ID: 954539846

View in Genome Browser
Species Human (GRCh38)
Location 3:51386000-51386022
Sequence TTTGATGCCCTGGGTGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954539846 Original CRISPR TTTGATGCCCTGGGTGTACC AGG Intronic
900611032 1:3544744-3544766 TGGGAAGCCCTGGGTCTACCAGG - Intronic
900885962 1:5415602-5415624 TCTGATGCCATGGATGGACCAGG - Intergenic
900997621 1:6130872-6130894 GCTGAAGCCCTGGGTGTGCCAGG - Intronic
902674284 1:17997686-17997708 TTTGATGTCCTGAATGTGCCTGG - Intergenic
903495467 1:23763612-23763634 TTTAATCCCCTGGATTTACCAGG - Intergenic
904572886 1:31480508-31480530 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
904595235 1:31640156-31640178 TCTGATGCCCTGGGGGGACTGGG + Intronic
904823820 1:33261972-33261994 TTGGATGCACAGGGTGTGCCTGG + Intronic
905843222 1:41203659-41203681 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
906150869 1:43587005-43587027 TCTCATGCCCTAGGTGAACCTGG + Intronic
908894984 1:68888395-68888417 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
911131115 1:94389396-94389418 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
912856486 1:113172983-113173005 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
915401333 1:155624103-155624125 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
920085695 1:203414614-203414636 TTTCCTGCCCTGGGTGGGCCAGG - Intergenic
920577630 1:207073151-207073173 TTCGATGCCCTGGGAGAATCTGG + Exonic
922246330 1:223801934-223801956 ATTGATACCCTGGTTGTACAAGG - Intronic
922681162 1:227597280-227597302 TTTTCTGCCCTGGGTGGGCCAGG + Intronic
923522156 1:234743646-234743668 TTGGATGCCCACTGTGTACCAGG - Intergenic
923865466 1:237934590-237934612 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
924516990 1:244774475-244774497 TTTTCTGCCCTGGGTGGGCCGGG - Intergenic
924765643 1:247029811-247029833 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1063314306 10:4986473-4986495 TTTTCTGCCCTGAGTGGACCAGG + Intronic
1064014302 10:11760861-11760883 TCTGAAGCCCTGGTTGAACCAGG - Intronic
1064127589 10:12677055-12677077 TTTCATGCCTTGGGGGTACCAGG - Intronic
1068337370 10:55652678-55652700 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1069056225 10:63847578-63847600 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1069151495 10:64966267-64966289 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1069162293 10:65106943-65106965 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1069346881 10:67480519-67480541 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
1071450994 10:85791253-85791275 TTTCATGGCCTGGGTGTGGCTGG - Intronic
1072338711 10:94424683-94424705 TTACAGGCCCTGGGAGTACCTGG + Intronic
1074013058 10:109504226-109504248 TTTCCTGCCCTGGGTGGGCCAGG + Intergenic
1074110489 10:110419344-110419366 TCCAGTGCCCTGGGTGTACCGGG - Intergenic
1075014056 10:118897104-118897126 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1076208866 10:128624939-128624961 TTTTATGCCCTTGGTCTACGAGG - Intergenic
1076416155 10:130290958-130290980 TTTTCTGCCCTGGGTGGGCCGGG - Intergenic
1077968663 11:7164222-7164244 GTTGATGCCCTGGTTGACCCTGG - Intergenic
1078206528 11:9234652-9234674 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
1082321744 11:50820328-50820350 TTTGATGCCCTAGGTGGAAACGG + Intergenic
1083581272 11:63827021-63827043 CTTGGTGCCCTGGGGGTGCCTGG - Exonic
1086061400 11:82703296-82703318 TTTGATGGCCTGTGTGTCTCAGG + Intergenic
1087495695 11:98888229-98888251 TTTCATGGTCTGGATGTACCAGG + Intergenic
1087874255 11:103337053-103337075 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
1090037218 11:123259483-123259505 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1090658827 11:128866292-128866314 TTTGATCTGCTGGTTGTACCTGG - Intronic
1092686249 12:11050417-11050439 TTTCCTGCCCTGGGTGGGCCAGG + Intronic
1095095579 12:38146538-38146560 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1095617315 12:44206293-44206315 TTTTCTGCCCTGGGTGGGCCAGG + Intronic
1096257243 12:50070932-50070954 CTGGTTGCCCTGGGTGTTCCTGG + Intronic
1098172290 12:67759150-67759172 CTTGATGCCCACGGTCTACCTGG + Intergenic
1102593500 12:113974971-113974993 ATTTATGCACTGGGTGTCCCTGG + Intergenic
1102667966 12:114592236-114592258 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1103143289 12:118571041-118571063 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1103794927 12:123496783-123496805 TTTGTAGCCCTGGGCCTACCTGG + Intronic
1104714170 12:131005644-131005666 TGTGATGCCCTGGGTGAGCCTGG + Intronic
1104714182 12:131005693-131005715 TGTGATGCCCTGGGTGAGCCTGG + Intronic
1105163200 13:17467867-17467889 TTTGATGCCTTTGGTGAAACAGG + Intergenic
1105178988 13:17714345-17714367 TTTGATGCCTTTGGTGAAACAGG + Intergenic
1105181102 13:17747311-17747333 TTTGATGCCTTTGGTGAAACAGG + Intergenic
1105282625 13:18977242-18977264 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1105738516 13:23297608-23297630 TTTTCTGCCCTGGGTGGGCCAGG + Intronic
1106519002 13:30480600-30480622 GTAGATGCCCTGGGTGAAGCTGG + Intronic
1108735959 13:53283446-53283468 TTAGATTCCCTGGGTGTGCTTGG + Intergenic
1111173461 13:84560987-84561009 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1111404555 13:87785676-87785698 TGGGATGCCCTGGGTGTTCTGGG - Intergenic
1112215493 13:97426786-97426808 TTTTATTTCCTTGGTGTACCAGG - Intergenic
1114138545 14:19883849-19883871 TTTGAATCCCTGTTTGTACCTGG + Intergenic
1117631162 14:57693428-57693450 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
1122653283 14:103239121-103239143 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1122710571 14:103654057-103654079 CTTGATGCCCTGTGTCTTCCAGG + Intronic
1123891367 15:24783445-24783467 TTTTCCGCCCTGGGTGGACCAGG + Intergenic
1124020829 15:25921463-25921485 TTTTCTGCCCTGGGTGGACCAGG + Intergenic
1125356992 15:38826741-38826763 TTGGATGCCCTGGAGGTCCCTGG + Intergenic
1126687627 15:51262095-51262117 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
1128472767 15:67968772-67968794 ATTTATGTCCTGGGTGTCCCTGG - Intergenic
1129072540 15:72963210-72963232 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1130009885 15:80142872-80142894 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1131037622 15:89234056-89234078 TTTTCTGCCCTGGGTGGACCAGG + Intergenic
1133017194 16:2949486-2949508 TTTGCTGCCCAGGATGGACCTGG - Exonic
1134860611 16:17557067-17557089 TTTGAAGCCCTCCGTGTCCCTGG + Intergenic
1136130226 16:28215711-28215733 TTTGTGGCCCTGGCTGTTCCTGG - Intergenic
1137052294 16:35724483-35724505 TTTGATGCCTGGGGTCTCCCAGG + Intergenic
1137341981 16:47616990-47617012 TTTTCTGCCCTGGGTGGGCCAGG + Intronic
1137811378 16:51356101-51356123 ATTTATGCCTTGGCTGTACCAGG + Intergenic
1138268362 16:55676983-55677005 TTCTATGCCCTGGTTGTACCCGG - Intronic
1138582208 16:57949027-57949049 TTTGGTGCCCACTGTGTACCAGG + Intronic
1139350776 16:66333966-66333988 TTTAATGCTCTGGGTTTGCCAGG - Intergenic
1140432065 16:74912923-74912945 TTTTCTGCCCTGGGTGGGCCAGG + Intronic
1141719890 16:85750440-85750462 TTTGATGCCCTGGGAGCGCAGGG + Intronic
1144506791 17:15838403-15838425 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1145170973 17:20656338-20656360 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1145219979 17:21080389-21080411 TTTTCTGCCCTGGGTGGACCAGG + Intergenic
1145389651 17:22445610-22445632 TTTGATGCACTTGGTGCAGCAGG + Intergenic
1146293889 17:31633250-31633272 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1152931709 17:83113427-83113449 TTTGATGCCCAGGAAGTCCCAGG + Intergenic
1154906073 18:20573468-20573490 TTTGATGCCTTTGGTGTAAAAGG - Intergenic
1154910389 18:20641080-20641102 TTTGATGCCTTTGGTGTAAAAGG + Intergenic
1158267680 18:55678085-55678107 TATGATGCCCTGGATGTAGAGGG + Intergenic
1158537198 18:58319005-58319027 TTTGATGCCCTGCCTGTACTTGG + Intronic
1160884649 19:1340074-1340096 TTTGATGCCCTTGGGGTGCCTGG + Intergenic
1162275586 19:9651590-9651612 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
1163895728 19:20057270-20057292 TTTTCTGCCCTGGGTGGACCAGG - Intergenic
1165159803 19:33809442-33809464 GTTGAGGCCCGGGGTGGACCAGG + Intronic
1167879272 19:52442284-52442306 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
1168271421 19:55251815-55251837 TTTCCTGATCTGGGTGTACCTGG + Intronic
1168388226 19:55984189-55984211 TTTAATCCCCAGGGTTTACCAGG - Intronic
1168531664 19:57134706-57134728 TTAGATGCCTTTTGTGTACCAGG - Exonic
926060219 2:9800419-9800441 GCTGATGTCCTGTGTGTACCCGG - Intergenic
926163161 2:10502117-10502139 TTTGATACCCTGAGAGTGCCTGG - Intergenic
926673809 2:15602333-15602355 TTTCATTCCCTGGGTGTCCTTGG - Intronic
928703150 2:33919355-33919377 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
930183756 2:48390290-48390312 TTTTCTGCCCTGGGTGGCCCAGG - Intergenic
935230599 2:101092598-101092620 TTTGATGCTCTGATTGTCCCAGG + Intronic
937207111 2:120243856-120243878 GATGATGCTCTGGGTGTTCCAGG + Intronic
937842691 2:126539580-126539602 TTTGTTGCCCTCAGTGCACCAGG - Intergenic
937889929 2:126931050-126931072 TGTGATGGGCTGGGTGGACCAGG + Intergenic
939208537 2:139140666-139140688 TTTTATGCCTTGAGTGTACGTGG + Intergenic
939967609 2:148625764-148625786 TTTGATGCCCTTTCTGTGCCAGG - Intergenic
943062551 2:183053597-183053619 TTTTCTGCCCTGGGTATGCCAGG + Intergenic
943255169 2:185585390-185585412 TTTTCCGCCCTGGGTGTGCCAGG + Intergenic
945806607 2:214498068-214498090 TTTCATGCCCTGGGTGACCCTGG - Intronic
946206465 2:218112404-218112426 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
946210676 2:218144714-218144736 TTTTCTGCCCTGGGTGGTCCAGG - Intergenic
946982544 2:225233287-225233309 TTTTATACCCTGGGTGCAGCTGG + Intergenic
1171763202 20:29231686-29231708 TTTGAGGCCCATGGTGTAACAGG - Intergenic
1171764460 20:29249924-29249946 TTTGATGCCCATGGTGAAACAGG - Intergenic
1172202629 20:33137517-33137539 TTTAATGCCCTGGGAGGTCCAGG - Intergenic
1172326651 20:34040951-34040973 TTTGGTGCCCTGAGTGTAATAGG + Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1177316631 21:19470795-19470817 TTTTCTGCCCTGGGTGGGCCGGG - Intergenic
1178321560 21:31610111-31610133 TTTCCTGCCCTGGGTGGGCCAGG + Intergenic
1178701212 21:34835158-34835180 GAGGATGCCCTGCGTGTACCTGG - Intronic
1181006926 22:20017904-20017926 TTTCCTGCCCTGGATGCACCTGG + Intronic
950200148 3:11036848-11036870 TTGGATGCGCTGTGGGTACCGGG - Exonic
951821913 3:26823363-26823385 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
952517434 3:34120005-34120027 CTTTATGCCCTGGGTGGGCCAGG - Intergenic
953835008 3:46334825-46334847 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
954120258 3:48494254-48494276 TATGATGACATGGATGTACCTGG - Intronic
954539846 3:51386000-51386022 TTTGATGCCCTGGGTGTACCAGG + Intronic
955445229 3:59002515-59002537 TATGATGACCAGGGTGTACATGG - Intronic
956981768 3:74647396-74647418 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
957491149 3:80929009-80929031 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
957600024 3:82321766-82321788 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
958426204 3:93980600-93980622 TTTCATTCCCAGGGTGTCCCGGG + Intronic
961368444 3:126415592-126415614 TTAGATGCCGTTTGTGTACCTGG + Intronic
961533640 3:127555889-127555911 TTTGGTGGCCTGTATGTACCAGG + Intergenic
961859825 3:129906948-129906970 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
963538417 3:146557026-146557048 TTTTCTGCCCTGGGTGAGCCAGG - Intergenic
964197586 3:154082363-154082385 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
965315394 3:167183737-167183759 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
965978839 3:174661410-174661432 TTTTATCCCTTGGGTGTATCAGG - Intronic
969174378 4:5387466-5387488 CTTCAAGCCCTGGGTGCACCAGG - Intronic
970327067 4:14936854-14936876 TTTGAGGCCCTGAGTGTAAGTGG - Intergenic
971976750 4:33699602-33699624 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
972947308 4:44271615-44271637 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
973083410 4:46024242-46024264 TTTGATTCTCTTGGGGTACCTGG - Intergenic
974535073 4:63164154-63164176 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
974981171 4:68959310-68959332 TTTTCTGCCCTGGGTGGACCAGG + Intergenic
977016878 4:91701835-91701857 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
977625685 4:99187468-99187490 TTTTCTGCCCTGGGTGAGCCAGG + Intergenic
977626127 4:99191372-99191394 TTTTCTGCCCTGGGTGAGCCAGG + Intergenic
977638458 4:99328096-99328118 TTTGCTGCCCTGGATGGGCCAGG + Intergenic
977641906 4:99367200-99367222 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
982281582 4:153688708-153688730 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
982532917 4:156570205-156570227 TTTGAAGCCCTGGTTGAACTAGG + Intergenic
982882382 4:160735467-160735489 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
983972591 4:173893107-173893129 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
984170250 4:176350404-176350426 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
985539125 5:479667-479689 TCTGATGCCCTGGGAATCCCAGG - Intronic
985630859 5:1013342-1013364 TTTGGTGCCCTCTGTGTGCCTGG + Intronic
987404030 5:17506979-17507001 TCTAATGCCCGGGGTGTAACAGG + Intergenic
987573975 5:19702857-19702879 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
988511178 5:31865942-31865964 TTTAATCCCCTGGGTTTACCAGG + Intronic
989116550 5:37959428-37959450 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
989426157 5:41298257-41298279 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
991967813 5:72108792-72108814 TTTGTTGCCCTGGGAGTCCCTGG + Intronic
992430987 5:76711617-76711639 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
993222071 5:85111566-85111588 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
993405765 5:87510479-87510501 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
993406726 5:87520015-87520037 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
993938429 5:94030606-94030628 AGTGATGCGCTGGGTCTACCTGG + Intronic
996934467 5:128932519-128932541 TTTTCTGCCCTGGGTGGGCCAGG + Intronic
1000413533 5:160959389-160959411 TTTGCTGCCCTCTGTCTACCTGG + Intergenic
1001274165 5:170338384-170338406 TTTAATGCTCTCGGTGTGCCAGG + Intergenic
1001918933 5:175585528-175585550 TTATATACCCTGGGTGTCCCTGG - Intergenic
1004482872 6:16037767-16037789 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1004778819 6:18882023-18882045 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1005668681 6:28082597-28082619 TTTTCTGCCCTGGGTGGGCCAGG + Intronic
1005780561 6:29187189-29187211 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1007887020 6:45241343-45241365 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
1008587648 6:52963713-52963735 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1009955617 6:70448884-70448906 TTTTCTGCCCTGGGTGGGCCAGG + Intronic
1014294438 6:119601477-119601499 TTTGGTGCCCTCGGTGCACATGG + Intergenic
1015825373 6:137305447-137305469 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1016683146 6:146853513-146853535 TTTGATGACATGGATGAACCTGG - Intergenic
1016849433 6:148601834-148601856 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1016953944 6:149608526-149608548 TTTGCTGCCCTGGGTGGGGCCGG - Intronic
1017373308 6:153737873-153737895 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1017754328 6:157517039-157517061 TTTTATACCGTGGTTGTACCCGG + Intronic
1018292810 6:162310311-162310333 TTGGATGCCCTGCCTCTACCAGG + Intronic
1019997161 7:4731995-4732017 TCAGATGCCCTGGGGGCACCTGG - Intronic
1020082192 7:5292062-5292084 TTTGAAGCCCTGTTTATACCAGG - Intronic
1022317158 7:29256190-29256212 TTAAATGCCATGGGTGTGCCAGG + Intronic
1024057844 7:45676806-45676828 TTTGCTGGCCTGGGTGGAGCTGG + Intronic
1024495696 7:50043042-50043064 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
1025196732 7:56940077-56940099 TTTGAAGCCCTGTTTATACCAGG + Intergenic
1025675215 7:63636860-63636882 TTTGAAGCCCTGTTTATACCAGG - Intergenic
1025728263 7:64087709-64087731 TTTGAAGCACAGGCTGTACCTGG + Intronic
1025757376 7:64357559-64357581 TTTGAAGCACAGGCTGTACCTGG + Intergenic
1030277580 7:107737003-107737025 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1034301137 7:150016411-150016433 GATGATGCCTTGGGTGTGCCTGG - Intergenic
1034403893 7:150888453-150888475 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1034804918 7:154080895-154080917 GATGATGCCTTGGGTGTGCCTGG + Intronic
1035332511 7:158105529-158105551 ATTGAAGCCTTGGATGTACCTGG - Intronic
1037154594 8:15684550-15684572 TTTGATGCCTTGGGACTCCCTGG + Intronic
1038407903 8:27335669-27335691 GTTCATGCCCTGGGGGTCCCTGG + Intronic
1038849977 8:31266242-31266264 TGTGATGCCCTGGGAAAACCAGG - Intergenic
1039036672 8:33367254-33367276 TTTTCTGCCCTGGGCGGACCAGG - Intergenic
1039692175 8:39875640-39875662 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1040528424 8:48244857-48244879 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1040782441 8:51125788-51125810 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1040829636 8:51662718-51662740 TTTGATATCCTGGGGGTTCCAGG + Intronic
1040988806 8:53326860-53326882 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1041493479 8:58460855-58460877 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1043201422 8:77373993-77374015 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1045476628 8:102558087-102558109 TTTCTTGCCCTGGGTGTGCCAGG - Intronic
1046001070 8:108421451-108421473 TTTTCTGCCCTGGGTGGGCCAGG + Intronic
1046641724 8:116739109-116739131 TTTTCTGCCCTGGGTGGTCCAGG - Intronic
1049460577 8:142725851-142725873 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1051528277 9:18071781-18071803 TTTGATGCGTTGTGTGTTCCAGG + Intergenic
1051844267 9:21434023-21434045 TTTTCTGCCCTGGGTGCGCCAGG - Intronic
1055318322 9:75056206-75056228 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1057168464 9:92946542-92946564 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1057625157 9:96670034-96670056 TTTTCTGCCCTGGGTGGTCCAGG - Intergenic
1061602491 9:131680521-131680543 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
1187188256 X:17008789-17008811 TATGATGCCCTGGGTGTGACAGG - Intronic
1189151804 X:38716748-38716770 TGTGATGGCATGGGTGAACCTGG - Intergenic
1189293779 X:39904532-39904554 TCTGACGTCCTGGGTGAACCAGG + Intergenic
1189670317 X:43401197-43401219 TTTTGTGCCCTGGGTGGGCCAGG - Intergenic
1191149271 X:57203360-57203382 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1191919431 X:66238993-66239015 TTTTCTGCCCTGGGTGGGCCAGG + Intronic
1191949121 X:66569476-66569498 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1192524164 X:71827747-71827769 TCTGATGCCTTGGGTGGTCCTGG + Intergenic
1192884570 X:75323340-75323362 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1193314477 X:80047926-80047948 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1193787277 X:85774610-85774632 TTTCCTGCCCTGGGTGGGCCAGG + Intergenic
1194122150 X:89974948-89974970 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1196298790 X:114030683-114030705 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1200475005 Y:3632382-3632404 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1200684128 Y:6245018-6245040 ATTGATGGCCTGGGTGTGCTGGG + Intergenic
1200906094 Y:8484495-8484517 TTTGAAGCACAGGATGTACCTGG + Intergenic
1201048507 Y:9909368-9909390 ATTGATGGCCTGGGTGTGCTGGG - Intergenic
1201857043 Y:18556191-18556213 TTTTCTGCCCTGGGTGGGCCAGG + Intronic
1201876278 Y:18764189-18764211 TTTTCTGCCCTGGGTGGGCCAGG - Intronic
1201926473 Y:19293398-19293420 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1202041024 Y:20684225-20684247 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1202169792 Y:22031287-22031309 TTTTCTGCCCTGGGTGTGCCAGG - Intergenic
1202170210 Y:22035435-22035457 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1202221156 Y:22550938-22550960 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1202221574 Y:22555086-22555108 TTTTCTGCCCTGGGTGTGCCAGG + Intergenic
1202321544 Y:23640586-23640608 TTTTCTGCCCTGGGTGTGCCAGG - Intergenic
1202321957 Y:23644724-23644746 TTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1202548810 Y:26025332-26025354 TTTTCTGCCCTGGGTGGGCCAGG + Intergenic
1202549223 Y:26029470-26029492 TTTTCTGCCCTGGGTGTGCCAGG + Intergenic