ID: 954570389

View in Genome Browser
Species Human (GRCh38)
Location 3:51636259-51636281
Sequence CTAAGGGGCCTTTGCTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954570383_954570389 12 Left 954570383 3:51636224-51636246 CCATTCCTGTCATAGTTCTAATT 0: 1
1: 0
2: 1
3: 21
4: 256
Right 954570389 3:51636259-51636281 CTAAGGGGCCTTTGCTCATTTGG 0: 1
1: 0
2: 1
3: 5
4: 90
954570384_954570389 7 Left 954570384 3:51636229-51636251 CCTGTCATAGTTCTAATTCTACT 0: 1
1: 0
2: 1
3: 11
4: 142
Right 954570389 3:51636259-51636281 CTAAGGGGCCTTTGCTCATTTGG 0: 1
1: 0
2: 1
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954570389 Original CRISPR CTAAGGGGCCTTTGCTCATT TGG Intronic
902221074 1:14965818-14965840 CCAAAGGGCTTTTGCTCATATGG + Intronic
904602233 1:31679954-31679976 CTGCGGGGCCTTTGCACACTGGG + Intronic
905201633 1:36320479-36320501 CTCAGAGGCCTCTGCTCGTTGGG - Exonic
907991089 1:59583622-59583644 CTGAGGGGCATTTCCTCAATGGG + Intronic
915050048 1:153059309-153059331 GTAAAGGGCCTTTACTCAATAGG + Intergenic
915830716 1:159127311-159127333 CTAAGGGCCCCGTGCACATTTGG - Intronic
916246594 1:162694369-162694391 CTAAAGGGCCTTTCCTCAGAGGG - Intronic
917712791 1:177704249-177704271 CCCAGGGGACTTTGCCCATTAGG - Intergenic
922168999 1:223139470-223139492 CTGAGGGGCCTCTGCACATAGGG + Intronic
1064251492 10:13709752-13709774 CTGAGGGCCCTTTGCTCAGAAGG + Intronic
1066465066 10:35643025-35643047 CCAAGGGGGCTTTGATAATTAGG + Intergenic
1066632806 10:37473092-37473114 CTATGGAGTCTATGCTCATTTGG + Intergenic
1068118117 10:52756905-52756927 CTCAGGGGATTTTGCTCTTTGGG + Intergenic
1073106841 10:101036997-101037019 CTGAGGAGCCGCTGCTCATTCGG + Intronic
1076210907 10:128644170-128644192 ATAAGGGGCTTTTCCCCATTTGG + Intergenic
1076794417 10:132791668-132791690 GGAGGGGCCCTTTGCTCATTGGG + Intergenic
1080226803 11:29970993-29971015 TCAAGGTTCCTTTGCTCATTGGG + Intergenic
1084571444 11:69962392-69962414 CAAAGGGGCCATGACTCATTGGG - Intergenic
1088827229 11:113506312-113506334 CCAGGGGGCCTCTGCTGATTTGG - Intergenic
1089908043 11:122065706-122065728 ATAAGGGGCTTTTCCTCCTTTGG + Intergenic
1091233236 11:134001831-134001853 CTGAGCTGCCTCTGCTCATTAGG + Intergenic
1098562331 12:71888609-71888631 CTCAGTGGCCTGTCCTCATTAGG - Intronic
1099050279 12:77774235-77774257 CTATTGGGCCTTTCCTAATTTGG - Intergenic
1101961403 12:109253334-109253356 CTAGGTGTCCTTTGCTCTTTTGG + Intronic
1102151303 12:110690314-110690336 CAAAGGGGACTTTGCACATGTGG - Intronic
1108575314 13:51785256-51785278 ATAAGGTGCCTTTGTTCGTTAGG + Intronic
1111697118 13:91638781-91638803 CTAACGGGCTTTTTCTCATTTGG - Intronic
1113751115 13:112777068-112777090 CTCAGGGGTGTTTGCTCCTTAGG + Intronic
1116701436 14:48248267-48248289 GTAAGGGACATTTGCACATTTGG + Intergenic
1127070476 15:55283531-55283553 CTAATGTGGCTTTTCTCATTAGG - Intronic
1127606806 15:60594280-60594302 CTGAGGGGCGTTGCCTCATTGGG - Intronic
1128802208 15:70504087-70504109 CTTGGGGGCCTTTGCTCCTCTGG + Intergenic
1130872224 15:87980624-87980646 ATAAGGGGCCTCTGGACATTGGG + Intronic
1133597835 16:7310166-7310188 CTGCGGGTCCATTGCTCATTTGG - Intronic
1133637288 16:7680060-7680082 CAGAGGGGCCTTTGGTCATCCGG + Intronic
1136354729 16:29736928-29736950 ATAAGGGACTTTTGCTCCTTTGG - Intergenic
1146173726 17:30651547-30651569 CAAAAGGGACTTTGCTGATTAGG - Intergenic
1146347182 17:32067568-32067590 CAAAAGGGACTTTGCTGATTAGG - Intergenic
1147888091 17:43698128-43698150 CACAGGGCCCTTTGCTCAGTGGG - Intergenic
1151375143 17:73683286-73683308 CTAAGGGACCTTTTAACATTAGG - Intergenic
1155774457 18:29741253-29741275 ATAAGGAGCCTCTGCTCTTTTGG - Intergenic
1159068016 18:63591082-63591104 CTAAGGGGCATCAGCTGATTTGG - Intronic
1162988691 19:14288493-14288515 CAAAAGGGACTTTGCTGATTAGG + Intergenic
1163296486 19:16416083-16416105 CTAACCTGCCTTTGCTCATCAGG + Intronic
1163390524 19:17027320-17027342 CAAAGGGTCCTCTGCTCCTTGGG - Intergenic
1164233501 19:23311951-23311973 GTAATGTGCCTTTGCTGATTGGG + Intronic
925342298 2:3145948-3145970 CAAAGGGGCCTTTCCTCTGTGGG - Intergenic
926083166 2:10004952-10004974 CTAAGGGGCCTTTAGTCTCTGGG - Intergenic
927111146 2:19864494-19864516 CTATGGGGCCTTTCCTCTCTTGG + Intergenic
927162278 2:20277459-20277481 ATTCTGGGCCTTTGCTCATTTGG - Intronic
927923864 2:26995867-26995889 CTAATGGGCCTTTTCTGTTTGGG + Intronic
929824067 2:45296303-45296325 CTATGGGGCATTTGCACATGGGG + Intergenic
930491285 2:52075889-52075911 CTAAGGGGGTTTTGCTCTTGAGG - Intergenic
932074275 2:68648244-68648266 CTAAGGGGCATTGGGTTATTTGG + Intronic
935693532 2:105750926-105750948 CTAAGGGATGTTTGCTCATGTGG - Intronic
936249807 2:110859725-110859747 CTGAGGGGTCTTTGCTCACCAGG + Intronic
942460656 2:176165782-176165804 CTTTGGTACCTTTGCTCATTTGG - Intronic
942900499 2:181111087-181111109 ACAAGGTACCTTTGCTCATTGGG + Intergenic
946520131 2:220455663-220455685 CTAAGTTGCCTTTGATCAGTGGG - Intergenic
948305097 2:236940683-236940705 CAAAGAGGCCTCTGCTCATGGGG + Intergenic
1172216614 20:33240041-33240063 CTAAGTGGCCTTGGGTCACTTGG + Intronic
1172630885 20:36377569-36377591 CTCAGGCGCCTCTGCTCATCAGG + Intronic
1174758502 20:53183267-53183289 CAAAGGGGCCCTTACACATTGGG - Intronic
1174912882 20:54625432-54625454 TTAAGGTGCCTTTTATCATTTGG + Intronic
1177034877 21:16029638-16029660 CTAAGGTGTCTTTCCTGATTTGG + Intergenic
1182028309 22:27137687-27137709 CTAAAGGGCCCTTCCTCTTTAGG + Intergenic
1184522138 22:45001065-45001087 CTATGGGGCCCTTGCTCTTCCGG + Intronic
953651183 3:44806415-44806437 CTTAGCGGTCTTTGCCCATTAGG - Intronic
954570389 3:51636259-51636281 CTAAGGGGCCTTTGCTCATTTGG + Intronic
956542129 3:70351841-70351863 CCAAGGGGCCTTTGCTGTTATGG - Intergenic
957833302 3:85551460-85551482 CTAAGTAGCCTTTGATCATATGG + Intronic
958437747 3:94118591-94118613 CCAAGGGGCCATAGCTCATTTGG + Intronic
963913142 3:150832055-150832077 CTAAGGGTCCTTAGATCATCAGG - Intergenic
964766991 3:160188974-160188996 CTGAGGTGCCTTTGCCCTTTTGG + Intergenic
966287534 3:178315391-178315413 GTTAGGGGCATTTGCTCATTAGG + Intergenic
970050748 4:11912369-11912391 CTATGGGTCCTTTGCTAACTCGG - Intergenic
975992159 4:80268251-80268273 CTGTGGGGCTTTTGCTCAGTAGG + Intronic
980580147 4:134739960-134739982 CAAAGAGGCTTTTACTCATTAGG - Intergenic
997438007 5:133889039-133889061 CTAAAGGGCCTTTGCAGATGGGG + Intergenic
997476578 5:134145990-134146012 CAAAGGGGCCTTTTGTCACTAGG - Intronic
1000035841 5:157447356-157447378 CCCAGGGGCCTTTGCCCATCAGG + Intronic
1016754701 6:147671602-147671624 CTAGTGGGTCTTTGGTCATTGGG + Intronic
1023855231 7:44179012-44179034 ATAAGGGGACTTTGCTGATGTGG + Intronic
1024246899 7:47477492-47477514 CTAAGGGGCTTCTGCTCTCTGGG - Intronic
1024423104 7:49193076-49193098 ATAAGGATCCTTTGCTAATTTGG + Intergenic
1040016782 8:42706614-42706636 CTAGGGGGCATTTGCTCAGAGGG - Intronic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1048226092 8:132586911-132586933 CTAAGGTGCCATTGCTCCTTGGG - Intronic
1054905221 9:70408550-70408572 CTAAGGGGCCTTAGCTCACTGGG - Intronic
1055641013 9:78319056-78319078 CTTAGTGGCCATTGCTCTTTGGG + Intronic
1056055435 9:82817976-82817998 CCAAGGGGCCTTTGAGCATAAGG - Intergenic
1056538898 9:87554710-87554732 CTGATGGCACTTTGCTCATTTGG - Intronic
1056809242 9:89751464-89751486 CTAAGGGGTCTCTGCTCTCTTGG - Intergenic
1059886682 9:118751936-118751958 CTAAGGGCTCTTTGCTCAACAGG - Intergenic
1060029678 9:120203467-120203489 CTAAATGGCCTTTGCTAATTAGG + Intergenic
1198736083 X:139786654-139786676 ATAAGGTGGCTTTGTTCATTAGG + Intronic
1201940085 Y:19449825-19449847 CTAAGAGGCCTTTGGTCCTAAGG - Intergenic