ID: 954535262

View in Genome Browser
Species Human (GRCh38)
Location 3:51355062-51355084
Sequence TGGGTGGATCTCACCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954535262_954535270 14 Left 954535262 3:51355062-51355084 CCCTGGGAGGTGAGATCCACCCA 0: 1
1: 0
2: 1
3: 16
4: 127
Right 954535270 3:51355099-51355121 TACCACATTGCCAACCATACAGG 0: 1
1: 0
2: 0
3: 6
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954535262 Original CRISPR TGGGTGGATCTCACCTCCCA GGG (reversed) Intronic