ID: 954543039

View in Genome Browser
Species Human (GRCh38)
Location 3:51408593-51408615
Sequence CACTGTGCATGAGAGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954543036_954543039 18 Left 954543036 3:51408552-51408574 CCTACAAAGGAAAGTGAGTTTAA 0: 1
1: 0
2: 1
3: 24
4: 311
Right 954543039 3:51408593-51408615 CACTGTGCATGAGAGGCAGTAGG 0: 1
1: 0
2: 2
3: 16
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954543039 Original CRISPR CACTGTGCATGAGAGGCAGT AGG Intronic
902396699 1:16135769-16135791 CTCTGGGCAGGACAGGCAGTGGG + Exonic
902542516 1:17165045-17165067 CAGTGTTAATGGGAGGCAGTGGG + Intergenic
903484052 1:23676525-23676547 CACTGTGCTTGTGGGGCAGGTGG + Intergenic
904042353 1:27592258-27592280 CTCTGTGGATGACAGGCAGGGGG - Intronic
906008165 1:42496937-42496959 CTCTGTGCAGGAGAGCCACTAGG - Intronic
907580473 1:55567791-55567813 CACTGTGCATGAGCTGAAGCAGG - Intergenic
907699119 1:56766082-56766104 CACTTTGAAAGAAAGGCAGTGGG - Intronic
908573516 1:65435029-65435051 CTCTGTGAATGAGAATCAGTGGG - Exonic
910295582 1:85642019-85642041 CACTGTGCGTGAGCGGAAGCAGG + Intergenic
911388095 1:97203082-97203104 CACTGCTCTTCAGAGGCAGTAGG + Intronic
912639940 1:111335368-111335390 CACTGTGCATGAGCTGAAGCAGG + Intergenic
915643999 1:157254058-157254080 CACTGTGCATGAGCTGAAGTAGG + Intergenic
915947514 1:160164391-160164413 CAATGTGCCTGAGGGGCTGTTGG + Exonic
917214075 1:172659608-172659630 CACTTTGCAAGCCAGGCAGTGGG - Intronic
917275023 1:173322559-173322581 CACTGTGCATGAGCTGAAGCAGG + Intergenic
917498244 1:175562351-175562373 CACTGGCCATGTGAGGCACTTGG - Intronic
917639130 1:176965293-176965315 CACTGTGCCTGATACGAAGTGGG - Intronic
917670808 1:177271704-177271726 CACAGAGCATGAGAGGCAGCAGG - Intronic
917759866 1:178144516-178144538 CACTGTGCTTGACACGTAGTTGG + Intronic
919352866 1:196481686-196481708 CACTGGGCATGAAATTCAGTAGG + Intronic
920632245 1:207663611-207663633 CACTGTGCATGAGCCGAAGCAGG - Intronic
921574294 1:216815990-216816012 CACTTTGCATGTGAGCCATTTGG - Intronic
923276580 1:232401862-232401884 CCCTGTGCTGGAGAGCCAGTTGG - Intronic
923495773 1:234522925-234522947 CAATGTGCAGGAGAGTCATTTGG - Intergenic
923827008 1:237511532-237511554 CACTGCGCCTGAGAGGTTGTGGG + Intronic
1063570422 10:7210400-7210422 CACTGGGCAGCAGAGGCAGGAGG + Intronic
1065753256 10:28907997-28908019 CACTGTGGAGGTGAGACAGTGGG + Intergenic
1066371752 10:34823446-34823468 CACTGTGCATTAGAGTCACCAGG - Intergenic
1068778906 10:60898480-60898502 CAGTGTGTATGAGATGCAGAGGG + Intronic
1068943547 10:62705262-62705284 CATTGTGCATGAGAGTCACCTGG - Intergenic
1068970108 10:62949777-62949799 CACTGTGCATGAGCCGAAGCAGG + Intergenic
1070474227 10:76815970-76815992 CACTGTGCATGAGCCGAAGCAGG - Intergenic
1070512553 10:77174790-77174812 TACTGTGCATGAGAAGCACCAGG - Intronic
1071386427 10:85125897-85125919 CACTGTGCATGAGCGGAAGCAGG + Intergenic
1071941955 10:90600410-90600432 CACTATTCATGAGAAGCACTAGG - Intergenic
1072255113 10:93613629-93613651 GACTGTGAATGAGAGGCATGGGG - Intronic
1076307510 10:129475385-129475407 CACAGTGCATGAGAGGCGTGAGG + Intronic
1077946390 11:6904746-6904768 CACCGTGCATGAGCGGAAGCAGG + Intergenic
1079461216 11:20679805-20679827 TACTGTGCATGAAACACAGTAGG + Intronic
1080209733 11:29771640-29771662 CACTGTGCATGAGCTGAAGCAGG - Intergenic
1080937866 11:36882493-36882515 CCCTTTGCAGGAGGGGCAGTGGG - Intergenic
1081433840 11:43005337-43005359 CACTGTGCATGAGCCGAAGCAGG - Intergenic
1082103225 11:48191714-48191736 CACTGTGCATGAGCTGAAGCAGG - Intergenic
1082321666 11:50819188-50819210 CACTGTGCATGAGCCGAAGCAGG - Intergenic
1082894844 11:58179267-58179289 CACTTTGGAAGCGAGGCAGTGGG - Intronic
1083620335 11:64046220-64046242 CACTTTGGATGAGAGGGACTGGG - Intronic
1083739092 11:64698471-64698493 CATTTTGCAGAAGAGGCAGTAGG - Intronic
1084463428 11:69308824-69308846 CACTGTGCACCTAAGGCAGTGGG - Intronic
1084963690 11:72732374-72732396 AACTGAGCTTGAGAGGCAGAGGG - Intronic
1085370902 11:76004245-76004267 CACAGTGCATGACACACAGTAGG - Intronic
1085393147 11:76192858-76192880 CTCTGTACAGGAGAGGCAGGAGG - Intronic
1085967089 11:81540255-81540277 CACTGTGCATGAGACAAAGCAGG - Intergenic
1088371146 11:109089818-109089840 CACTCTGCATCATAGGCAGCTGG - Intergenic
1090700955 11:129295197-129295219 CACAGTCCAGGAGAGACAGTGGG + Intergenic
1091238635 11:134037759-134037781 CACTGTGGATTAGAGGGAGCCGG - Intergenic
1092244834 12:6858028-6858050 CACTGTGAAAGAGAGGCGGAGGG + Intronic
1092262201 12:6958758-6958780 CTGGGTGGATGAGAGGCAGTGGG + Intronic
1092957775 12:13565518-13565540 CACCGTGCAGGAGAGGCAACGGG + Intronic
1094354504 12:29563854-29563876 CACAGTGCATTAGAGTCCGTTGG - Intronic
1094840122 12:34339351-34339373 CCCCGTGCATGAGCGGCAGGGGG - Intergenic
1094861825 12:34476462-34476484 CACTGTGCATGAGCTGAAGCAGG + Intergenic
1095514561 12:42991751-42991773 CTCAGTGGAAGAGAGGCAGTAGG + Intergenic
1097313226 12:58144049-58144071 CAGTGTGTATGAGAGACATTCGG - Intergenic
1098179610 12:67832252-67832274 CACAGTCCAGGAGAGGCAGATGG + Intergenic
1101925282 12:108966535-108966557 CACTGTGCAAGCCAGGCAGCTGG - Intronic
1102572472 12:113835513-113835535 CACTCTGGCTGGGAGGCAGTGGG + Intronic
1105241286 13:18611082-18611104 GAGTTTGGATGAGAGGCAGTTGG + Intergenic
1106890805 13:34243561-34243583 CACTGTTCATTAGAGGCTGGAGG + Intergenic
1107227172 13:38065531-38065553 CACTGTGCATGAGCTGAAGCAGG + Intergenic
1108186143 13:47890353-47890375 CAGTGTGCATGACAGGAAGCTGG - Intergenic
1109113514 13:58352525-58352547 CACTGTGCATGAGCCGAAGTAGG - Intergenic
1110964273 13:81672632-81672654 CACTGTCCATGAGCAGCATTGGG + Intergenic
1111144102 13:84157860-84157882 CACTGTGAAGGAAAGGCACTGGG - Intergenic
1112349234 13:98619068-98619090 CCCTGTGCCTCAGAGGAAGTTGG - Intergenic
1116325126 14:43523706-43523728 CTCTGTGCATGATAGGATGTGGG - Intergenic
1116546118 14:46167102-46167124 CACCGTGCATGAGCTGAAGTAGG - Intergenic
1120544767 14:85797563-85797585 CACTGTGAATGAGAAACAATGGG - Intergenic
1122245686 14:100401726-100401748 CAGAGAGCCTGAGAGGCAGTGGG + Intronic
1122463911 14:101917583-101917605 CACTGTCCATCAGATGCAGAGGG + Intronic
1123467753 15:20529012-20529034 CACTCTGCAGGAGGGGCAGCAGG + Intergenic
1123490071 15:20774065-20774087 GAGTTTGGATGAGAGGCAGTTGG - Intergenic
1123546572 15:21343152-21343174 GAGTTTGGATGAGAGGCAGTTGG - Intergenic
1123650360 15:22472030-22472052 CACTCTGCAGGAGGGGCAGCAGG - Intergenic
1123728066 15:23124221-23124243 CACTCTGCAGGAGGGGCAGCAGG + Intergenic
1123740768 15:23280872-23280894 CACTCTGCAGGAGGGGCAGCAGG - Intergenic
1123746230 15:23321686-23321708 CACTCTGCAGGAGGGGCAGCAGG + Intergenic
1124278497 15:28345003-28345025 CACTCTGCAGGAGGGGCAGCAGG + Intergenic
1124304203 15:28566605-28566627 CACTCTGCAGGAGGGGCAGCAGG - Intergenic
1124423122 15:29539492-29539514 CACCGTCCATGGCAGGCAGTGGG - Intronic
1125492055 15:40155623-40155645 CACTGTGCCTGACAAGCAGCAGG - Intergenic
1125521093 15:40348247-40348269 CACAGTGATTCAGAGGCAGTTGG - Intergenic
1126580692 15:50240035-50240057 TACTGTGCATGAGAATCACTTGG + Intergenic
1127907869 15:63390084-63390106 CTCAGTGCTTGAGAGGAAGTTGG - Intergenic
1128315709 15:66657938-66657960 CACGGTGCCTGGCAGGCAGTAGG - Intronic
1128450442 15:67803092-67803114 CAGTGAGCATGGGAGCCAGTGGG + Intronic
1128747825 15:70126854-70126876 CTCTGTGCCTGAGAAGCAGCAGG + Intergenic
1128917139 15:71573218-71573240 CACAGTGCCTGACATGCAGTAGG + Intronic
1130100759 15:80892151-80892173 CACTGTGTATGACACGGAGTTGG - Intronic
1202954902 15_KI270727v1_random:70367-70389 GAGTTTGGATGAGAGGCAGTTGG - Intergenic
1132557927 16:580613-580635 CCCTCTGCATGTGAGGCTGTGGG + Intronic
1133665250 16:7961006-7961028 CAGGGTGCTTGAGAGCCAGTGGG - Intergenic
1136606532 16:31338042-31338064 CACTGTGCATGAGCCGAAGCAGG + Intergenic
1137532127 16:49284413-49284435 CAGTGTGTGGGAGAGGCAGTAGG - Intergenic
1138008441 16:53357698-53357720 CACTCTGCAGGAGGGGCAGCAGG + Intergenic
1139370861 16:66468737-66468759 GACTGTCCACGTGAGGCAGTGGG + Intronic
1141055072 16:80805984-80806006 CACTGTTCCTGAGAGAGAGTAGG + Intergenic
1141689295 16:85587441-85587463 CAGTGTGCATGTGAGGCTGTGGG + Intergenic
1142816570 17:2430817-2430839 CAATGAGCATGAGAGGGAATTGG - Intronic
1146329229 17:31913941-31913963 TACTTTGCTTGAGGGGCAGTGGG + Intergenic
1146758429 17:35454106-35454128 CACTGCTCATGAGAGGCAAGGGG + Intergenic
1147367196 17:39966659-39966681 CCCTGTGCATGCGTGACAGTGGG - Intronic
1151149632 17:72073794-72073816 CACTGAGCATGGCAGGCAGGGGG + Intergenic
1153134674 18:1901594-1901616 CACTGTCTATGGGTGGCAGTGGG - Intergenic
1153971573 18:10231893-10231915 GTCTCTGCATGAGAGGCAGGGGG - Intergenic
1154447672 18:14448819-14448841 GAGTTTGGATGAGAGGCAGTTGG - Intergenic
1156808298 18:41214514-41214536 CACAGTGCCTGAAATGCAGTAGG + Intergenic
1157332210 18:46712261-46712283 CAAAGTCCATGAGAAGCAGTAGG - Intronic
1158017990 18:52807273-52807295 CACCGTGCTAGAGAGGCAGGAGG - Intronic
1160706845 19:533843-533865 CGCTGTGCCTGGGAGGGAGTTGG + Intronic
1161391174 19:4021388-4021410 CACTGTGGAGGCGAGGCAGGTGG - Intronic
1163972041 19:20807881-20807903 CACTGTGCATGAGCTGAAGCAGG + Intronic
1164623317 19:29710619-29710641 CATGGAGTATGAGAGGCAGTGGG + Intronic
1164983080 19:32628588-32628610 CACTGTACAGCAGAGGCAGCTGG + Intronic
1165064482 19:33221037-33221059 CACTATGGAGAAGAGGCAGTGGG - Intronic
1165093845 19:33400154-33400176 AGCTGTGGGTGAGAGGCAGTGGG + Intronic
1165334500 19:35159916-35159938 CACTGTGCCTGGGCGGCAGGAGG - Intronic
1168438026 19:56337551-56337573 CACTGTGCATGAGCTGAAGCAGG - Intronic
1168592175 19:57646487-57646509 GAATGTGTATGAGAGGCTGTTGG - Intergenic
926338912 2:11887423-11887445 CACTGTGCATGAGCCGAAGCAGG - Intergenic
926783762 2:16499863-16499885 CACTGTTACTGAGAAGCAGTGGG - Intergenic
927236065 2:20875812-20875834 CACTGTGCATGAGCCGAAGCAGG - Intergenic
927938667 2:27089780-27089802 CTCTGTGCTTGACAGGCAGTTGG + Intronic
928081485 2:28316360-28316382 CACTGTGCATGTTTGGGAGTGGG + Intronic
928403504 2:30996472-30996494 CCCTGTGCTGGAGAGGCAGGTGG + Intronic
928420958 2:31137744-31137766 CGGTGTGCATGAGTGGCAGTGGG - Intronic
928837907 2:35569025-35569047 CACTGTGCATGAGCTGAAGTAGG - Intergenic
932650165 2:73546902-73546924 CACTGGGCATGGGAGAGAGTTGG + Intronic
932669146 2:73721553-73721575 CACTGTGCATGAGCTGAAGCAGG + Intergenic
932791560 2:74658076-74658098 CATTGTGCATGATAAGCATTGGG + Intronic
934653059 2:96103361-96103383 CACTGGCCATGAAAGGCAGAGGG + Intergenic
934730310 2:96652365-96652387 CACTGTGCCTGATACACAGTAGG + Intergenic
935228178 2:101072641-101072663 AACTGTGCATGCGAGGCATCTGG - Intronic
936048419 2:109204079-109204101 GACTGTTCATGACAGCCAGTGGG - Intronic
936500624 2:113063091-113063113 CACTATGCAGGAGAGGGAGGTGG + Exonic
936923794 2:117715964-117715986 CACTGTGCATGATATCCAGATGG + Intergenic
937074225 2:119089292-119089314 GACAGTCCTTGAGAGGCAGTGGG - Intergenic
937098493 2:119250906-119250928 CCCTTTGCATGAGAGGCCTTCGG - Intronic
937264086 2:120605268-120605290 CACAGTGCTTGGCAGGCAGTAGG + Intergenic
938133506 2:128736188-128736210 CACAGTGCAAGAGAGGCCCTGGG + Intergenic
939051716 2:137315355-137315377 CACTGTGCATGAGCCGAAGCAGG - Intronic
940182095 2:150946062-150946084 CACTGCCCAAGAGAAGCAGTTGG + Intergenic
943189956 2:184663404-184663426 CACTGTGCATGGGAGGGAGTTGG + Intronic
943952317 2:194146779-194146801 CAGAGTGCATGTGGGGCAGTGGG + Intergenic
945250903 2:207766122-207766144 CTTTGTGCCTGAGAGGTAGTGGG - Exonic
946640498 2:221778699-221778721 TACAGTGTATGATAGGCAGTGGG + Intergenic
946980715 2:225212450-225212472 CATTGTGCATGAGAGGTAAGAGG - Intergenic
948811143 2:240479031-240479053 CACTGGGAATGAGAGGAAGGAGG - Intergenic
948990510 2:241551673-241551695 CCCTGTGCCTGGGAGGCAGATGG - Intergenic
1171910739 20:30949962-30949984 CACTGTGCATGAGCCGAAGCAGG - Intergenic
1172034275 20:32000560-32000582 CCCTGGGGATGAGAGGTAGTTGG + Exonic
1175427302 20:58876670-58876692 CTCTGAGCATGAGAGGCGTTTGG + Intronic
1177003026 21:15636601-15636623 CACTGCTCATGAGAGGCAAGGGG - Intergenic
1177319978 21:19508757-19508779 AACTGTGCCTGAGAGGCTGATGG + Intergenic
1178031001 21:28526090-28526112 CACTTTGCCTGAAAGGCAATTGG + Intergenic
1178343212 21:31803508-31803530 CCCTTGGCATGAGAGGAAGTAGG + Intergenic
1178598476 21:33975903-33975925 ATCTGTGCATGAGTGACAGTGGG + Intergenic
1178687419 21:34722669-34722691 CACTGTGCCTGACAGACAGCTGG - Intergenic
1179618346 21:42596009-42596031 CACTGTGCCTGTGACGCTGTGGG + Intergenic
1179970652 21:44835436-44835458 CACTGAACGTGAGAGACAGTGGG + Intergenic
1182156972 22:28083684-28083706 CACCGTGCATGAGATGAAGCAGG + Intronic
1182299440 22:29329533-29329555 CACTGTGAATGTGTGGAAGTGGG + Intronic
1184419748 22:44372823-44372845 CAAGGTCCATGGGAGGCAGTGGG + Intergenic
949126589 3:452400-452422 CACTCTGCTTGAGAGGAGGTTGG + Intergenic
949387016 3:3514206-3514228 CACACTGAATCAGAGGCAGTGGG + Intergenic
950046601 3:9952018-9952040 CACTCTGCTGGAGAGGCTGTGGG + Intronic
950143544 3:10632076-10632098 CTCTGTGCCTGAGGAGCAGTGGG + Intronic
950788494 3:15454500-15454522 CACTGTGCACCAGAGGCAGAAGG + Intronic
951624221 3:24642532-24642554 CAATGTGCATGAGAGTCACCTGG + Intergenic
953536625 3:43781996-43782018 CACAGTGGATGGGAGGCTGTGGG - Intergenic
954449642 3:50564739-50564761 ATCTGTGCATGGGAGGCTGTTGG - Intronic
954543039 3:51408593-51408615 CACTGTGCATGAGAGGCAGTAGG + Intronic
955795720 3:62634841-62634863 CACTGTGCCTTTGAGGCACTGGG - Intronic
956242674 3:67147800-67147822 CACTGTGCATGAGACGAAGCAGG + Intergenic
956765963 3:72484773-72484795 CACTGTGCCTGAGAGACACACGG - Intergenic
957265404 3:77957067-77957089 CACTGTGCATGAGAACAAGATGG - Intergenic
959100856 3:102008361-102008383 CACTGTGCATGAGCTGAAGCAGG + Intergenic
961517707 3:127448551-127448573 GACTGTGGATGAGAGAGAGTGGG + Intergenic
961595347 3:128011554-128011576 CAGTGTGCATCACAGACAGTCGG - Intergenic
961843984 3:129745353-129745375 CACTGTGGCTGAGAAGCTGTTGG - Intronic
962887100 3:139637915-139637937 CACTCTGCATTAGACCCAGTGGG - Intronic
962889919 3:139662603-139662625 CACTGTACATCAGAGGAAGCAGG - Intronic
963722339 3:148876917-148876939 CACAGTGTATGAGATGGAGTTGG - Intronic
963818740 3:149864322-149864344 CACTATGCATGAGTGGAAGCAGG + Intronic
965922565 3:173935914-173935936 CACTGTCCATGGGGAGCAGTAGG - Intronic
966711961 3:182980578-182980600 CACTGCGCATGAGCGGGAGCCGG - Exonic
968522309 4:1039571-1039593 CAGTGTGCAGGAGAGGCTGAGGG - Intergenic
968829654 4:2926454-2926476 CACGGTGGCTGAGAGGCAGCCGG - Intronic
969345739 4:6568701-6568723 CTCTGTGCATGTAAGGCAGGAGG - Intergenic
970898676 4:21133227-21133249 CATTGTGTATGTGAGGAAGTAGG - Intronic
973051120 4:45598499-45598521 AAGTCTTCATGAGAGGCAGTAGG - Intergenic
974798418 4:66782926-66782948 CACTGTGCACGAGCGGAAGCAGG + Intergenic
975033218 4:69649917-69649939 GCATGTGCATGAGAGGGAGTGGG + Intronic
980155827 4:129103791-129103813 AACTATGCATTAGAGGCAGGGGG - Intronic
980467762 4:133207369-133207391 CACTGTGCATGACAGAAACTAGG + Intronic
983959453 4:173734622-173734644 CACTGTGCATGCCATGCACTGGG - Intergenic
984845477 4:184104497-184104519 CACTGTCCAGGAGAGGCTGCAGG + Intronic
986385614 5:7230750-7230772 CACTGTGCATGAGCCGAAGCAGG + Intergenic
986619089 5:9651991-9652013 CACTCTGCATGAGTGTCAGAAGG + Intronic
988722789 5:33894709-33894731 CAGTGGGCAGGAGAGGTAGTTGG - Intergenic
990060084 5:51636916-51636938 CACTGTGCATGAGCCAAAGTAGG + Intergenic
990684676 5:58288207-58288229 CACTGTGCATGAGCCGAAGCAGG + Intergenic
991089325 5:62678773-62678795 CACTGTGCATGAGCCGAAGCAGG - Intergenic
991598432 5:68328180-68328202 CACTGTGAATTAAAGGCAGTGGG - Intergenic
992354511 5:75967344-75967366 CACTGTGCATGAGCCGAAGCAGG + Intergenic
996600013 5:125252457-125252479 CACAGGCCATGTGAGGCAGTGGG - Intergenic
997137090 5:131337937-131337959 CACTGTGCGTGAGCGGAAGCAGG - Intronic
997411290 5:133692891-133692913 CACAGTGCAGCAGAGGCAGATGG - Intergenic
998189675 5:140012522-140012544 GAATGAGCATGAGAGTCAGTGGG - Intronic
1002399765 5:178985118-178985140 CAGTGTGGATGAGAGGCACAGGG - Intronic
1004642225 6:17526525-17526547 AACTGAGAATGAAAGGCAGTGGG - Intronic
1004895276 6:20141978-20142000 CACTGTGCATTCTAGGCAGGAGG - Intronic
1005839252 6:29730681-29730703 CAGTGGGCATGAGAGGCAGCAGG - Intronic
1005853150 6:29838074-29838096 CAGTGGGCATGAGAGTCAGCAGG - Intergenic
1007705539 6:43788524-43788546 CACTGTTCCTCAGATGCAGTGGG + Intergenic
1007726172 6:43917152-43917174 CTCTATTCTTGAGAGGCAGTAGG - Intergenic
1008239839 6:49097529-49097551 CACTGTGCATGAGCAGAAGCAGG + Intergenic
1008901113 6:56617163-56617185 CACTGTGACTGCCAGGCAGTTGG - Intronic
1009826928 6:68878995-68879017 CACTGTGAAAGAGAGCCGGTGGG - Intronic
1010095333 6:72036681-72036703 CACTGTGCATGACATATAGTAGG + Intronic
1011745873 6:90407297-90407319 CCCTCTGCAGGGGAGGCAGTGGG - Intergenic
1012570097 6:100713630-100713652 CACTGTGCTTGTGTGGGAGTAGG + Intronic
1013419440 6:109952719-109952741 CACAGGGCCTGAGAGGCAGATGG - Intergenic
1017113984 6:150959820-150959842 CACGGAGCATGAGACCCAGTAGG - Intronic
1017760797 6:157566638-157566660 CACATTGCCTGAGAGGCATTGGG - Intronic
1018162917 6:161065032-161065054 CACTGTCCATGAGAGGTATGAGG + Intronic
1018801116 6:167222844-167222866 CCCAGTGCATGACATGCAGTTGG - Intergenic
1018809017 6:167284327-167284349 CCCAGTGCATGACATGCAGTTGG + Intronic
1019392888 7:799337-799359 AACTGTGCATGAGAGGGATTAGG + Intergenic
1019401000 7:853761-853783 CAGTGTGCCGGAGAGGGAGTGGG + Intronic
1019605170 7:1906481-1906503 CAGGGTGCAGGAGAGGCAGCTGG - Intronic
1020110018 7:5442800-5442822 TACTTTGCATGGGACGCAGTTGG - Intronic
1021931558 7:25585946-25585968 CAGTGTGCATGAGATCCAGCTGG - Intergenic
1024477843 7:49832723-49832745 CACAGTTGATGAGAGGCTGTTGG - Intronic
1024842222 7:53600353-53600375 CACGGGGCATGGGAGTCAGTAGG + Intergenic
1027124043 7:75543309-75543331 CACTTTACATGAGAATCAGTTGG + Intronic
1027139771 7:75648783-75648805 CCCTGGGAATGGGAGGCAGTGGG + Intronic
1028199865 7:87948884-87948906 CACTGTGCCTGACACACAGTTGG + Intronic
1028665743 7:93342121-93342143 CACTGTGCATGAGCCGAAGCAGG + Intronic
1029124566 7:98287436-98287458 CCCTGTGCCTGGGAGGCCGTGGG + Intronic
1029790366 7:102837174-102837196 CACTGGGCATCAGAGCAAGTGGG + Intronic
1031646131 7:124228475-124228497 CACTGTGCTAGAGAGGCTGGTGG + Intergenic
1034358405 7:150472487-150472509 TACTGTGGATGAGAGACAGGAGG + Intronic
1034445325 7:151111128-151111150 CACTGAGCCCGGGAGGCAGTGGG - Intronic
1034853188 7:154515374-154515396 CACCGTGCATGAGAGGCCAGAGG + Intronic
1036567329 8:9948644-9948666 CACTGGGCTTGACAGGAAGTTGG + Intergenic
1036824726 8:11967159-11967181 CAGAGTGCATGAGAGGCAGTAGG - Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1040612320 8:48997768-48997790 CACTGTGCATGAGCCGTAGCAGG + Intergenic
1043865343 8:85368795-85368817 CACTGTGCATCAGAGCCAGGAGG + Intronic
1046007751 8:108506265-108506287 CACCGTGCATGAGCCGAAGTAGG - Intergenic
1046462101 8:114553033-114553055 GAATGGGCCTGAGAGGCAGTAGG - Intergenic
1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG + Intronic
1046894884 8:119462180-119462202 CACTGTGCATGAGCCGAAGCAGG - Intergenic
1047929213 8:129710017-129710039 CATTGTGCATGACACACAGTTGG + Intergenic
1049035432 8:140071836-140071858 CACTGCGTATGACAAGCAGTAGG + Intronic
1049212651 8:141393784-141393806 CACTGGACATGGGAGGCAGGAGG + Intronic
1049459312 8:142716301-142716323 AACTGTGCATGTGAGGGATTTGG - Intergenic
1051987194 9:23105257-23105279 CACTGTGCATGAGCCGAAGCAGG + Intergenic
1052923501 9:33992597-33992619 GACTTTGCTTGAGGGGCAGTAGG - Intronic
1055853997 9:80664152-80664174 CACTGTGCATGAGCCGAAGCAGG - Intergenic
1057604748 9:96491074-96491096 CACTGTGCTGGGGAGGAAGTGGG + Exonic
1057769472 9:97954799-97954821 CACTTTCCCTTAGAGGCAGTTGG + Intergenic
1057988828 9:99745796-99745818 CACTGTTACTGAGAGGAAGTAGG - Intergenic
1058723772 9:107783201-107783223 CATTGTGCCTGAGATGTAGTCGG + Intergenic
1058884007 9:109309331-109309353 CACTGTGAATGAGCTGAAGTTGG - Intronic
1060216391 9:121741034-121741056 CACTATTCTTGAGAGGTAGTAGG - Intronic
1060895294 9:127213091-127213113 CGCTGTGCAAGAGAGGAAATGGG - Intronic
1061034065 9:128103722-128103744 CACAGTGGAGGAGAGGCAGACGG + Exonic
1062536029 9:137021514-137021536 CACTGTGCCTGAGAGTCAGAAGG - Exonic
1186768363 X:12792985-12793007 CATTGTGAATGAGTGGCAGGTGG + Intronic
1187105424 X:16236676-16236698 CACTGTGCATGAGCTGAAGCAGG - Intergenic
1188281477 X:28275134-28275156 CACTATGCTTGAGAAACAGTTGG - Intergenic
1188518326 X:31011122-31011144 CAGTGGGCAGGAGAGGAAGTTGG + Intergenic
1190358258 X:49626025-49626047 CACCGTGCATGAGCCGAAGTAGG - Intergenic
1191157903 X:57295629-57295651 CACCGTGCATGAGCAGCAGCAGG + Intronic
1191589963 X:62871185-62871207 CACTGAGCATGAGATGAAGCAGG - Intergenic
1191704978 X:64084826-64084848 CACTGAGCATGAGATGAAGCAGG - Intergenic
1191979451 X:66909954-66909976 AACTGTGCATAAGATGCAATGGG - Intergenic
1192976131 X:76288155-76288177 CACTGTGCATGAGCCGAAGCAGG + Intergenic
1193072287 X:77319040-77319062 CACTGTGCATGAGCCGAAGCAGG + Intergenic
1193654315 X:84181157-84181179 CACTTTACAGGAGAGGCAGAGGG + Intronic
1193928230 X:87517732-87517754 CACAGTGTATCATAGGCAGTGGG + Intronic
1194446642 X:93995606-93995628 CACTGTGCTAGACAGGTAGTGGG - Intergenic
1195684005 X:107569585-107569607 CACAGTGCATCAGAGCCAGCTGG + Intronic
1196006017 X:110838115-110838137 CACAGTGCAGGACAGGTAGTGGG + Intergenic
1196173258 X:112613039-112613061 GACTGTGCATGAGGGACAGTGGG + Intergenic
1201534418 Y:15030420-15030442 AACTGTGCATGTGAGGGATTAGG - Intergenic
1201778829 Y:17696028-17696050 CACTGTGCATGAGCTGAAGCAGG - Intergenic
1201822727 Y:18209964-18209986 CACTGTGCATGAGCTGAAGCAGG + Intergenic