ID: 954566441

View in Genome Browser
Species Human (GRCh38)
Location 3:51604057-51604079
Sequence TGGTGAAAGTAGTTGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954566441 Original CRISPR TGGTGAAAGTAGTTGGATTC AGG Intronic
900240320 1:1614183-1614205 TGGTGGAAGTAGTTCCATTTTGG - Intergenic
900243311 1:1626859-1626881 TGGTGAAAGTGTTTGGAGACGGG + Exonic
901587743 1:10312302-10312324 TGGTGAAAAGAGATGGAGTCAGG - Intronic
907902439 1:58753214-58753236 TGGTGAAGGTAGGTGGAATCAGG + Intergenic
908001294 1:59682977-59682999 TGGTGAAAGGAGTTGGCCCCAGG - Intronic
910100968 1:83576451-83576473 TGGAGAGAGTAGTTGAACTCTGG - Intergenic
911201075 1:95044160-95044182 AAGGGAAAATAGTTGGATTCTGG - Intronic
914703531 1:150153768-150153790 TGGTGGAGGAAATTGGATTCGGG + Intronic
916304221 1:163311012-163311034 AGGTGAAGGTAATTGGATTATGG - Intronic
916924122 1:169499516-169499538 TGGTGAGAGTGGTGGAATTCCGG - Intergenic
917813895 1:178688042-178688064 TGGTGATAGTTGTTGGAATTGGG - Intergenic
918368543 1:183835728-183835750 GGGTGAAAGTAGTTGGTGTAGGG + Intronic
919261604 1:195202606-195202628 TGGTAAAAGTTCTTGGCTTCAGG - Intergenic
920779628 1:208975962-208975984 TGGTGAAAGTTGTTGAATATTGG - Intergenic
922967459 1:229702991-229703013 TGATGAAAGTAGTTTTCTTCAGG + Intergenic
923854316 1:237829375-237829397 TGCAGAAACTAGATGGATTCAGG - Intronic
1064628288 10:17283512-17283534 TGGTGGAGGTAATTGGATTATGG + Intergenic
1064774773 10:18764273-18764295 TGGTGGAAGTGGTCAGATTCAGG + Intergenic
1064926870 10:20579130-20579152 TGGTGACAGTAGCTGGGTGCAGG - Intergenic
1066105433 10:32152277-32152299 TGGTTGAAGTGGTTTGATTCAGG + Intergenic
1067197487 10:44134882-44134904 TGGTTAAACTAGGTGGGTTCAGG - Intergenic
1072172042 10:92873747-92873769 TGGTGAAAGAAATTGGATTCTGG + Intronic
1072517730 10:96202388-96202410 CAGTGAGAGTGGTTGGATTCTGG + Intronic
1072639465 10:97200622-97200644 TGGTGAAAGTTGTTACTTTCAGG - Intronic
1072734209 10:97868139-97868161 TGGAGAAAGTAGCTGGATGTTGG + Exonic
1074334189 10:112552257-112552279 TGGTGAAAGTAGATGGCATTTGG - Intronic
1075382546 10:122031006-122031028 GGGTGGAAGTAGGTGGAGTCAGG - Intronic
1076868651 10:133182021-133182043 TGGTGATAGTGGTTGGAGCCAGG + Intronic
1077436318 11:2540895-2540917 TGGTCAAGGTAGTTGAAGTCGGG + Intronic
1077905208 11:6527352-6527374 TGGTGAGAATTGGTGGATTCTGG + Intronic
1077956700 11:7028372-7028394 TGCTGAAAGTAGTCATATTCTGG - Intronic
1082805414 11:57446297-57446319 TGGTGACAGTCATTGGCTTCAGG + Intergenic
1084058362 11:66652470-66652492 TGGCAAAAGCAGTTGGGTTCTGG + Intronic
1085362342 11:75901568-75901590 TTGAGAAAGTAGATGGATTGTGG - Intronic
1085862389 11:80249524-80249546 CGGTGAAGGTAATTGGATCCTGG - Intergenic
1086747647 11:90450206-90450228 TGGAGAAAGTAGTTGTATTAAGG - Intergenic
1086966300 11:93031739-93031761 TGGTGAGAGTGGTTGACTTCAGG - Intergenic
1087911223 11:103755790-103755812 TGGTGAAAGTGGTTGGGCTGGGG + Intergenic
1091496025 12:973433-973455 TGATGAAAGTGGTTGAATTCTGG + Intronic
1092401595 12:8183347-8183369 TGGTGAAAGAAAGTGCATTCTGG + Intronic
1093671740 12:21884473-21884495 TTGTGAAAGTTGTTGGTTTTGGG + Intronic
1093779912 12:23123030-23123052 AGGTGGAAGTAGTTGGATTCTGG + Intergenic
1096434079 12:51573403-51573425 TGGTGAAAGAGGTGAGATTCTGG + Intergenic
1097274406 12:57802596-57802618 TTCTGCAAGAAGTTGGATTCAGG - Intronic
1098068555 12:66646831-66646853 TGCTGAAAGGAGTAGAATTCAGG + Intronic
1099095101 12:78365601-78365623 TGGTGAAAGTGTTTGGATCATGG + Intergenic
1100223937 12:92537565-92537587 TGGTGAAGGAACTGGGATTCAGG - Intergenic
1100956842 12:99918055-99918077 TGGGGAGAGTGGTTGGTTTCAGG - Intronic
1106068219 13:26379789-26379811 TGGAGAAGGTAGTGGGATTTGGG + Intronic
1106227044 13:27793470-27793492 AGGTCAAAGTCGTAGGATTCTGG + Intronic
1107703769 13:43077838-43077860 TGATAAAAGTGGTTAGATTCTGG - Intronic
1114244216 14:20897636-20897658 TGGTGAATGTATGTGGGTTCTGG - Intergenic
1114247253 14:20926139-20926161 TGGTGAATGTATGTGGGTTCTGG - Intergenic
1115266003 14:31500835-31500857 TCTTGAAAGTACTTGGATTCAGG + Intronic
1125615014 15:41003292-41003314 TGTTAAAAGTAGTGGGATTGTGG + Intronic
1127150653 15:56071555-56071577 TGGTGGCAGTAGCTGGATTTGGG - Intergenic
1127509470 15:59625746-59625768 TGGTGAAAGTGGCCAGATTCTGG + Intronic
1128457599 15:67840919-67840941 TGGTTAAAGTAGTTGGGATTTGG + Intergenic
1133633221 16:7641726-7641748 TAGTGAAAAGAGCTGGATTCAGG + Intronic
1135477021 16:22785821-22785843 TGGTGGAAGTTGTTGGGTTATGG - Intergenic
1135787545 16:25363925-25363947 TGGTGGCAGTAGGTGGATTCAGG + Intergenic
1135969312 16:27060800-27060822 TGGAGAAGCTAGTTGGATTCTGG - Intergenic
1136708047 16:32206045-32206067 TTTTGAAAGTAGTGGGATTGGGG - Intergenic
1136759863 16:32723369-32723391 TTTTGAAAGTAGTGGGATTGGGG + Intergenic
1136808241 16:33147017-33147039 TTTTGAAAGTAGTGGGATTGGGG - Intergenic
1137572585 16:49576446-49576468 TAGTGAATGTAGTTGCATTGGGG - Intronic
1137906167 16:52324286-52324308 TGGAGAAATTATTTGGATTCTGG - Intergenic
1137964383 16:52916205-52916227 TGCAGAAATTAGATGGATTCTGG - Intergenic
1138454057 16:57111012-57111034 TGATGGAAGTAGTTGGAGTGTGG + Intronic
1138996313 16:62457465-62457487 TGGTGAATCTAGATGGATTTGGG + Intergenic
1203062016 16_KI270728v1_random:983686-983708 TTTTGAAAGTAGTGGGATTGGGG + Intergenic
1143390800 17:6558067-6558089 TGGTGAACAGCGTTGGATTCAGG - Intergenic
1143646276 17:8232287-8232309 TGGTGGAAGGAGTGGGATGCTGG - Intronic
1146172162 17:30642609-30642631 TGCTGAAAGAATTTGAATTCAGG - Intergenic
1146345613 17:32058634-32058656 TGCTGAAAGAATTTGAATTCAGG - Intergenic
1148923308 17:51059806-51059828 TGGTAAAAGTGGTGAGATTCTGG - Intronic
1149430252 17:56592043-56592065 TGGTGAATGTGATTGGAATCTGG - Intergenic
1149934645 17:60792585-60792607 TGGTGAAGGTACTTGGATCATGG + Intronic
1150969777 17:70014534-70014556 TTGTGAAAGGAGAGGGATTCAGG - Intergenic
1151444978 17:74157579-74157601 AGGCGGAAGAAGTTGGATTCTGG - Intergenic
1155491986 18:26408526-26408548 TGATGAAACCAGTTTGATTCTGG - Intergenic
1155499423 18:26472045-26472067 TTGAGCAAGTAGGTGGATTCTGG + Intronic
1155913379 18:31531433-31531455 TGGTTGAAGAAGGTGGATTCTGG - Intronic
1156103389 18:33626417-33626439 TTATGAAAGTGGTGGGATTCAGG + Intronic
1156506345 18:37597256-37597278 TGTTGAAAATAGTTGGCTCCAGG - Intergenic
1156954390 18:42943911-42943933 AGAAAAAAGTAGTTGGATTCTGG - Intronic
1158312676 18:56175110-56175132 AGGTGAAAGTGGTAGCATTCTGG + Intergenic
1159994739 18:74953195-74953217 TGATGAAAATGGTTGGATTCAGG + Intronic
1159994932 18:74955284-74955306 TGGAGAGAGTAGTTTAATTCTGG + Intronic
1162874089 19:13608036-13608058 TGCAGGAAGTGGTTGGATTCAGG - Intronic
1162990262 19:14297429-14297451 TGCTGAAAGAATTTGAATTCAGG + Intergenic
1168582109 19:57564193-57564215 TGGGGAAAGTGGCTGGATTCAGG + Intergenic
928276817 2:29908777-29908799 TGGTTATAGTAGTTGGATAGAGG - Intronic
928494628 2:31819524-31819546 TAGTGAAAGTAATTGGATCATGG - Intergenic
928748960 2:34449079-34449101 TGGGGAAGGTAGTGGGAGTCGGG - Intergenic
929015163 2:37486577-37486599 TGTTGAATGTGGTTGGATTCTGG - Intergenic
929418083 2:41764176-41764198 TGATGAAAGTGGTCAGATTCTGG + Intergenic
929643798 2:43607675-43607697 TGGTGGAGGTATTTGGATTATGG - Intergenic
930829852 2:55731445-55731467 GGGTAAGAGTAGTTGGATTTGGG + Intergenic
931057719 2:58491468-58491490 TGGTTAAAGCAGTAGGATGCTGG - Intergenic
931494958 2:62795481-62795503 TGGAGAAAGGAGTTGGACTGAGG - Intronic
932077845 2:68681732-68681754 TGGGAAAAGTGGATGGATTCAGG + Intronic
932386268 2:71335871-71335893 TGGTAAAGGTTGTTGGAGTCAGG + Intronic
933909645 2:86928568-86928590 AGGTGAAAGTGGTTGGATTGTGG + Intronic
934023080 2:87974811-87974833 AGGTGAAAATGGTTGGATTGTGG - Intergenic
935594634 2:104869172-104869194 TGATGAAATTAGGTGGATTCCGG + Intergenic
936413463 2:112281506-112281528 AGGTGAAAATGGTTGGATTGTGG + Intronic
937647278 2:124279803-124279825 TGGTGAAACCTGTTGGATTCAGG + Intronic
940378618 2:152987373-152987395 TGGTGAAAATATTTGAATTAAGG - Intergenic
940390754 2:153130124-153130146 TGGGAAAAGTTGTTAGATTCTGG - Intergenic
940664216 2:156587634-156587656 TGGTGGAACTAGTTGTAGTCTGG - Intronic
941203272 2:162541158-162541180 TTGAGAAGGTAGTTGGATCCAGG + Intronic
941493114 2:166167094-166167116 TGCTAAAAGTAGTTGGCTTCAGG + Intergenic
942136247 2:172928521-172928543 TGGTGAAAGGAGATGTATTGGGG + Intronic
945683328 2:212939058-212939080 TGGGGAAAGTATCTGGATTGGGG + Intergenic
946180404 2:217945664-217945686 TGGTGAAAGCAGATGGACTATGG + Intronic
947249500 2:228086084-228086106 TGGAGAAAGTAGTGAGTTTCAGG + Intronic
1169829777 20:9811521-9811543 GAGTGAAAGTAGTTGGCCTCTGG - Intronic
1170135210 20:13066052-13066074 TGGTGAAAATAGGGGGATACTGG - Intronic
1170268572 20:14498664-14498686 TTGTGAAATTAGTTGTTTTCAGG - Intronic
1170748537 20:19123048-19123070 TGAAGAAAGTAGTTGGAAGCTGG - Intergenic
1173170106 20:40716781-40716803 TGGTGATAGAAGTGGGTTTCAGG - Intergenic
1173885554 20:46455198-46455220 TGGTGAAACTACTGGTATTCTGG + Intergenic
1175410711 20:58766295-58766317 TGGTGAAAGTTGTTGTTTTTTGG - Intergenic
1175485461 20:59342769-59342791 TGGGGAAAGTAGTAAAATTCAGG + Intergenic
1178580056 21:33830952-33830974 TGTTGACAGTAGGTGAATTCGGG + Intronic
1179899940 21:44385892-44385914 AGGTGGAGGTAGTTGGATTGTGG - Intronic
1181333499 22:22112811-22112833 TGGTAAAAGTAATTGGAGGCAGG - Intergenic
1181537842 22:23555966-23555988 TGCTGAAAGTAGCAGGAGTCCGG + Intergenic
1182580770 22:31309356-31309378 TGATGAAAGTAGATGGTTTCAGG + Intergenic
1182800915 22:33031423-33031445 AGTTGAAAGGAGATGGATTCCGG - Intronic
949364096 3:3262019-3262041 AGGTCAAAGCAGTAGGATTCTGG - Intergenic
949518894 3:4831822-4831844 GAGAGAAAGTAATTGGATTCAGG + Intronic
953266352 3:41392809-41392831 TGGTGCCAGTAATTGGATTAAGG - Intronic
954418591 3:50406493-50406515 TGGTGAATGGAGTAGCATTCTGG - Intronic
954566441 3:51604057-51604079 TGGTGAAAGTAGTTGGATTCAGG + Intronic
956806181 3:72814235-72814257 TGTTGAAAGTAGTTGGTGACTGG - Intronic
962100493 3:132337024-132337046 TGGAGAAAGGAATTTGATTCTGG - Intronic
962836901 3:139197707-139197729 TGGTGAAAGTTGCTGGAGTGGGG + Intronic
965468135 3:169057975-169057997 TGGTGAAAGTAGTAAAATTCTGG + Intergenic
965572793 3:170188503-170188525 TAGTAAAAGTATTTGGAGTCGGG - Intergenic
966752254 3:183333496-183333518 TGGTTAAAGTGGTTGCCTTCTGG - Intronic
967382198 3:188871244-188871266 TGGTGAAATAAGTAGGCTTCTGG - Intronic
967661551 3:192116713-192116735 GATGGAAAGTAGTTGGATTCTGG - Intergenic
968754698 4:2409254-2409276 TGGAGAAAGTAGATGGATCTGGG - Intronic
970928328 4:21479181-21479203 TGGTGATAGTAGGTGTCTTCTGG - Intronic
975080483 4:70273629-70273651 TGGTATAAGGAGTTGGATTTTGG - Intergenic
975990785 4:80257927-80257949 GGTGGAAAGTACTTGGATTCTGG + Intergenic
976366293 4:84236361-84236383 TGGTGAAAGCATTTGAATTTAGG + Intergenic
976503283 4:85816058-85816080 TGGTGGAGATAGTTGGATTGTGG - Intronic
976571725 4:86619572-86619594 TGGTGACAGGAGTTGAAATCTGG - Intronic
979567890 4:122177296-122177318 GGGGAGAAGTAGTTGGATTCTGG - Intronic
981430926 4:144658888-144658910 TGGTCCAAGTAGTTAGATGCTGG - Exonic
982536629 4:156615270-156615292 TGCTGAAAGTTTTTGGATTTGGG - Intergenic
983439461 4:167762989-167763011 TGGGGAAGGTAGGTGGATGCAGG - Intergenic
985195794 4:187427966-187427988 TTGTGAAAGTAGGTGGTTTGAGG - Intergenic
985883825 5:2660524-2660546 TGGGTAATGTAATTGGATTCCGG + Intergenic
986396099 5:7332272-7332294 TGGGGAAAGCAGGTGGGTTCTGG + Intergenic
987562838 5:19546449-19546471 AGGTGAAAATAATTGGATTCCGG + Intronic
987634796 5:20526177-20526199 TGGTGAAAAGGGTTGGATCCAGG - Intronic
989044690 5:37263084-37263106 TGGAGAAAGTAGGAGGCTTCAGG - Intergenic
989178384 5:38552808-38552830 TGGTCAAAATACTTAGATTCGGG - Intronic
991730842 5:69586537-69586559 TAGTGAAATTATTTGGTTTCTGG - Intronic
991772122 5:70050132-70050154 GAGTGAAAGTATTTGGATTCTGG + Intronic
991807278 5:70441699-70441721 TAGTGAAATTATTTGGTTTCTGG - Intergenic
991851415 5:70925550-70925572 GAGTGAAAGTATTTGGATTCTGG + Intronic
991864108 5:71041319-71041341 TAGTGAAATTATTTGGTTTCTGG + Intronic
992076853 5:73199751-73199773 TGGTGAAAGTATGTGCACTCTGG + Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
996862220 5:128080582-128080604 GGGGAAAAGTAGTTGAATTCTGG - Intergenic
998066612 5:139164428-139164450 TGGAGAAGGTATTTGGAGTCAGG - Intronic
999137452 5:149331991-149332013 TGGTGACAGTGATTGGATTAGGG - Intronic
1000641307 5:163705663-163705685 TGGGAAAAGTAGTAGGATGCTGG - Intergenic
1000730543 5:164829134-164829156 TAATGAAAATATTTGGATTCTGG + Intergenic
1002307548 5:178292684-178292706 TGGTGGACGTGGTTGGGTTCTGG + Intronic
1006382768 6:33710147-33710169 AGATGGAAGTGGTTGGATTCAGG - Intronic
1006454916 6:34126152-34126174 TGGTGAAAAAAGGTAGATTCAGG + Intronic
1007683217 6:43648759-43648781 CTGTGGAAGTGGTTGGATTCTGG + Intronic
1009287439 6:61838676-61838698 GGGTCAAAATAGATGGATTCAGG - Intronic
1009460950 6:63912651-63912673 TGGTGGAGGTGGTTGGATTATGG + Intronic
1009550935 6:65090192-65090214 AGGTGAAAGTAATTGGATCATGG + Intronic
1009710075 6:67307127-67307149 AGGTGAAAGTAATTGGATTATGG + Intergenic
1011065375 6:83320615-83320637 TGGAGAAAGTATTTTAATTCTGG - Intronic
1013098917 6:106971741-106971763 TGGTGGCATTAGTTGGATTTGGG + Exonic
1014002974 6:116385434-116385456 TGGTAAAAGTGGCTGGATTCTGG + Intronic
1014300523 6:119675944-119675966 AGAGGGAAGTAGTTGGATTCTGG + Intergenic
1015383085 6:132592082-132592104 AGGCAAAAGTAATTGGATTCTGG + Intergenic
1016539219 6:145144901-145144923 GGGAGAAAGTAGTTTGATTTAGG - Intergenic
1016580734 6:145627281-145627303 AGGTGAAAGTGGTTGGCTTGGGG + Exonic
1016760439 6:147730405-147730427 AGCTGTAAGTACTTGGATTCTGG + Intronic
1022356030 7:29615385-29615407 TGGTGAAAGTGGTTGCATTCAGG - Intergenic
1022819927 7:33949654-33949676 TGATGAAAGTTGTTAGATTCTGG + Intronic
1023216437 7:37868086-37868108 TGGAAAAAGTAGTTGGCTTGTGG + Intronic
1023631406 7:42167943-42167965 TGGGGTAAGAAATTGGATTCAGG - Intronic
1023938498 7:44755888-44755910 TGGGGAAAGTATTTGGAATCGGG + Intronic
1024932989 7:54684062-54684084 TGGTTTAAGTAGATGGTTTCAGG - Intergenic
1028278220 7:88886204-88886226 TGGTGATGGTAGATGGATTAGGG + Intronic
1032419309 7:131765030-131765052 TGATGAAAATAGTGGCATTCAGG + Intergenic
1032546588 7:132748871-132748893 TAGTGAAAATAGTAGGATTCTGG - Intergenic
1033781884 7:144680705-144680727 CAGTCAAACTAGTTGGATTCAGG - Intronic
1034022919 7:147664957-147664979 TTGTGAAAATAATTGGTTTCAGG - Intronic
1036029996 8:4959507-4959529 AGCTGGAAGTTGTTGGATTCTGG - Intronic
1036792068 8:11727515-11727537 TGGTTAAAGAAGCTGGAGTCAGG + Intronic
1037363330 8:18096611-18096633 TGGTGACAGTGTTTGGAGTCAGG - Intergenic
1038223840 8:25636343-25636365 TAGTGAAAGTGGTTAGAATCTGG - Intergenic
1040972578 8:53152954-53152976 TGGGGGAAGTAATTGGATTATGG + Intergenic
1044109044 8:88249073-88249095 TGGTGAAGGTTGTTGGTTCCAGG - Intronic
1046352311 8:113031857-113031879 TGGTGGAAGTGATTGGATTATGG + Intronic
1047464395 8:125098607-125098629 TGGTGAGAGTGGTTGGATTCTGG + Intronic
1047524033 8:125617165-125617187 TGGTCAAAGAAGTAGGACTCTGG - Intergenic
1047698053 8:127422837-127422859 TGGTGAAAGTGGTCAGATTAAGG + Intergenic
1047831333 8:128633814-128633836 AGGTGAAAGTAATTGGATCATGG + Intergenic
1047938937 8:129808610-129808632 TGGTGAAAAATGTTGGATTAGGG + Intergenic
1048076741 8:131079755-131079777 TGGTGAGTGTAGTTGGACTCTGG - Intergenic
1048272145 8:133038036-133038058 TAGTTAAAGTAGTTCCATTCAGG + Exonic
1050787078 9:9416916-9416938 TTGTGAAAGTACTTGTATTGAGG - Intronic
1053373099 9:37579150-37579172 TGGTGAATGTGGTATGATTCTGG + Intronic
1055890607 9:81120116-81120138 TGGTGAAAGCAAGTGAATTCAGG - Intergenic
1058172782 9:101702952-101702974 TGATGAAAGTGATTGAATTCAGG - Intronic
1060590201 9:124811550-124811572 TGGTGTGAGTAGTTGGGTCCAGG + Exonic
1060738923 9:126084921-126084943 GGGTGAAAGGAGCTGGTTTCTGG - Intergenic
1060783928 9:126434138-126434160 GTGTGACAGTAGTTGGATTCAGG - Intronic
1061975513 9:134066476-134066498 TGGGGAAAGTAGTTTGTTACTGG - Intronic
1189369155 X:40414109-40414131 TTGCCACAGTAGTTGGATTCTGG + Intergenic
1189688868 X:43594424-43594446 TGGTGAAAGTGGGCAGATTCAGG + Intergenic
1194072317 X:89340922-89340944 TAGTGAATGTAGTTAGATTTTGG - Intergenic
1195818675 X:108917905-108917927 TGGAGAAAGAATTGGGATTCAGG - Intergenic
1196228161 X:113189906-113189928 TGGTTAAAGTAGCTGAACTCTGG - Intergenic
1201306834 Y:12557714-12557736 TTGTGAAAGTGGTTGAGTTCTGG + Intergenic
1201895843 Y:18992547-18992569 TGGTGGCATTAGTTGGATTTGGG + Intergenic