ID: 954553312

View in Genome Browser
Species Human (GRCh38)
Location 3:51499785-51499807
Sequence CCGGGCGGCAGAGTGGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 310}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954553312 Original CRISPR CCGGGCGGCAGAGTGGGCGC CGG (reversed) Intronic