ID: 954556274

View in Genome Browser
Species Human (GRCh38)
Location 3:51519939-51519961
Sequence ATGCTGAGGTAAAGGACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954556274_954556283 16 Left 954556274 3:51519939-51519961 CCTTCTGTCCTTTACCTCAGCAT No data
Right 954556283 3:51519978-51520000 TGGCTACTCTTGCCTCAATAAGG No data
954556274_954556280 -4 Left 954556274 3:51519939-51519961 CCTTCTGTCCTTTACCTCAGCAT No data
Right 954556280 3:51519958-51519980 GCATAGGTTGGGAGCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954556274 Original CRISPR ATGCTGAGGTAAAGGACAGA AGG (reversed) Intergenic
No off target data available for this crispr