571 AAACCAAAGAAATTTAAATGAGG - Intergenic
934594161 2:95589207-95589229 AAACCAAAGAAATTTAAATGAGG + Intergenic
934788624 2:97036475-97036497 AAACCAAAGAAATTTAAATGAGG - Intergenic
935836223 2:107057343-107057365 CCACAAAAAAGTTTTAAATCAGG - Intergenic
937353063 2:121179507-121179529 TCACAAAGTAATTTAAAATGTGG - Intergenic
940019447 2:149141356-149141378 ACACCAAACAACTTTAAATCAGG - Intronic
940706121 2:157107431-157107453 TCACAATATAATATTAAATGGGG + Intergenic
943997927 2:194795907-194795929 CTACAAAATCATTTCAAATGAGG + Intergenic
944456811 2:199903591-199903613 CCACTGAATAATTTTAAATAGGG - Intergenic
944473463 2:200080291-200080313 CCATGAAATCATTTTAATTGGGG - Intergenic
945265163 2:207883422-207883444 CCACCAAATAATTGGAAATAAGG + Intronic
945306138 2:208260682-208260704 CCACCAAATCATTTTCTAGGGGG + Intronic
947308023 2:228768485-228768507 TCACCATATAACTTTAAATAGGG + Intergenic
948260023 2:236596953-236596975 TCCCCAAATTATTTTAGATGTGG - Intergenic
1169715778 20:8616154-8616176 CCACCAAATGGCTTTAAACGGGG - Intronic
1170360594 20:15541933-15541955 CCACCAAATAAGTCTAACTTGGG + Intronic
1172983137 20:38960120-38960142 CCATGAAATAATCTTAAAAGTGG + Intergenic
1173212713 20:41049020-41049042 CCATAAAAGAAATTTAAATGCGG + Intronic
1173599724 20:44285152-44285174 TTAACAAATAATTTTTAATGAGG - Intergenic
1173736848 20:45367919-45367941 CCGCCAAAGAATTCTAAATAAGG - Exonic
1178452198 21:32712764-32712786 CCAACAAACAATTTAAAATTAGG - Intronic
1179127326 21:38601805-38601827 ACATTAAAAAATTTTAAATGAGG + Intronic
1182188421 22:28432502-28432524 CCAGTAAATAACTGTAAATGTGG - Intronic
1183087488 22:35495410-35495432 CCACCAAAGGGTTTTAAATGCGG + Intergenic
1183113058 22:35667247-35667269 CCATCAAATACTTATAAATTGGG - Exonic
1184569695 22:45314373-45314395 CCACCAAATCATTACAAATAAGG - Intronic
949503969 3:4709272-4709294 CAATCAAATAATTTTGAGTGGGG - Intronic
949652878 3:6181111-6181133 TTACCAAATATTTTTAAATTTGG - Intergenic
949653054 3:6183306-6183328 TCAACAAAGAATTTTAAAGGTGG + Intergenic
949670463 3:6394223-6394245 AAACCAAATAATTTTAAATTAGG + Intergenic
949970557 3:9399268-9399290 CCAAAAAATAATTTCAAATAGGG - Intronic
950814037 3:15679826-15679848 CCCCCAAATATTTTTAATTTGGG - Intronic
950940729 3:16888231-16888253 CAAATAAATTATTTTAAATGAGG - Intronic
951090635 3:18569447-18569469 CAAGCAAATATTTTTAAATATGG - Intergenic
952044928 3:29306980-29307002 CTAACGAATAAATTTAAATGTGG - Intronic
952298095 3:32079191-32079213 ACATCAAAATATTTTAAATGTGG - Intergenic
952674055 3:36005625-36005647 CCAGGATATAATTATAAATGTGG + Intergenic
954535121 3:51354227-51354249 CCACCAAATAATTTTAAATGGGG - Intronic
955498880 3:59564412-59564434 CCAACAAAGATTTTTAAATCTGG - Intergenic
956998690 3:74858416-74858438 TCATCAATTAATGTTAAATGAGG + Intergenic
957459051 3:80493905-80493927 CCACAAATTATTTTTAAAAGAGG + Intergenic
957801814 3:85094278-85094300 CTAATAAATAATTTTTAATGAGG + Intronic
958174573 3:89979910-89979932 TCACCAACAAATTTTGAATGAGG - Intergenic
959483267 3:106899055-106899077 CCATCAGAGAATTTTAAATGCGG + Intergenic
959799269 3:110471565-110471587 TCAACAAATAAATTTAAATGTGG - Intergenic
959914531 3:111801430-111801452 TCACCCAATATTTTTAACTGAGG + Intronic
962107288 3:132404268-132404290 CCACCACAAAATGTTAATTGTGG + Intergenic
963162751 3:142168736-142168758 CCACTAAAGAATTTTAACCGGGG - Intronic
965553703 3:169997841-169997863 CTACCAAATAATTTATGATGTGG + Exonic
966311411 3:178598204-178598226 CCACCAAACACTTTTATATACGG - Intronic
966508210 3:180730975-180730997 CCAAAAAATAAATTTAAATTGGG - Intronic
966623370 3:181990276-181990298 CGACCAAACAATTTTAAAAAGGG + Intergenic
967647289 3:191940721-191940743 CCAACAAAACCTTTTAAATGAGG + Intergenic
968157036 3:196390051-196390073 CCACAAAATATTTTTAAAATTGG + Intronic
970451518 4:16171127-16171149 CCACCAAATAATTCTAGCTTTGG - Intronic
971656309 4:29349908-29349930 ACTCCAAATAATGTTAAAAGTGG + Intergenic
972554960 4:40172432-40172454 CCACCACACAAGTTAAAATGGGG + Intergenic
973584090 4:52373872-52373894 TCATTAAATAATTTTAAATAAGG + Intergenic
973888823 4:55348956-55348978 TTACCAAATGATTTTAAATTTGG - Intronic
974149812 4:57992254-57992276 CCAACAAAAAACTTTAAATTAGG + Intergenic
974374190 4:61055744-61055766 CAAACAAATAATATGAAATGTGG - Intergenic
974651621 4:64760597-64760619 CAACACAATAATTTTATATGTGG + Intergenic
974722147 4:65754380-65754402 TCATCAAATAATTTTTAATCTGG + Intergenic
975334480 4:73159729-73159751 TCTCCAAATATTTTTTAATGTGG - Intronic
975534086 4:75430941-75430963 CCTCCAGAGAATTTTGAATGGGG + Intergenic
976009470 4:80469597-80469619 CCCACAGATAATATTAAATGAGG - Intronic
976169494 4:82288249-82288271 CCACCAAATTATTTTAAGCAGGG - Intergenic
976204573 4:82612439-82612461 CCCCCAGATACTTTTATATGTGG + Intergenic
976951959 4:90844544-90844566 CCCCCAATTAATTTTACATATGG + Intronic
981163253 4:141524330-141524352 TCACCAAGATATTTTAAATGGGG - Intergenic
981274946 4:142888322-142888344 TCAACAAATTATTTTTAATGAGG - Intergenic
984664463 4:182410547-182410569 GCCCCAAATTATTTTATATGAGG - Intronic
984794004 4:183641833-183641855 TTAAAAAATAATTTTAAATGTGG + Intronic
987554068 5:19422900-19422922 CAATCAAATAATTTGAAATTTGG + Intergenic
987650095 5:20730087-20730109 CAACTAAATAGTTGTAAATGAGG + Intergenic
987676307 5:21077036-21077058 CCACCACCTAATTTTACATTAGG - Intergenic
988113893 5:26857829-26857851 CAACCAATTAAATTTATATGTGG + Intergenic
988523679 5:31968050-31968072 CCTCCAAATACTTTTGCATGGGG - Intronic
990256008 5:53970110-53970132 CCCCCAAATGATATCAAATGTGG + Intronic
990819132 5:59817616-59817638 TCAGTAAATAAGTTTAAATGTGG + Intronic
991944770 5:71889440-71889462 CCAGCCAATATTTTTAAAAGGGG - Intergenic
992714727 5:79498693-79498715 CCAAAAAATAATTTTAAATCTGG + Intronic
993027777 5:82666194-82666216 GCAACAAATAATTTTAGAAGGGG - Intergenic
993135890 5:83963611-83963633 CCACCAATTAATTTTATATTAGG + Intronic
995597282 5:113761540-113761562 CCATTAGAAAATTTTAAATGTGG - Intergenic
995816635 5:116176793-116176815 CCACAAAGTAATTTTAAACAGGG + Intronic
995900412 5:117059372-117059394 GAACCACAGAATTTTAAATGTGG + Intergenic
999601192 5:153267137-153267159 CAACTAAATAATTGTATATGTGG - Intergenic
1001061931 5:168498664-168498686 CCAGGAAATAATTTTTAAAGAGG - Intronic
1001536811 5:172503879-172503901 CCAGCAAACAATTTAAAATGGGG - Intergenic
1001724057 5:173881909-173881931 CCACTAAATCTTTGTAAATGGGG - Intergenic
1002023177 5:176378705-176378727 CCAAAGAATAATTTCAAATGGGG + Exonic
1005909151 6:30292943-30292965 CCACAAAATAATTTTTAAAATGG - Intergenic
1006687583 6:35849409-35849431 CCTCCATATAGTTTTACATGAGG - Intronic
1008210909 6:48724771-48724793 ACACCAAAAAATTCAAAATGTGG - Intergenic
1009937308 6:70249173-70249195 CCACTGAAGATTTTTAAATGGGG + Intronic
1011104883 6:83768600-83768622 CCACTAAATAATTTTCAGTAAGG - Intergenic
1011362518 6:86543142-86543164 GCACCAGATAATTTAAAATGTGG + Intergenic
1011865603 6:91822529-91822551 CCCCCTAATAATTTAAAATAAGG + Intergenic
1012405837 6:98897145-98897167 CAATCAGAAAATTTTAAATGAGG + Intronic
1013871713 6:114770498-114770520 TCACCTAATAATTTTATATGCGG + Intergenic
1015025975 6:128532897-128532919 CGATGAAATAATTTTAACTGAGG - Intergenic
1016626879 6:146180881-146180903 ACAGCAAATATTTTTAAAAGCGG + Intronic
1018305746 6:162453379-162453401 CTACTAAATAATTTTAAAAGTGG - Intronic
1018336607 6:162797632-162797654 AAAACAAATATTTTTAAATGTGG - Intronic
1019781883 7:2945308-2945330 CCACCAAAGGGTTTTAAATAGGG + Intronic
1021078053 7:16329190-16329212 CCACCAAATTAGTTTTAGTGTGG - Intronic
1021588122 7:22231873-22231895 CCACGAAAGAATTTTAAATTGGG + Intronic
1023570961 7:41571395-41571417 CCACCAAAGGATTTTAAGTAAGG + Intergenic
1023808379 7:43891352-43891374 CAACAATATATTTTTAAATGTGG + Intronic
1027747431 7:82094977-82094999 CCAACAAATACTTTTAATTAGGG - Intronic
1028233631 7:88334099-88334121 AAGCAAAATAATTTTAAATGTGG + Intergenic
1028960110 7:96739082-96739104 CCAACAAATAAATTTAAAATGGG - Intergenic
1029181417 7:98704522-98704544 CCACAAAATATTTTTAAACAGGG - Intergenic
1030755394 7:113281961-113281983 CACCCCAATAATTTTAATTGTGG + Intergenic
1033121094 7:138667274-138667296 CCAGCAAAGAATTTTCCATGGGG - Intronic
1035887152 8:3303784-3303806 TTACCAAATAACTTTCAATGGGG + Intronic
1036570366 8:9975070-9975092 CCTCCAAATAACTGGAAATGGGG - Intergenic
1038092887 8:24274161-24274183 CCACCAGCTACTTTTAAAAGTGG + Intergenic
1039076597 8:33695515-33695537 CCATTAAAGAATTTTAAATGAGG + Intergenic
1039815341 8:41089326-41089348 CAACAAAATATTTTTAAATTAGG + Intergenic
1040409158 8:47137306-47137328 TTACCAAGTAATTTTAAATAAGG - Intergenic
1041067781 8:54098935-54098957 CCACCAAATAATTTCAGAACTGG + Intronic
1042794902 8:72651294-72651316 CTAGTAAATAATTTTCAATGAGG + Intronic
1043744781 8:83860622-83860644 CCACTAAAGAGTTTTAAATAGGG - Intergenic
1044498694 8:92925541-92925563 CAACCTAATAATTTAAAAAGGGG + Intronic
1044739474 8:95311437-95311459 CTACCAAATAATTTCAAAAAGGG - Intergenic
1044803986 8:95986098-95986120 CCTCAACATATTTTTAAATGTGG + Intergenic
1044927404 8:97221288-97221310 CCACCAAAGAATTTTGAACAGGG + Intergenic
1045734698 8:105281000-105281022 CCACCTAAGGATTTTAAATAAGG - Intronic
1046223286 8:111242950-111242972 CTACCAAACAAATTGAAATGCGG + Intergenic
1047043871 8:121029836-121029858 CCACCAACTAGTTTTAGAAGAGG + Intergenic
1047373906 8:124278291-124278313 TCACCAGATAATTTTGCATGGGG - Intergenic
1047942775 8:129841839-129841861 GAACTAAATATTTTTAAATGTGG - Exonic
1048406023 8:134122692-134122714 CAATCAAATAATTTTCAATAGGG + Intergenic
1048651944 8:136487678-136487700 CCACCATCTCATTCTAAATGTGG + Intergenic
1050144599 9:2553211-2553233 CACCCAAATATTTTTAGATGGGG + Intergenic
1051027516 9:12630868-12630890 CCACCAAAGAATGGTAGATGAGG + Intergenic
1051763157 9:20491266-20491288 CCACAAAACCATTTTAAATATGG + Intronic
1052579380 9:30334456-30334478 CCACCAATTACATATAAATGTGG + Intergenic
1052759330 9:32573473-32573495 CAAGCAAATAATTTTGAATCTGG - Intergenic
1053841889 9:42193995-42194017 CAACCAAAAATTTTTAAGTGAGG + Intergenic
1055263931 9:74474226-74474248 TCACAAAATAATGTTAATTGAGG + Intergenic
1055830819 9:80376607-80376629 CTAGAAAATAATATTAAATGGGG + Intergenic
1057157814 9:92859542-92859564 CAGCCAAATAATTTGAAATAGGG + Intronic
1057575578 9:96239734-96239756 CCACCAAAGAAAGTTAGATGGGG - Intronic
1058083924 9:100728690-100728712 CCAACGAATAATTTAAACTGTGG + Intergenic
1058146267 9:101415232-101415254 CCACAAAACACTTTTGAATGAGG - Intergenic
1060087922 9:120718102-120718124 CTTCCAAATACTTTTACATGGGG + Intergenic
1061857649 9:133451085-133451107 CCATTAAAGAATTGTAAATGAGG - Intronic
1186593826 X:10959490-10959512 CCACCAGATAATTTAAAAATTGG - Intergenic
1187327504 X:18305178-18305200 CCACTAAATAATTTTAAAGTGGG - Exonic
1188308054 X:28583025-28583047 CCACCACATATTCTCAAATGAGG - Intergenic
1188565889 X:31526117-31526139 CCACCCAAGTGTTTTAAATGCGG + Intronic
1188819655 X:34759147-34759169 CAACCAATTAATTTTAGAAGAGG + Intergenic
1189087715 X:38044383-38044405 AAACTAAATTATTTTAAATGTGG - Intronic
1189739078 X:44100288-44100310 CCATCAAAGAATTTTAAATGGGG + Intergenic
1190472936 X:50800797-50800819 CCATTAAATAATTTTAAGGGAGG + Intronic
1190534832 X:51416071-51416093 CCTCCAAATATTTTTCAAAGTGG + Intergenic
1191966584 X:66765727-66765749 ACACCAAACAATTTTAAGTTTGG + Intergenic
1193334225 X:80268859-80268881 CCCCAAAAGAATTCTAAATGTGG - Intergenic
1193750561 X:85337886-85337908 GCATCAAATAAAATTAAATGGGG + Intronic
1194026118 X:88753002-88753024 CCACCTGAGAATTTAAAATGGGG - Intronic
1194771200 X:97908271-97908293 CCACCAAATGATTTTCATTAGGG + Intergenic
1195215403 X:102695340-102695362 CCAAAAAATATTTTTTAATGGGG + Intergenic
1196859130 X:120011260-120011282 CCACCCTATAACTCTAAATGGGG - Intergenic
1197691097 X:129501908-129501930 CGGCCAAACATTTTTAAATGGGG + Intronic
1198865265 X:141116067-141116089 CCTCCAAATATTTTTAAATCTGG - Intergenic
1199026595 X:142946592-142946614 CCACCAACTAATATTTAAGGGGG - Intergenic