ID: 954559000

View in Genome Browser
Species Human (GRCh38)
Location 3:51539668-51539690
Sequence AATCAGCTTTATGTGGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 1, 2: 4, 3: 17, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954559000 Original CRISPR AATCAGCTTTATGTGGGTCA TGG Intergenic
901042066 1:6370289-6370311 AAAGAGCTTTATTTGGCTCATGG - Intronic
904162345 1:28530981-28531003 AATTAGCTTTCTGCGGGGCAAGG + Intronic
906424447 1:45698465-45698487 AAGCAGTTTTGTTTGGGTCAAGG + Intronic
907413449 1:54298226-54298248 AATCAGCTTACAGTGGGGCAGGG - Intronic
908690301 1:66772187-66772209 AAACAGGTTTATTTGGCTCATGG + Intronic
911870587 1:103093107-103093129 ATGCAGCTTTATGTGGGTGAGGG + Intronic
913180059 1:116312346-116312368 GTTCAGCTTTGTGTGTGTCATGG + Intergenic
916983785 1:170168162-170168184 AATCAGCATTCTGTGCATCAAGG + Intergenic
917761611 1:178165868-178165890 TATTAGGTTTATGTTGGTCATGG - Intronic
918433373 1:184485623-184485645 ACTCAGCCTTTTGTGTGTCAGGG + Intronic
918513789 1:185340088-185340110 AAAGAGGTTTATGTGGCTCACGG + Intergenic
922925714 1:229345186-229345208 AAACAGGTTTATTTGGCTCATGG - Intergenic
922998049 1:229982546-229982568 AAAGAGGTTTATTTGGGTCACGG + Intergenic
923038189 1:230300325-230300347 AATCAGCTGTCTGTGAGGCAGGG - Intergenic
924250335 1:242126652-242126674 AATCAACTCAAGGTGGGTCAAGG + Intronic
1063121700 10:3109327-3109349 AACCAGGTCCATGTGGGTCAGGG - Intronic
1063880062 10:10522043-10522065 AGTCACCTTTATCTGGGGCAGGG + Intergenic
1064066441 10:12186180-12186202 ACTCAGATTTATGTGGGGGAGGG + Intronic
1064491709 10:15864721-15864743 AATGAGCTTTTTGTAGATCATGG - Intergenic
1065385354 10:25128300-25128322 AAAAAGGTTTATGTGGCTCATGG - Intergenic
1066145109 10:32549562-32549584 AATCAACTTAAGGTGGGTTAAGG - Intronic
1069970677 10:72165740-72165762 AATCAGCTTTAAATGTGTCAAGG + Intronic
1072419227 10:95275382-95275404 AATCAGCTCTATCTGGGCAATGG + Intronic
1075274126 10:121078204-121078226 AATCAGCTTGATGTTCCTCAGGG + Intergenic
1077378865 11:2218664-2218686 AATGAGATTTATTTGGCTCATGG + Intergenic
1077875640 11:6302706-6302728 AGCCAGCATTATGTGGGTCCTGG - Intergenic
1079245504 11:18749511-18749533 AATCAGCTGCATGGGGGCCACGG + Intronic
1082103299 11:48192379-48192401 AAACAGGTTTATTTGGGTTATGG + Intergenic
1084359939 11:68662623-68662645 AATCAGCTTCATCTGGGTAGTGG - Intergenic
1085163966 11:74379093-74379115 AATAAGTTTTATTTGGCTCATGG + Intronic
1085624734 11:78063416-78063438 AAACAGCTTGATGTGGGGCAAGG - Intronic
1086848310 11:91779006-91779028 AAACAGATTTAAGTGGGTCCAGG - Intergenic
1087171390 11:95052939-95052961 GAACAGTTTTATTTGGGTCATGG - Intergenic
1087861832 11:103167817-103167839 AGCCAGCTTTCTGTGGGTTATGG + Intronic
1088775099 11:113074969-113074991 AAACAGCTTCATGTGGCTCATGG + Intronic
1088780967 11:113133640-113133662 ACTCAGGTTTATGTGTGTGATGG + Intronic
1088923370 11:114278091-114278113 AAAGAGCTTTATTTGGCTCATGG + Intronic
1090539939 11:127690550-127690572 AAATAGGTTTATGTGGCTCATGG + Intergenic
1090811297 11:130246476-130246498 AATCAGCTTTATATGGGTCAGGG + Intronic
1091215559 11:133899303-133899325 GATCAGCTTTATGTGGAGTAAGG - Intergenic
1091551242 12:1536460-1536482 AATCAGCTTTAGGCTGGGCAAGG + Intronic
1092824377 12:12384735-12384757 TCTCAGATTTCTGTGGGTCAGGG + Intronic
1093865507 12:24222286-24222308 AATAAGCTTAAAGTAGGTCAGGG + Intergenic
1102901381 12:116640419-116640441 ACTCAGCTTTAAGAGGCTCACGG - Intergenic
1103061647 12:117863180-117863202 AAACAGCTGTACTTGGGTCAAGG + Intronic
1105321331 13:19324960-19324982 AAACAGCTTTAATTGGCTCATGG + Intergenic
1105467904 13:20664198-20664220 ATTCAGGTTTATGTGGGTCAGGG + Intronic
1107449066 13:40492337-40492359 AAACAGATTTATTTGGCTCATGG - Intergenic
1108128986 13:47276785-47276807 AAAGAGCTTTATTTGGCTCATGG + Intergenic
1108447246 13:50521826-50521848 ATTTAGCTTGATTTGGGTCAAGG + Intronic
1108986954 13:56603560-56603582 AAGAAACTTTATGTGGTTCAGGG - Intergenic
1110437074 13:75487070-75487092 AATTAACTTTATGTGCATCATGG + Intergenic
1111289004 13:86137678-86137700 AATCAACTTTTTGTGTTTCATGG + Intergenic
1111327562 13:86719169-86719191 AAACAGGTTTATTTGGCTCACGG - Intergenic
1111646052 13:91033197-91033219 AAGCAGCTTTATGTCTGCCATGG - Intergenic
1111753171 13:92359594-92359616 AAAAAGCTTTATTTGGCTCATGG + Intronic
1111968088 13:94881320-94881342 AAAGAGGTTTATGTGGTTCATGG + Intergenic
1113440443 13:110324239-110324261 ACTCAGCTTCATGGGCGTCAAGG + Intronic
1115375562 14:32671609-32671631 GATCATCTTTGTGTAGGTCAGGG + Intronic
1116340809 14:43721613-43721635 AAAGAGCTTTATTTGGCTCATGG + Intergenic
1118526745 14:66652992-66653014 ATTCAGCTGTCTGGGGGTCATGG + Intronic
1119978331 14:79051083-79051105 AAACTGCATTATGTGGGGCAGGG - Intronic
1120831678 14:89002977-89002999 AATCAGCTTTATGACAGTGATGG + Intergenic
1122029701 14:98903224-98903246 AAAAAGGTTTATGTGGCTCACGG - Intergenic
1124158105 15:27245880-27245902 AAACAGGTTTATTTGGCTCACGG + Intronic
1125881149 15:43197143-43197165 AAAGAGCTTTATTTGGCTCACGG - Exonic
1126253798 15:46600473-46600495 AATGAGGTTTATTTGGCTCATGG - Intergenic
1127583012 15:60354787-60354809 CATCAGCTTTTTGTGGGGGATGG - Intronic
1127641188 15:60917375-60917397 AAGTAGCTTTCTGTGTGTCAAGG + Intronic
1127968170 15:63939305-63939327 AATCAGCTTGATGTGTGGAATGG + Exonic
1128188429 15:65665786-65665808 ACTCAGCGTTATCTGGGCCAGGG - Intronic
1128400161 15:67270764-67270786 AAACAGATTTATTTGGCTCATGG - Intronic
1130058854 15:80555150-80555172 CATCAGCTTTAAGTGGGTACTGG - Intronic
1131325893 15:91444752-91444774 AATCAGAGTTCTGTGGGTCTAGG + Intergenic
1132813428 16:1813364-1813386 AAGGAGGTTTATGTGGCTCATGG - Intronic
1134259643 16:12640666-12640688 AATCAGCTATAGGTAGGGCAGGG - Intergenic
1137493992 16:48955150-48955172 ACTAAGATTAATGTGGGTCATGG - Intergenic
1138872193 16:60904325-60904347 AATCTGTTTTATGTGAGTCCTGG - Intergenic
1141288712 16:82697388-82697410 AATCACCTTTAAGGGGGCCAAGG + Intronic
1143451043 17:7036832-7036854 ACTCAGGTATAGGTGGGTCAAGG - Exonic
1146660987 17:34665071-34665093 AAAGAGGTTTATGTGGCTCATGG + Intergenic
1148127809 17:45245865-45245887 GCTCAGCTTTCTGTGGGCCAAGG - Exonic
1150966856 17:69980583-69980605 AATATTCTTTATGTGGGTGAGGG + Intergenic
1158484567 18:57854251-57854273 GATTACCTTTATGTGGGCCATGG - Intergenic
1158578340 18:58659515-58659537 AATAAGATTTATTTGTGTCAGGG - Intergenic
1159557296 18:69958697-69958719 AATCTGCATTTTGTGAGTCAGGG - Intronic
1160010014 18:75100211-75100233 AAATAGGTTTATTTGGGTCATGG + Intergenic
1161503969 19:4634031-4634053 AATCAGACTTATGTGGCTGATGG - Intergenic
1162523696 19:11195880-11195902 AATCAACTTTCTGTTGCTCAGGG - Exonic
1166241411 19:41497056-41497078 ACTCAGGTTTAATTGGGTCATGG - Intergenic
926014190 2:9434837-9434859 CATCAGGTGTATGTGGTTCAAGG + Intronic
927720462 2:25378828-25378850 AATCACATGTCTGTGGGTCAGGG + Intronic
929419482 2:41776224-41776246 AAACAGGTTTATTTGGCTCATGG - Intergenic
930805973 2:55490920-55490942 AACCAGCTTGAGGTGGCTCAAGG - Intergenic
933049822 2:77589928-77589950 AATCAACTGTAAGTGGATCAGGG + Intronic
933389169 2:81649562-81649584 AATCAGCTATATGTGGGCAGTGG - Intergenic
933636233 2:84711777-84711799 AATCACCCTTGTGTTGGTCAAGG - Intronic
933839370 2:86274266-86274288 TTTGAGCTTTATGTGGCTCAGGG + Intronic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
937558733 2:123193885-123193907 AAACAGGTTTATTTGGCTCATGG + Intergenic
937745703 2:125411053-125411075 AATCAGCTTCAGGTGGGTTATGG + Intergenic
938209132 2:129450997-129451019 AAACAACTTTATGTGGGCAACGG + Intergenic
940412177 2:153377686-153377708 AAATAGCTTTATTTGGCTCATGG - Intergenic
941245091 2:163086181-163086203 AATCAGCTCTATCTGGGCAATGG + Intergenic
942437087 2:175990457-175990479 AATGAGGTTTATTTGGCTCATGG - Intronic
943407157 2:187503681-187503703 AATCAGCATTAAGAGGGGCAGGG + Exonic
943597123 2:189871805-189871827 AATGAGGTTTATTTGGCTCATGG + Intronic
946452483 2:219792808-219792830 TCTCAGCTTTAAGTGGGTTAAGG - Intergenic
946835250 2:223766054-223766076 AATGAGCTTTATTTGGATGATGG - Intronic
947477810 2:230466939-230466961 ATTCAGATTTGTGTGGCTCAAGG - Intronic
948770806 2:240250503-240250525 ACTCTCCTTTATGGGGGTCAAGG - Intergenic
1170021949 20:11846379-11846401 AATCAGCTGTGGGTGGGTCGGGG + Intergenic
1171999876 20:31765762-31765784 AATCATCTTTATGTGGCTCAGGG - Intronic
1173319350 20:41973641-41973663 CAACAGCTTGCTGTGGGTCAGGG + Intergenic
1173423257 20:42921804-42921826 ACTCAGCTACATGAGGGTCATGG - Intronic
1173996270 20:47340932-47340954 AATTATCTTGATCTGGGTCAGGG + Intronic
1174536599 20:51256115-51256137 AATCAGCTTCATCTGGGCAATGG - Intergenic
1175195874 20:57243023-57243045 AAACAGCTGTATGTGGCTCATGG + Intronic
1175348186 20:58298033-58298055 AATCAGCTTTAAGTGGAAAAAGG + Intergenic
1177038587 21:16076811-16076833 AATCAGCTTAATTTGGGGAAGGG + Intergenic
1177188254 21:17821245-17821267 AAACAGGTTTATTTGGCTCATGG + Intergenic
1177475661 21:21618405-21618427 AACCACTTTTATGTGGATCAGGG + Intergenic
1178817526 21:35945322-35945344 GATCAGCTTGCTGGGGGTCATGG - Intronic
1179665161 21:42906203-42906225 AATGCGCTTTAGGTGGGTCGTGG + Intronic
1180259219 21:46656303-46656325 AATGAGGTTTATTTGGCTCATGG - Intronic
1180645143 22:17332655-17332677 CATCAGCCTTTTGTGGCTCATGG - Intergenic
949340089 3:3020305-3020327 GATCAGCTTTCTGGGAGTCACGG - Intronic
949702886 3:6779705-6779727 AATGAGCTACATTTGGGTCATGG - Intronic
950334422 3:12182215-12182237 AAGCAGCTTTATGTGGGAGTAGG + Intronic
951252965 3:20415859-20415881 AGTCATCTTTCTCTGGGTCATGG - Intergenic
951421295 3:22488907-22488929 CATCAGCTTTTTCTGTGTCAAGG + Intergenic
951989133 3:28656333-28656355 TCTGAGTTTTATGTGGGTCAGGG - Intergenic
953473281 3:43184650-43184672 GATCAGCTTTTTGTTGGGCATGG + Intergenic
954559000 3:51539668-51539690 AATCAGCTTTATGTGGGTCATGG + Intergenic
956449454 3:69358976-69358998 AAACAGATTTATTTGGCTCATGG - Intronic
957910130 3:86609317-86609339 AAAGAGTTTTATGTGGCTCATGG + Intergenic
958744478 3:98115798-98115820 TATCAGCATTATGGGAGTCAAGG - Intergenic
958901402 3:99891294-99891316 TCTCAGCTTTATGTGGGGCTGGG + Intronic
958906711 3:99949884-99949906 AATCAGCTGTGTGTGTGTTAGGG + Intronic
959712977 3:109403242-109403264 AATCAGGTTTACGTGGGGCAAGG - Intergenic
961952938 3:130769877-130769899 GTCCAGCTTTATGTGGGTCAGGG - Intergenic
962047069 3:131771658-131771680 AAACAGGTTTATTTGGTTCATGG - Intronic
964332500 3:155619449-155619471 AATCAGCTTTATGTTGGTGAAGG - Intronic
964569090 3:158093610-158093632 AATCAGTTTAATGTGTGTGAGGG - Intergenic
964608552 3:158585441-158585463 AAAGAGGTTTATTTGGGTCATGG - Intronic
965701862 3:171466142-171466164 AATATGATTTCTGTGGGTCAGGG - Intergenic
967489742 3:190076608-190076630 ATTCAGCTTTATTTGGTTCTGGG - Intronic
969931998 4:10639904-10639926 ATTCCACTTTATGTGCGTCATGG - Intronic
970807821 4:20056552-20056574 AAAGAGGTTTATGTGGCTCATGG + Intergenic
976633833 4:87267374-87267396 ATTCAGCATTATTTGGGTCAAGG - Intergenic
978744919 4:112182099-112182121 GATGAGCTGGATGTGGGTCATGG + Intronic
979552173 4:122003438-122003460 AATCAGCTCTAAGTGGGACATGG - Intergenic
980191488 4:129530450-129530472 AAGCAGGTTTTTGTGGGACAAGG - Intergenic
981426685 4:144611461-144611483 AATGAGGTTTAATTGGGTCATGG - Intergenic
981658570 4:147140356-147140378 AATCAGGTTTAGTTGGCTCATGG + Intergenic
982096118 4:151925044-151925066 AACCAGCTTTTCCTGGGTCAGGG - Intergenic
982202183 4:152971872-152971894 AATGAGCTCTGTGAGGGTCAGGG - Intronic
983925227 4:173393499-173393521 AATGGGCTTTTTGTAGGTCATGG + Intronic
984843634 4:184091572-184091594 AAACAGCTTTCTATGGCTCATGG + Intronic
985785874 5:1894235-1894257 CATCTGATTTTTGTGGGTCAGGG + Intergenic
986749899 5:10777558-10777580 AATCAGCTCTCTGGGGGTCAGGG + Intergenic
987069763 5:14325294-14325316 AAACAGGTTTATTTGGCTCACGG + Intronic
987651536 5:20747366-20747388 AATCATCTTTAAATGGGTCATGG - Intergenic
988542822 5:32127514-32127536 AAATAGCTCTATGTGGGTAATGG - Intronic
988744025 5:34114109-34114131 AATCATCTTTAAATGGGTCATGG + Intronic
989128449 5:38079652-38079674 AGTCAGCTTTATGTGGTGGAGGG + Intergenic
989218430 5:38928390-38928412 AAACAGGTTTAAGTGGCTCACGG + Intronic
990723986 5:58732934-58732956 AATTAGCTTGATCTGGGTGAAGG - Intronic
991467809 5:66932668-66932690 AATTAGCTATGCGTGGGTCATGG + Intronic
994389625 5:99176421-99176443 AATCCTAATTATGTGGGTCATGG + Intergenic
995980560 5:118097851-118097873 AATTAACTTTATTTGGGACATGG + Intergenic
997015600 5:129930686-129930708 AGTCAGCCTTATGGGGGTAAGGG - Intronic
999822194 5:155239406-155239428 AACCAGCTTTATTTGAGTCTGGG + Intergenic
1001890958 5:175338075-175338097 AAACAGGTTTATTTGGCTCATGG - Intergenic
1002391945 5:178921014-178921036 AACCAGCTTTCTGTGGGTTGTGG + Intronic
1003152811 6:3566813-3566835 AAAGAGGTTTATGTGGCTCACGG - Intergenic
1004734691 6:18393580-18393602 AATCAGCATTATGTTGATCTTGG - Intronic
1007044097 6:38754447-38754469 AATCAGTTTTATGTGGCTTATGG - Intronic
1008775002 6:55027514-55027536 AATCAGCTTCAGATGGATCAAGG - Intergenic
1009291118 6:61883918-61883940 AATCTGCTTTCTTTGGGTAAAGG + Intronic
1009674999 6:66807943-66807965 CATCAGCATTATGTGGATGAAGG - Intergenic
1010487363 6:76431503-76431525 AGTCAGCTGTATCTGTGTCATGG + Intergenic
1010946288 6:81976835-81976857 AAAAAGATTTAAGTGGGTCATGG - Intergenic
1011808296 6:91098555-91098577 AATGACCTTTATGTGGATTAAGG - Intergenic
1014813641 6:125911764-125911786 AATCAGATTCAAGTGGCTCATGG + Intronic
1015285981 6:131487026-131487048 AAACAGGTTTATTTGGCTCATGG + Intergenic
1015871317 6:137779229-137779251 AAACTGCTTTATGTGTCTCATGG - Intergenic
1017531720 6:155299432-155299454 AATCAGTTTTGTGTTGGGCATGG - Intronic
1017908512 6:158773138-158773160 AATCAGCGTTTTCTGAGTCAGGG - Intronic
1023124859 7:36945527-36945549 AATCAGCTTTATTAGAGTTATGG + Intronic
1024148390 7:46540642-46540664 AATTAGCTTTATTTTTGTCATGG - Intergenic
1024401992 7:48935011-48935033 AATAATCTTTCTTTGGGTCAAGG - Intergenic
1027830501 7:83170929-83170951 AATCAGCTTTGTGTATGCCATGG - Intergenic
1028827736 7:95293175-95293197 TATGAGCTGTATCTGGGTCAGGG + Intronic
1031961632 7:127995345-127995367 AGTCAGCTGTATGTGGGTCAGGG - Intronic
1033409834 7:141107314-141107336 AATCTGCTTTATGTTTTTCAAGG + Intronic
1033590805 7:142806701-142806723 AATCAGCTTTTTGGGAGCCATGG - Intergenic
1033614496 7:143000006-143000028 GCTAAGCTTTATGTGGTTCATGG + Intergenic
1033729162 7:144157684-144157706 AATTAGATTTATGAGGGCCAGGG - Intergenic
1033868545 7:145721436-145721458 AAACAGGTTTATTTGGCTCATGG + Intergenic
1034706393 7:153149437-153149459 AAAGAGGTTTATGTGGCTCATGG + Intergenic
1035235356 7:157494387-157494409 AAAGAGGTTTATGTGGCTCATGG + Intergenic
1035591937 8:822874-822896 AATCTGCTCTTTGTGGGTCTGGG - Intergenic
1035713514 8:1736935-1736957 AAACAGGTATATGTGGCTCATGG + Intergenic
1036023689 8:4878870-4878892 CATCAGCTTTTTGTGTGTCTGGG - Intronic
1037393760 8:18420767-18420789 AAAGAGGTTTATTTGGGTCATGG - Intergenic
1038489698 8:27961468-27961490 AAACAGGTTTATTTGGCTCATGG - Intronic
1039200223 8:35083055-35083077 CATGAGCTTGATGTGAGTCAGGG - Intergenic
1039934760 8:42032195-42032217 AGGCAGCTTGATGTGGCTCAAGG + Intronic
1045741296 8:105363080-105363102 ACTCACCTTTACATGGGTCAAGG + Intronic
1046791209 8:118324039-118324061 AATGAGCTTTCTTTGGGTAATGG - Intronic
1047304666 8:123643047-123643069 AAACAGGTTTATTTGGTTCATGG + Intergenic
1048534333 8:135278316-135278338 AATCAGCTTTATGTAGAACAGGG - Intergenic
1048671613 8:136729488-136729510 AATGAGGTTTATTTGGCTCATGG - Intergenic
1052086568 9:24274120-24274142 AATCAATTTTAGGTGGATCATGG - Intergenic
1054790756 9:69254218-69254240 AAGGAGCTTTCTGTGGCTCAGGG - Exonic
1058286073 9:103180093-103180115 AATCAGCTATTCCTGGGTCATGG + Intergenic
1059568074 9:115403654-115403676 AATCATATTGATGTGCGTCATGG + Intergenic
1062249467 9:135587083-135587105 AACAAGGTTTATGTGGGTCAGGG - Intergenic
1186248004 X:7635134-7635156 AATCTGCTTTATGTGGGACCTGG - Intergenic
1188211604 X:27432100-27432122 AAACAGTTTTATCTGGATCATGG + Intergenic
1188455566 X:30361143-30361165 AATTAGCATTATGTGGCTAATGG - Intergenic
1190914568 X:54801234-54801256 AATCAGCTCCATGGGGGCCAAGG + Intergenic
1192744154 X:73922084-73922106 AAAGAGGTTTATTTGGGTCATGG + Intergenic
1193046258 X:77058071-77058093 AAACAGGTTTATTTGGCTCATGG - Intergenic
1193632884 X:83911541-83911563 AAACAGGTTTATTTGGCTCATGG + Intergenic
1196673105 X:118390258-118390280 AATCATCTCTATGTGTGTCTTGG + Intronic
1196718499 X:118832100-118832122 AATGAGCTTTAGCAGGGTCAGGG - Intergenic
1196779037 X:119365914-119365936 ACTCAGCTTAATTTGGGACAGGG - Intergenic
1198028077 X:132728541-132728563 AATCCCATCTATGTGGGTCAGGG - Intronic