ID: 954540315

View in Genome Browser
Species Human (GRCh38)
Location 3:51389394-51389416
Sequence ACTGGAAAGCAGAAACTGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954540315_954540321 -7 Left 954540315 3:51389394-51389416 CCTACCAGTTTCTGCTTTCCAGT 0: 1
1: 0
2: 2
3: 26
4: 292
Right 954540321 3:51389410-51389432 TTCCAGTTGCAGAGTTTGGGGGG 0: 1
1: 0
2: 0
3: 19
4: 194
954540315_954540320 -8 Left 954540315 3:51389394-51389416 CCTACCAGTTTCTGCTTTCCAGT 0: 1
1: 0
2: 2
3: 26
4: 292
Right 954540320 3:51389409-51389431 TTTCCAGTTGCAGAGTTTGGGGG 0: 1
1: 0
2: 2
3: 26
4: 252
954540315_954540318 -10 Left 954540315 3:51389394-51389416 CCTACCAGTTTCTGCTTTCCAGT 0: 1
1: 0
2: 2
3: 26
4: 292
Right 954540318 3:51389407-51389429 GCTTTCCAGTTGCAGAGTTTGGG 0: 1
1: 0
2: 2
3: 15
4: 209
954540315_954540319 -9 Left 954540315 3:51389394-51389416 CCTACCAGTTTCTGCTTTCCAGT 0: 1
1: 0
2: 2
3: 26
4: 292
Right 954540319 3:51389408-51389430 CTTTCCAGTTGCAGAGTTTGGGG 0: 1
1: 0
2: 4
3: 38
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954540315 Original CRISPR ACTGGAAAGCAGAAACTGGT AGG (reversed) Exonic
900247812 1:1646716-1646738 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900259039 1:1713870-1713892 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900504743 1:3023980-3024002 ACTGAAAGGCAGAGATTGGTAGG - Intergenic
900727814 1:4229800-4229822 ACTGGAAAACAGAAATTATTTGG - Intergenic
908530100 1:65026165-65026187 TCTGGAAAGCAAACACTGGCTGG - Intergenic
911850184 1:102807994-102808016 AATGGAAAACAGAAAATGGCAGG + Intergenic
912214712 1:107595339-107595361 CCTTGAAAGCAGAAACTGAAAGG - Intronic
913314593 1:117539381-117539403 GCTGGGAAGCAGGAAGTGGTGGG - Intergenic
914672234 1:149879748-149879770 ACAGGAAACCAGAAACCAGTGGG - Intronic
916376215 1:164156232-164156254 ATTGGGAAGAAGAAAATGGTAGG + Intergenic
916617741 1:166460003-166460025 ACTGGTAACCAGAGCCTGGTGGG - Intergenic
917266653 1:173227933-173227955 ACTGGGAAGCTCAAACTGGGTGG + Intergenic
917508149 1:175647818-175647840 AATTGAAAGAAGAAACTGATGGG - Intronic
918403316 1:184186772-184186794 AATTGAAAGCAGAATCTGGATGG + Intergenic
918557416 1:185819369-185819391 ACTGGAAAGCATATTTTGGTTGG - Intronic
919439704 1:197616448-197616470 ACTAGAAAGGAGAAACTGTTTGG - Intronic
922060524 1:222086350-222086372 ACTGGAAAGCAGAAGCATGGTGG + Intergenic
923015151 1:230120762-230120784 ACTGGAAAGAAGATACCGGCAGG - Intronic
923930687 1:238692653-238692675 GCTGGAATCCATAAACTGGTAGG + Intergenic
924353604 1:243145683-243145705 ACTGGAAAAAAGCAACTGGTGGG + Intronic
924428837 1:243979325-243979347 ACTGTACAGCAGAAGCTGCTTGG - Intergenic
1063310740 10:4949568-4949590 AATGGAGAGCTAAAACTGGTTGG + Intronic
1064954566 10:20893487-20893509 AGTGCAAAGCAGAAACTAGGTGG + Intronic
1065497504 10:26344627-26344649 ACAGGAAAACAGAAAAGGGTTGG + Intergenic
1067802516 10:49368878-49368900 ACCTGAGAGCAGAGACTGGTTGG + Intronic
1068040847 10:51822632-51822654 ACTGAACAGGAGAAACTGGTGGG - Intronic
1068088264 10:52401457-52401479 ACTGAAATTCTGAAACTGGTAGG - Intergenic
1068469939 10:57448239-57448261 ACTGGGAAGTACAAACTGGGCGG - Intergenic
1071314409 10:84380090-84380112 ACTGGAAGGTATACACTGGTAGG - Intronic
1071930574 10:90465396-90465418 ACAGAAAAGCAGAATCTGCTGGG + Intergenic
1072515484 10:96177729-96177751 AATGGAAAACAAAAACTGGTGGG + Intronic
1073287146 10:102395903-102395925 TCTGGGAAGCAGAACCTGGCCGG + Exonic
1073531729 10:104238640-104238662 ACAGGAAAACAGAAAAAGGTCGG - Intronic
1073978921 10:109131875-109131897 ACTGGGAAGCTCAAACTGGGTGG + Intergenic
1074138917 10:110653883-110653905 ATTGGAAAGTAGAAAGAGGTGGG - Intronic
1075512196 10:123081524-123081546 CCTGGACAGCAGAACCTGGCTGG - Intergenic
1077198053 11:1291402-1291424 ACTGGGAAGGAGGAACTGGCGGG - Intronic
1078636768 11:13058193-13058215 CCTGGAAAGCAGAAACAGTGTGG - Intergenic
1078977731 11:16496815-16496837 ACTGGGAAGCTCAAACTGGGTGG + Intronic
1079515837 11:21267824-21267846 ACTTTAAGTCAGAAACTGGTAGG - Intronic
1079814455 11:25038619-25038641 ACTGGAATTCAGAATCTGGATGG - Intronic
1083591462 11:63897787-63897809 ACTGTAAATCAGAAAATGATGGG + Intronic
1084795573 11:71502454-71502476 TCTGGATAGCAGAAAGTGGGGGG + Intronic
1084795588 11:71502532-71502554 TCTGGATAGCAGAAAGTGGGGGG + Intronic
1085483408 11:76841607-76841629 GCTGGAAGGGAGAGACTGGTGGG - Intergenic
1085832624 11:79917676-79917698 GGTGGAAAGCAGAAATTGGATGG - Intergenic
1085968503 11:81558050-81558072 TCTTGGAAGCAGAAACAGGTAGG - Intergenic
1086455713 11:86956497-86956519 ACTGGAAAGCAGAGAGAGGGTGG - Intergenic
1089896860 11:121939181-121939203 ACTGTAGAGCAAAAACTGATAGG - Intergenic
1090184642 11:124728980-124729002 ACTGAAAAGCAGAAACCTCTGGG - Intergenic
1090500738 11:127258174-127258196 ACCGGGAACCAGAAACAGGTTGG + Intergenic
1093576924 12:20742457-20742479 ACTGTAAAGCTTAAACTGATTGG - Intronic
1095065058 12:37762182-37762204 GCTGGAAAGCTCAAACTGGGTGG + Intergenic
1095595542 12:43953468-43953490 AATGGAAAGCAGAAAATAGCAGG + Intronic
1096013609 12:48245742-48245764 ACTGGCAAGCAGTAATTGCTTGG + Intergenic
1096550430 12:52368501-52368523 ACAGGGAAGCAGAAACTAGAAGG - Intergenic
1096662058 12:53131905-53131927 GATGGAAAGCAGAAGCTTGTTGG - Intergenic
1097583075 12:61481808-61481830 GCTGGAAATGAGAAAATGGTCGG + Intergenic
1097629234 12:62039487-62039509 ATTGTAAAGCAGAAACTTGATGG + Intronic
1098611445 12:72463413-72463435 ACTGGAAGGCAGAAATTGGCTGG + Intronic
1099727518 12:86452055-86452077 ACTGGCCAGTAGAAACTCGTGGG + Intronic
1099886848 12:88541924-88541946 AATGCAAAGATGAAACTGGTAGG + Intronic
1100223871 12:92536293-92536315 ACTGGAGAGCTGAAAGTAGTGGG - Intergenic
1101296103 12:103425065-103425087 ACTGGGAAGTAGGAACTGGACGG + Intronic
1101296234 12:103425863-103425885 ACTGGGAAGTAGGAACTGGACGG - Intronic
1103255206 12:119536238-119536260 AATGGAAAGCAAAAAATGGAGGG - Intronic
1105325880 13:19370416-19370438 CCTGGAAAGCAGACTCTGGATGG + Intergenic
1105519367 13:21117733-21117755 AATGGAAATAAGAAACTGGGAGG - Intergenic
1105557827 13:21462674-21462696 TTTAGAAATCAGAAACTGGTCGG - Intergenic
1106242091 13:27920558-27920580 ACCGGAAAGGAGAAAGGGGTGGG - Intronic
1106892856 13:34265162-34265184 ACTGTAACGAAGAAACTGATTGG - Intergenic
1106910792 13:34461513-34461535 TCTGCAAAGCAGAACCTGGAAGG - Intergenic
1107235958 13:38170972-38170994 GATGGTAGGCAGAAACTGGTAGG + Intergenic
1107284927 13:38780259-38780281 ACTGGAAAGATGAAATTGCTAGG - Intronic
1107807059 13:44163331-44163353 ACTGGAGGGCAGACACTGGCAGG - Intergenic
1108128606 13:47272420-47272442 ACTGGAAATCAATAACAGGTGGG + Intergenic
1108185475 13:47884508-47884530 ATTGGAAAGCAGAAACTTGGAGG + Intergenic
1109411340 13:61973299-61973321 AGAGGAAGGAAGAAACTGGTTGG + Intergenic
1112384872 13:98930363-98930385 ACTGGATGGGAGAAACTGGAGGG - Intronic
1116165350 14:41328186-41328208 ACTGGAAAGCAAAAACAAGTAGG - Intergenic
1116494912 14:45549554-45549576 AATGGAAAGCAAAAAAAGGTGGG - Intergenic
1117636419 14:57749144-57749166 ACAGGACAGTAGAAACAGGTTGG + Intronic
1117754188 14:58957078-58957100 ACTGGGAAGCTGAAACTGCTGGG + Intergenic
1118625089 14:67651451-67651473 AATGGAAAGCAGCAGCTTGTTGG + Exonic
1119166186 14:72495832-72495854 ACAGGGAAGGAGAAACTGGCTGG - Intronic
1119689389 14:76659176-76659198 TCAAGAAAGAAGAAACTGGTTGG - Intergenic
1120125302 14:80734962-80734984 AATGGAACACAGAAACTGCTTGG - Intronic
1121164628 14:91780411-91780433 ACTGTTAAGAAGAAACTAGTGGG - Exonic
1121655613 14:95593482-95593504 ACTGGAACTTATAAACTGGTGGG - Intergenic
1123928257 15:25140306-25140328 ACTGGAAACGAGAAACTGAGTGG + Intergenic
1125191988 15:37004144-37004166 AATGGTAAGTAGAAACTGCTAGG - Intronic
1125899034 15:43328685-43328707 AATGGAAAGCTGTTACTGGTTGG - Exonic
1126376345 15:48000717-48000739 ACTGGAAACAAGGAACTGGATGG - Intergenic
1126471074 15:49011278-49011300 ATTGCAAAGCAGAATCTAGTTGG - Intronic
1127130966 15:55863037-55863059 AATGGCAAGCAGCATCTGGTTGG + Exonic
1127993355 15:64136814-64136836 AAGGGAAAGCAAAAACTGGATGG + Intronic
1128827096 15:70729448-70729470 ACTGGTAAGCAGGAACATGTGGG - Intronic
1128994779 15:72288501-72288523 GCTGGACAGCAGAACCTGGTGGG - Intronic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129952274 15:79602311-79602333 GCTGGAAAGGAGAAGATGGTTGG + Intergenic
1131319635 15:91374786-91374808 ACTGGAAAGCAGAATCTGAGTGG - Intergenic
1133235683 16:4386380-4386402 CCTGGAAGGCAGGAAGTGGTGGG + Intronic
1133948938 16:10373632-10373654 ACTGGAAAGGCGGAAGTGGTAGG - Intronic
1136688132 16:32008002-32008024 ACTGGGAAGCGGTAACTGCTAGG - Intergenic
1136788735 16:32951557-32951579 ACTGGGAAGCGGTAACTGCTAGG - Intergenic
1136881077 16:33902377-33902399 ACTGGGAAGCAGTAACTGCTAGG + Intergenic
1137233545 16:46592813-46592835 ACTGGAAAACAGAAAATGGTGGG - Intronic
1139072703 16:63403015-63403037 AATGGAGAGCAGAAAGTAGTGGG - Intergenic
1140224641 16:73067583-73067605 ACTGCACAGCAGGAACTAGTTGG - Intergenic
1141115681 16:81307036-81307058 ACTTGAAAGCAGAAGCCGGAAGG - Intergenic
1141269410 16:82525266-82525288 ATTGGAAAGCTGAACCTGGCTGG + Intergenic
1203090932 16_KI270728v1_random:1213046-1213068 ACTGGGAAGCGGTAACTGCTAGG - Intergenic
1142817580 17:2439051-2439073 ACTAAAAACCAGAAACTGGGAGG + Intronic
1144513462 17:15897587-15897609 ACTGGTTAGCAGAAAGTTGTGGG - Intergenic
1144832913 17:18141645-18141667 ACTAGACAGCAGTACCTGGTAGG - Exonic
1146111440 17:30093663-30093685 ATTGGAAAGCAGAAAGTGGTGGG - Intronic
1146762689 17:35492306-35492328 ATTGGAAAGGAGAACCAGGTTGG + Intronic
1147398406 17:40163450-40163472 AATGGAATGAAGAAACTGTTAGG - Intronic
1148250810 17:46078355-46078377 AGTGGAAAGCAGTAATTGGAAGG - Intronic
1148253069 17:46102967-46102989 ACTTGGATGCACAAACTGGTAGG + Intronic
1149423718 17:56534743-56534765 ACTGGGAAGTATAAACTGGAGGG - Intergenic
1150937667 17:69654811-69654833 AATGAAAAAGAGAAACTGGTGGG - Intergenic
1151095318 17:71490807-71490829 GCTGGAGAGTAGACACTGGTGGG - Intergenic
1151108320 17:71645103-71645125 AATGGAAAGCAGAAAAAAGTAGG + Intergenic
1151896457 17:76983786-76983808 ACTTTAGAGGAGAAACTGGTGGG + Intergenic
1152583161 17:81177934-81177956 ACAGGGAAGGAGACACTGGTGGG - Intergenic
1154005982 18:10527476-10527498 ACTAGAAAGCAGAATGTTGTGGG - Intronic
1155090462 18:22504253-22504275 ACTTGCAAGCAGAAGATGGTGGG - Intergenic
1155433273 18:25784322-25784344 GCTTGAAACCAGAAACTGGAGGG + Intergenic
1155857322 18:30850033-30850055 ACTGGAAAGTTCAAACTGGGTGG - Intergenic
1159906788 18:74099645-74099667 TCTTGAAAGCAGCAACTAGTAGG - Intronic
1160327767 18:77966670-77966692 AATGGAATGCAGACACTGGATGG - Intergenic
1160461541 18:79042369-79042391 ACTGGAAAGAGGAAAAGGGTTGG - Intergenic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1164860892 19:31561332-31561354 GCTCGCAAGAAGAAACTGGTGGG - Intergenic
1164925799 19:32129104-32129126 CCTGGAAGGCAGAACTTGGTGGG - Intergenic
1166500751 19:43339417-43339439 CCAGGAAAGCAGAAACTTCTTGG - Intergenic
1166505212 19:43367100-43367122 CCAGGAAAGCAGAAACTTCTTGG - Intergenic
1166509345 19:43393995-43394017 CCAGGAAAGCAGAAACTTCTTGG + Intergenic
1166901953 19:46071356-46071378 ACTGGAAACCAGAAAGAGGGTGG - Intronic
1167393548 19:49212072-49212094 ACTGGAAAGTTGAAACTGGGTGG - Intergenic
1168440136 19:56357931-56357953 AATGGAAAGCAGAAACAAGCAGG + Intronic
1168469718 19:56630314-56630336 ACAGGAAAGCAGAAACTCAGAGG + Intergenic
1168662260 19:58176529-58176551 ACTTGAGAGCAAAAGCTGGTGGG - Intergenic
925179383 2:1807089-1807111 TCTGGAAGGCAGAAACTGACAGG + Intronic
925785641 2:7429674-7429696 ACTGGAAAGCAGAAACATACTGG - Intergenic
926556666 2:14365614-14365636 ACTTGAAAGCAGATTCTGGTTGG + Intergenic
929705306 2:44205493-44205515 ACTGGAAAGCAGAAACATCAAGG - Intronic
930481518 2:51953490-51953512 ACTGGAAAACAGGCAGTGGTTGG - Intergenic
930509815 2:52330305-52330327 ACTGGTTAGCAGAGACTGGTAGG + Intergenic
931204648 2:60135858-60135880 ACTGGGAAGCTCAAACTGGGTGG - Intergenic
931873714 2:66489106-66489128 ACAGGAAAGCAGCTACTGGCTGG - Intronic
931888899 2:66648240-66648262 GCTGGGAAGCTGAAACTGGGTGG - Intergenic
932226141 2:70042557-70042579 GAGGGAAAGCAGAAACTGATAGG + Intergenic
933052670 2:77618909-77618931 AATGGAAAACAGAAACAGGCCGG + Intergenic
935558799 2:104539895-104539917 ACTGCAAAGAGGAAACAGGTTGG - Intergenic
938672519 2:133599646-133599668 ACTGAAAAGAAGAGACTGATGGG + Intergenic
938896914 2:135761147-135761169 ACTGTAAAGAAGAATCAGGTTGG + Intronic
938998264 2:136703697-136703719 ACTGGAAAACAGGCACTGGATGG - Intergenic
939072003 2:137555040-137555062 ACTGGGAAGCTCAAACTGGGTGG + Intronic
939074116 2:137580173-137580195 AATGGAATCCAGAAACTAGTTGG - Intronic
939074873 2:137587979-137588001 ACTGGGAAGCTCAAACTGGGTGG - Intronic
939285233 2:140121144-140121166 ACTGGAAATAAGAATGTGGTTGG - Intergenic
939617837 2:144380334-144380356 CCTGGAAAACAGAAATTGTTTGG - Intergenic
939675245 2:145064063-145064085 ACTGGAAAGCATAAGATTGTAGG + Intergenic
939691353 2:145265694-145265716 TCTGGAAGACAGAAAATGGTGGG - Intergenic
940592814 2:155750560-155750582 AATGGAAAGCAGAAAAAAGTAGG + Intergenic
941014881 2:160344256-160344278 ACTTGTAAGCAGCAACTGGGGGG + Intronic
941353016 2:164459128-164459150 TCTGGAAAGCAGAGGCAGGTTGG - Intergenic
942113075 2:172701182-172701204 TCTGGGAAGCAGAATTTGGTGGG - Intergenic
942256314 2:174102703-174102725 AAGGGAAAGCAGAAACTGACAGG + Intronic
942481818 2:176396177-176396199 AAAGGAAAGGAGAAAATGGTTGG - Intergenic
943743071 2:191432076-191432098 AGTGGAAAGAACAAATTGGTGGG - Intergenic
946353346 2:219169622-219169644 ACTGCAAAGCAGGAGCAGGTGGG + Exonic
948206524 2:236165439-236165461 ACTGAAAAGCAGACATTGTTAGG - Exonic
948802604 2:240439685-240439707 ACTGAGAAGCAGATGCTGGTGGG - Intronic
1173529312 20:43756483-43756505 ACTGGAATCCAGAAAAGGGTGGG + Intergenic
1174707678 20:52673839-52673861 AGTGGAAACCAGAGAGTGGTTGG - Intergenic
1175305703 20:57974167-57974189 ATGGGAAGGCAGAAGCTGGTTGG - Intergenic
1176163006 20:63658086-63658108 AGTGGAACGCAGACCCTGGTGGG + Intronic
1178682105 21:34680951-34680973 ACTGGAAAACAGACAGAGGTTGG - Intronic
1179163866 21:38919921-38919943 CCAGGAAGGAAGAAACTGGTGGG - Intergenic
1180579431 22:16817353-16817375 CCTCAAAAGCAGAAACTGATTGG - Intronic
1181164467 22:20975995-20976017 GCTGGATAGGAGATACTGGTGGG + Intronic
1182306029 22:29369107-29369129 ACTTGAAAGGAGATATTGGTGGG - Intronic
1183290338 22:36998227-36998249 ACTGGAAGGCAGGATCTGGAAGG + Intronic
949137045 3:580323-580345 ACTGGAAAACAAAAAATGGCAGG - Intergenic
949373075 3:3356026-3356048 ACTGGAAAGCAGGAGTTGCTGGG + Intergenic
949683165 3:6539304-6539326 AATGGAAAGCAGAAAATAGCAGG - Intergenic
951947413 3:28155903-28155925 ACTAGAAAGAAGGAACTGGCAGG - Intergenic
953290186 3:41652636-41652658 AGTGAAAAGCAGAAAGAGGTGGG + Intronic
954177975 3:48859288-48859310 ACAGACAGGCAGAAACTGGTTGG + Intronic
954335335 3:49913131-49913153 AGTGGAAAGGAAAAAGTGGTTGG + Intronic
954534035 3:51344661-51344683 ACTGGATTTCAGACACTGGTAGG + Intronic
954540315 3:51389394-51389416 ACTGGAAAGCAGAAACTGGTAGG - Exonic
954978815 3:54724085-54724107 AATGGAAAGCAAAAAATGGCAGG + Intronic
955111130 3:55951073-55951095 ACAGGAAAGAAGAAACTGGAAGG + Intronic
955668050 3:61371030-61371052 CTTGCAAAGCAGAAACTGATTGG - Intergenic
957374102 3:79334646-79334668 ATTGGAAAGCACTAACAGGTTGG + Intronic
958569452 3:95860870-95860892 GCTGGAAAGCTCAAACTGGGTGG + Intergenic
959941585 3:112086613-112086635 ACTGGAAACCCGAAACTCGCGGG - Intronic
960283966 3:115807070-115807092 ACTGAAAAGCACCAACTGGTTGG - Exonic
961492784 3:127266777-127266799 ACTGGAAAGCAGGAACAGGGAGG - Intergenic
963191734 3:142480731-142480753 GCTGGAAAGCTGGAACTGGGTGG - Intronic
964514596 3:157494304-157494326 ATTGGAAAGATGAAAGTGGTGGG - Intronic
969097115 4:4741820-4741842 ACTGGATGGCAGAGTCTGGTTGG - Intergenic
970125047 4:12799766-12799788 ACTCTAAAGGAGAAACTGGAAGG - Intergenic
971072445 4:23110282-23110304 ATAGGAAAGAATAAACTGGTGGG - Intergenic
971372061 4:26027759-26027781 GCTGGAAGGCAGAGTCTGGTTGG + Intergenic
971708336 4:30077839-30077861 ATTGGAAAGCAGAAAAAAGTTGG - Intergenic
971864697 4:32154500-32154522 ACTGTAAAACAGCAACTGTTTGG + Intergenic
974877008 4:67713560-67713582 ACTGGCAATCAGGAACTGGCTGG - Intergenic
975160488 4:71119247-71119269 ACTGGAAGCCAGAAAATAGTGGG - Intergenic
975235902 4:71996513-71996535 GCTGGAAAGCTCAAACTGGGTGG + Intergenic
976527629 4:86113039-86113061 AATGGAAAGCAGAAAAAGGCAGG - Intronic
976954025 4:90871985-90872007 AATGAAAAGCAGAAAATGGCAGG - Intronic
977040028 4:92003969-92003991 AATGGAAAGCAGAAAAAGGGAGG + Intergenic
977087858 4:92627335-92627357 ACTGGAAAACAGGAACAAGTAGG - Intronic
978779343 4:112533687-112533709 AATGGAAGGGAGTAACTGGTGGG - Intergenic
978825381 4:113016361-113016383 ACTGCCAAGCAGAAACTTGGCGG - Intronic
979577327 4:122309423-122309445 ACTGGAAACCAGAAATTCATGGG + Exonic
980508710 4:133757817-133757839 AATGGAAAGCAGAAATTGACAGG - Intergenic
980521511 4:133941898-133941920 ACTGAGAAGCAGAAAATTGTGGG - Intergenic
981041978 4:140231607-140231629 AAAGGAAAGCAGAGACTTGTTGG + Intergenic
982461633 4:155676786-155676808 ACTGGAAAACAAAAAAAGGTTGG - Intronic
983065545 4:163206103-163206125 ACTGGTAAGAAGAAAATAGTAGG + Intergenic
983509156 4:168588868-168588890 ACTTGAAAGAAGAAATTGGCTGG - Intronic
986894262 5:12346721-12346743 ACTGGATAACAGAAAAAGGTTGG + Intergenic
988671955 5:33390999-33391021 AATGGAAAGCAAAAAATGGCAGG + Intergenic
989445533 5:41524328-41524350 ACTGGAAGGCAGGAAGTGGAAGG - Intergenic
989940639 5:50145930-50145952 ACTGGGAAGCACGAACTGGGGGG + Intergenic
990624335 5:57594542-57594564 AATGTAAAGCTGAAACTCGTTGG - Intergenic
991158076 5:63461548-63461570 AATGGAAAGCAGAAACAAGTAGG + Intergenic
991529906 5:67603968-67603990 GCTGGGAAGCTCAAACTGGTTGG - Intergenic
992526009 5:77610973-77610995 ACTGGAAAGCAAAAAAAGGCAGG + Intronic
993219083 5:85067015-85067037 ACTGCAAAGAAGAAGCTGTTTGG + Intergenic
993742270 5:91555859-91555881 GCTGGAAAGCTGGAACTGGGTGG + Intergenic
994444060 5:99849966-99849988 ACTGGTAAACATAAATTGGTTGG + Intergenic
999077038 5:148806179-148806201 ACCGGAAAGGAGAAATTGCTTGG + Intergenic
1001691772 5:173638704-173638726 GCTGGAAGGCAGAAATAGGTGGG + Intergenic
1001903098 5:175446965-175446987 CTTGGAAAGCAGGAACGGGTAGG + Intergenic
1002096231 5:176832777-176832799 AGTGGCAAGCTGAAGCTGGTTGG + Intronic
1003913545 6:10764578-10764600 CCTGGAACACAAAAACTGGTCGG - Exonic
1004985714 6:21079862-21079884 ACTGGCAAGTAGAAACAGCTTGG - Intronic
1005504261 6:26456500-26456522 ACTGGAAAGGAGGAACCAGTAGG - Intergenic
1007086538 6:39151470-39151492 ACTGGAAAGCTGAAACTCTATGG + Intergenic
1007989067 6:46236094-46236116 ACTGGAAACCAGAAATTACTTGG - Intronic
1007999524 6:46344406-46344428 ACTGGAAGGCATAAATTTGTGGG + Intronic
1008081474 6:47199272-47199294 ACTGGAGTGCAGAAAATGATAGG - Intergenic
1008895951 6:56555394-56555416 ACTTGAAAGCAGAACTTAGTAGG - Exonic
1009323704 6:62323381-62323403 ACTGGAAAGCAGAATATGGCAGG + Intergenic
1009447477 6:63759920-63759942 AATGGAAATCAGGGACTGGTTGG + Intronic
1010390441 6:75331052-75331074 TCAGGTAAGCAGAAACTTGTAGG + Intronic
1010482570 6:76373253-76373275 AATGGAAAACAAAAAATGGTAGG - Intergenic
1010725203 6:79325274-79325296 ACTGGGAAGCTCAAACTGGGTGG - Intergenic
1010922995 6:81707609-81707631 AATGAAAAGTAGAAACTGTTTGG - Intronic
1011521107 6:88207895-88207917 ACTGGAAAGCAGTGTCAGGTAGG - Intergenic
1012917103 6:105181936-105181958 ACTGGGAATCAGAAACTATTGGG - Intergenic
1013225270 6:108116087-108116109 ACTGGTATGCAGAAAGGGGTGGG + Intronic
1013844952 6:114438921-114438943 ACTGGAAAGAAGAAAATAATGGG + Intergenic
1014214954 6:118744579-118744601 CCTGGAGAGCAGAAAGAGGTTGG - Intergenic
1015409773 6:132880306-132880328 ACTGGAAAGCAAAAGTTGGAAGG - Intergenic
1016523858 6:144977375-144977397 ACCGGGAAGCAGAAACTGGGTGG - Intergenic
1016663189 6:146604797-146604819 ACTTGACAGGAGAAACTTGTTGG + Intronic
1019213901 6:170428398-170428420 ACTCTAATGAAGAAACTGGTGGG - Intergenic
1020490049 7:8770826-8770848 ATTGGAAAGCAGAAGGTTGTTGG + Intergenic
1020718985 7:11717456-11717478 CATGGAAAGCAGAAAATGGAGGG - Intronic
1020867724 7:13588492-13588514 AATGGAAAGCAGAAAAAAGTAGG - Intergenic
1020880396 7:13755023-13755045 GCTGGAGAGTAGAAACTGGGAGG + Intergenic
1022091217 7:27109208-27109230 ACTGGAAACCTCAAACTGGAAGG + Intronic
1022146486 7:27547134-27547156 GCTGGAAAGCAGCAAGTGATGGG - Intronic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1022993300 7:35729347-35729369 ACTGAAAAGCAGAAAGTGATGGG + Intergenic
1023794035 7:43776966-43776988 AATGGAAAACAAAAAATGGTAGG - Intronic
1027258788 7:76448906-76448928 ACTCGAATGAAGAAACTGATGGG - Intergenic
1027280091 7:76603239-76603261 ACTCGAATGAAGAAACTGATGGG + Intergenic
1027310153 7:76946983-76947005 ACTCGAATGAAGAAACTGATGGG - Intergenic
1029637466 7:101794510-101794532 AATGAAAAGCAGAAGCAGGTTGG + Intergenic
1031985588 7:128162785-128162807 ATTGGAAACCAGAAACATGTGGG + Intergenic
1033081526 7:138303339-138303361 ACTGGAGGACAGAAACTGGGAGG + Intergenic
1035835060 8:2741233-2741255 ACTGGAAAGGAGGAAGTGGCAGG + Intergenic
1037379719 8:18272121-18272143 ACTGTAATGAAGAGACTGGTTGG - Intergenic
1038957623 8:32484227-32484249 AAAGGAATGAAGAAACTGGTAGG + Intronic
1040298046 8:46173445-46173467 ATTGGAAAGCAGAAACTCAGAGG + Intergenic
1040328520 8:46374424-46374446 GCAGGAAAGCAGAAACTGAGGGG - Intergenic
1040388842 8:46932869-46932891 GCTGGAAGGCAGATCCTGGTGGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1042796064 8:72664725-72664747 ACTGGAAAGCAGTACTGGGTGGG - Intronic
1043182270 8:77100522-77100544 AATGAAAAGCAGAAAGTAGTGGG + Intergenic
1043728708 8:83647335-83647357 TCTGGAAAGCAGGGACTGGAGGG - Intergenic
1044792266 8:95859724-95859746 ACTGGAAAACAGAAACATGCTGG + Intergenic
1045212136 8:100109052-100109074 ACTGGGAAGCTCAAACTGGGTGG + Intronic
1047301903 8:123620777-123620799 AGTGGAAAGCTAAAACTTGTTGG + Intergenic
1047728768 8:127708345-127708367 GCTGAAAAGCAGGAACTGGAAGG + Intergenic
1050737534 9:8781085-8781107 ACTGGAAAAAAAAAAGTGGTTGG - Intronic
1051727517 9:20103189-20103211 ACTGGGAAGCTCAAACTGGGTGG + Intergenic
1051903259 9:22065248-22065270 ACTGGAAAGAGGAACCTGGTGGG - Intergenic
1057408688 9:94797011-94797033 ATTTGAAAGAAGAATCTGGTGGG + Intronic
1057465093 9:95306357-95306379 ATTACCAAGCAGAAACTGGTTGG + Intronic
1059116496 9:111604402-111604424 ACTGGAAAGCTGAAAGTGCAGGG - Intergenic
1059192981 9:112344501-112344523 ACTGGACAGCTGCATCTGGTGGG - Intergenic
1186204551 X:7187681-7187703 AATGAACAGCAGAAGCTGGTAGG + Intergenic
1187269556 X:17767527-17767549 ACAGGAAAACAGTAACTGGTAGG - Intergenic
1188384744 X:29542309-29542331 ACTGGAAAGCAAGAAGTGGAAGG - Intronic
1189344781 X:40232697-40232719 ACTGGAGAGCAGAAAGTTGCAGG - Intergenic
1190435243 X:50417985-50418007 ACAGGAAAACAGAAACTTTTTGG - Intronic
1191711398 X:64153071-64153093 GCTGGGAAGCACAAACTGGGCGG + Intergenic
1191750419 X:64536167-64536189 ACTGGAAATGAGAAACAGGAAGG + Intergenic
1192007667 X:67234578-67234600 ACTGGGAAGCTCAAACTGGGTGG + Intergenic
1192323359 X:70110610-70110632 ACTGTAACGAAGAAACTGATGGG - Intergenic
1192433029 X:71125478-71125500 AAGGGACAGCAGAAACTGGTGGG + Exonic
1193202603 X:78709645-78709667 TCTGGAAAGCAGGAAATGTTAGG - Intergenic
1193351063 X:80464855-80464877 AATGGAAAGCAAAAAATAGTAGG + Intergenic
1194962575 X:100252380-100252402 AATGGAAAACAGAAACAGGTAGG + Intergenic
1196592481 X:117503183-117503205 ACTGGAAAGAAGGAGGTGGTTGG + Intergenic
1196822003 X:119709082-119709104 ACTGGTAACCAGAAATGGGTTGG + Intergenic
1199594152 X:149493507-149493529 AGTGGAAAGCAGAAACAGGCAGG + Intronic
1200408982 Y:2843145-2843167 ACTTGGAAGCAGAAACTGACAGG - Intronic
1201779858 Y:17708837-17708859 GCTGGGAAGCTCAAACTGGTTGG + Intergenic
1201821697 Y:18197155-18197177 GCTGGGAAGCTCAAACTGGTTGG - Intergenic
1202054723 Y:20817998-20818020 GCTGGGAAGCACAAACTGGGTGG + Intergenic