ID: 954570893

View in Genome Browser
Species Human (GRCh38)
Location 3:51639930-51639952
Sequence GTGGAAAAGCAGTACCATCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954570893_954570897 3 Left 954570893 3:51639930-51639952 CCAAGATGGTACTGCTTTTCCAC 0: 1
1: 0
2: 3
3: 11
4: 156
Right 954570897 3:51639956-51639978 ATTGAGGAAAGTGTGAAGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 226
954570893_954570901 29 Left 954570893 3:51639930-51639952 CCAAGATGGTACTGCTTTTCCAC 0: 1
1: 0
2: 3
3: 11
4: 156
Right 954570901 3:51639982-51640004 CAAGATCCTTGTGTTTAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 144
954570893_954570900 25 Left 954570893 3:51639930-51639952 CCAAGATGGTACTGCTTTTCCAC 0: 1
1: 0
2: 3
3: 11
4: 156
Right 954570900 3:51639978-51640000 GGGACAAGATCCTTGTGTTTAGG 0: 1
1: 0
2: 0
3: 6
4: 114
954570893_954570899 5 Left 954570893 3:51639930-51639952 CCAAGATGGTACTGCTTTTCCAC 0: 1
1: 0
2: 3
3: 11
4: 156
Right 954570899 3:51639958-51639980 TGAGGAAAGTGTGAAGCTTGGGG 0: 1
1: 1
2: 0
3: 23
4: 269
954570893_954570898 4 Left 954570893 3:51639930-51639952 CCAAGATGGTACTGCTTTTCCAC 0: 1
1: 0
2: 3
3: 11
4: 156
Right 954570898 3:51639957-51639979 TTGAGGAAAGTGTGAAGCTTGGG 0: 1
1: 0
2: 4
3: 11
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954570893 Original CRISPR GTGGAAAAGCAGTACCATCT TGG (reversed) Exonic
900506597 1:3032483-3032505 GAGGAAAAGGAGGACCATGTGGG + Intergenic
900972676 1:6000186-6000208 ATGGAAAGGCAATACCCTCTAGG - Intronic
901191195 1:7410787-7410809 GTGGAAAAGCAGGGCGTTCTGGG + Intronic
904439448 1:30520891-30520913 GGAGAAAAGCAGCACGATCTTGG + Intergenic
911174392 1:94804605-94804627 GTGATAAAGCAGTGCCGTCTGGG + Intergenic
912215595 1:107607536-107607558 GTGGAAAAGGTGAACCATGTAGG - Intronic
912442928 1:109712666-109712688 GTGGAAAAGAAGTACACGCTGGG + Exonic
915122788 1:153641886-153641908 GTTCAAAAGCAGTACAATCCAGG + Intronic
916793736 1:168146587-168146609 ATGGAAAAGCATTACCATCTGGG - Intergenic
919033919 1:192281558-192281580 ATTGAAAGGCAATACCATCTAGG - Intergenic
1064957834 10:20930999-20931021 GTGGAAAATCAGTACTGTTTAGG + Intronic
1065730969 10:28709300-28709322 TTGGAGAAGCAGTTCCAGCTGGG + Intergenic
1067208595 10:44240201-44240223 GTGCAGTAGCTGTACCATCTAGG + Intergenic
1068241089 10:54301522-54301544 GTTGAAAAGAAGTACAATCCAGG + Intronic
1068935787 10:62634261-62634283 GTTTAACAGCAGTACCATGTTGG + Intronic
1074404600 10:113169962-113169984 GGGGAAAGGAAGTTCCATCTTGG - Intergenic
1074939847 10:118223646-118223668 GTGGAAATCCAGTTCCCTCTTGG - Intergenic
1077972455 11:7208704-7208726 GTGGTACATCAGTATCATCTAGG - Intergenic
1078616508 11:12870833-12870855 GGGGTACAGCAGTACAATCTCGG - Intronic
1080250000 11:30222632-30222654 CAGGAAAAGCAGGACCAACTGGG - Intergenic
1084532525 11:69736611-69736633 GTGGAAAAGCAGATCCATGCTGG + Intergenic
1085218520 11:74852764-74852786 CTGGAAAAGCTGGACCATCTTGG + Intronic
1086152359 11:83625891-83625913 ATGGAAATCCAGTACCAGCTTGG - Intronic
1092634278 12:10424465-10424487 GTGTAGTAGCTGTACCATCTAGG - Intronic
1092635324 12:10439869-10439891 GTGTAGTAGCTGTACCATCTAGG - Intronic
1093617495 12:21244481-21244503 GAGGAAAAGCAGTACTAACAGGG + Intergenic
1093677271 12:21958090-21958112 GTGCAAAAGCAATGCCATTTTGG - Intergenic
1094035710 12:26068191-26068213 GAGGAAAACCAGTAACATTTAGG + Intronic
1096198247 12:49663002-49663024 CTGGAAAACCAGTGCCATGTTGG + Intronic
1096646808 12:53043042-53043064 GTGAAAAAGCATTACCTTGTAGG - Intergenic
1097625884 12:61999890-61999912 GTGGGAAAGAGGTAGCATCTTGG + Intronic
1097754138 12:63390254-63390276 GTGGAAAAATCGCACCATCTGGG + Intergenic
1102181811 12:110918344-110918366 GGTGAAAAGCAGTATCTTCTGGG - Intronic
1102231655 12:111266727-111266749 GTAGAAAAGCACCACCAACTGGG - Intronic
1104008817 12:124914726-124914748 GAGGAAAAGTAGTCCCTTCTCGG - Exonic
1107990431 13:45814426-45814448 CAGGAAAACCAGCACCATCTCGG + Intronic
1111139722 13:84100243-84100265 GTGTAAAAGCAATAAAATCTAGG - Intergenic
1111540056 13:89657771-89657793 GTGGAAGGGCACTACCATATTGG - Intergenic
1113355457 13:109575932-109575954 TAGGAAAAGCACTACCTTCTGGG - Intergenic
1116709493 14:48348429-48348451 ATGGAAAATCAGGAACATCTTGG - Intergenic
1120430183 14:84403458-84403480 GTGGAAAAACAGCAGCATATGGG - Intergenic
1124400576 15:29344429-29344451 GAAGAAAAGTATTACCATCTGGG + Intronic
1125709314 15:41771959-41771981 GTGGTTAAGCAACACCATCTAGG - Intronic
1126111675 15:45178832-45178854 GTGGAAAAGATGTACCACTTGGG - Intronic
1131738959 15:95365795-95365817 GTGGAAATGAAGTAACATCCTGG + Intergenic
1132377084 15:101335834-101335856 GTGGAGTAGGGGTACCATCTAGG - Intronic
1133096160 16:3447477-3447499 CTTAAAAGGCAGTACCATCTGGG - Intronic
1133328848 16:4958740-4958762 GTGCAAAAGCAGTCCCGTGTGGG + Intronic
1133443078 16:5836823-5836845 GTGGACAAGCATTCTCATCTGGG - Intergenic
1133902588 16:9991298-9991320 GTGGAGAACCAGTTCAATCTTGG + Intronic
1134542480 16:15078766-15078788 TTGGAAGAGTAGTTCCATCTTGG - Intronic
1135360058 16:21804849-21804871 TTGGAAGAGTAGTTCCATCTTGG - Intergenic
1136262746 16:29092090-29092112 TTGGAAGAGTAGTTCCATCTTGG + Intergenic
1138408058 16:56814688-56814710 GTGGAAAAACAGCAGCCTCTGGG - Intronic
1141874977 16:86818036-86818058 GTGCAAAAGCAGAAGCTTCTAGG + Intergenic
1145099323 17:20060906-20060928 GTGTAAAAGCAGTAACTTGTAGG + Intronic
1147511086 17:41069446-41069468 GTGAAAAAACTGTACCAACTGGG + Intergenic
1151292903 17:73163347-73163369 GTAGAACAGCAGCATCATCTCGG + Intergenic
1153295385 18:3541031-3541053 GAGGTAAAGCAGTTCCTTCTGGG - Intronic
1154126822 18:11699243-11699265 CTGGAGCAGTAGTACCATCTTGG + Intronic
1155428876 18:25734832-25734854 GTAGAAAAACAATACCATCATGG - Intergenic
1159410418 18:68067668-68067690 GTGGCAAAGCATTCCCAGCTGGG + Intergenic
1162179179 19:8855646-8855668 GTGGAGGAGCAATACCATCTAGG + Intronic
927815751 2:26215907-26215929 GTGGAAAATCAGTTGCATATTGG - Intronic
929028582 2:37629425-37629447 CTGGAGTAGCAGTGCCATCTGGG + Intergenic
936737812 2:115468008-115468030 GCGGGAATCCAGTACCATCTGGG - Intronic
937231436 2:120400314-120400336 GAAGAAAAGCAGCTCCATCTGGG - Intergenic
940140255 2:150485600-150485622 ATGGAAAAGCAGGACCCACTGGG - Intronic
941880467 2:170475805-170475827 GAGGCAAAGCAATTCCATCTTGG + Intronic
946144962 2:217723797-217723819 GGGGAAAAGCTGTATCATATTGG - Intronic
1171776567 20:29373726-29373748 GTGGAAAAGCAGTGCATTATGGG - Intergenic
1173063311 20:39682741-39682763 TTGCTAAAGCAGTACCATATTGG + Intergenic
1173141075 20:40483484-40483506 ATTGAAAAGCAGTACCATTGTGG - Intergenic
1174848761 20:53970380-53970402 GTGGAAATCCAGAACAATCTTGG + Intronic
1175928785 20:62483908-62483930 GTGGAAAAACAGCACCTTCCAGG - Intergenic
1176106230 20:63389855-63389877 GTAGAAAATCAGTAACATCTTGG + Intergenic
1178075046 21:29007493-29007515 ATGCAAAAAAAGTACCATCTAGG - Intronic
1179608711 21:42534917-42534939 ATGGAAATGCAGTTACATCTGGG - Intronic
1181554420 22:23659939-23659961 CTGCTAGAGCAGTACCATCTGGG - Intergenic
1185030206 22:48438877-48438899 GGGGAAAAGAAGTTCTATCTGGG + Intergenic
954355499 3:50081329-50081351 TTTTAAAAGCAGTACCAGCTGGG + Intronic
954570893 3:51639930-51639952 GTGGAAAAGCAGTACCATCTTGG - Exonic
956170583 3:66430700-66430722 ATGGCAAAGCAGTACCAGGTTGG + Intronic
957464382 3:80567537-80567559 GTGGAAATACAGAAACATCTGGG + Intergenic
960090754 3:113635814-113635836 GTGGCACAGTAGTACGATCTCGG - Intergenic
963855347 3:150247707-150247729 GGGGAAAGGCAGATCCATCTTGG + Intergenic
967516639 3:190377179-190377201 GAGGAAAAGAAGAACCAGCTTGG + Intronic
970205283 4:13649519-13649541 GTGGAAAAGGAGTAAAATCTGGG - Intergenic
970207762 4:13672709-13672731 ATGGAAAAGCAGCGCCATCAGGG + Intergenic
970707989 4:18828693-18828715 ATGGAAAAGAATGACCATCTTGG - Intergenic
971231783 4:24806144-24806166 GTGGAACAGAAGAACCATGTTGG + Exonic
971953029 4:33379077-33379099 ATGGTAAGGGAGTACCATCTTGG + Intergenic
975003430 4:69255752-69255774 GTGCAGCAGCAGCACCATCTTGG - Intergenic
976924097 4:90475644-90475666 CTGTGAAAGCAGCACCATCTAGG + Intronic
979091906 4:116493770-116493792 GTGGAAAAGCATAACCAAGTTGG + Intergenic
979709254 4:123758394-123758416 GTGGATCAGCAGTACTACCTGGG + Intergenic
984530966 4:180915746-180915768 GTGTAATAGCCATACCATCTAGG - Intergenic
984807473 4:183764732-183764754 CTGGAAATGCAGTCCCAGCTTGG + Intergenic
986696206 5:10357233-10357255 AAGGAAAAGCAGTACAATATTGG + Intronic
987392821 5:17391962-17391984 GTGGAAAGCCAGTTCCATGTTGG + Intergenic
987711156 5:21501730-21501752 CTGCTAGAGCAGTACCATCTGGG + Intergenic
988748991 5:34175896-34175918 CTGCTAGAGCAGTACCATCTGGG - Intergenic
989416748 5:41186931-41186953 TTGGAAAAGCATTAGCATCTTGG - Intronic
990241486 5:53820551-53820573 GTGGAAAGTCAGTACCATGAGGG + Intergenic
991714978 5:69443122-69443144 ATAGAAAAGCAATACCAGCTGGG - Intronic
991761498 5:69920771-69920793 CTGCTAGAGCAGTACCATCTGGG + Intergenic
991785831 5:70197329-70197351 CTGCTAGAGCAGTACCATCTGGG - Intergenic
991840726 5:70795820-70795842 CTGCTAGAGCAGTACCATCTGGG + Intergenic
991878276 5:71197720-71197742 CTGCTAGAGCAGTACCATCTGGG - Intergenic
996808720 5:127489041-127489063 GTGGGCAAGCATTACCATCTGGG - Intergenic
999729424 5:154465188-154465210 GTGAAAAAACAGTACCAATTCGG - Intergenic
1005546533 6:26878774-26878796 CTGCTAGAGCAGTACCATCTGGG - Intergenic
1007023721 6:38548245-38548267 CTGGAAAATCTGTACCATTTTGG - Intronic
1009017288 6:57919858-57919880 CTGCTAGAGCAGTACCATCTGGG - Intergenic
1016359425 6:143251692-143251714 TTGAAAGTGCAGTACCATCTGGG - Intronic
1021244564 7:18245563-18245585 GTTGAAAAGAAGTTCTATCTTGG - Intronic
1021763575 7:23924975-23924997 TTGGAAATGCAGCAGCATCTAGG - Intergenic
1024850520 7:53710128-53710150 GTGGAATAGCAGTATCATTAAGG + Intergenic
1025732690 7:64120449-64120471 CTGCCAGAGCAGTACCATCTGGG + Intronic
1025926473 7:65964397-65964419 CTGCTAGAGCAGTACCATCTGGG - Exonic
1029529437 7:101115550-101115572 GTGGAAAAGGAGGCCCAACTAGG - Intergenic
1029860451 7:103565750-103565772 TTTGAAAAGCATTACCACCTTGG + Intronic
1031439170 7:121772107-121772129 TTGGAGAAGCAGTGCCATATTGG - Intergenic
1041563069 8:59242695-59242717 GAGGAAAAGCAGTAGAATCTGGG - Intergenic
1045317568 8:101056574-101056596 TTGGAAAATATGTACCATCTGGG - Intergenic
1045529391 8:102970161-102970183 GTGGAAAGGCAGTCTCTTCTTGG - Intronic
1050965756 9:11799879-11799901 GTTGAAAACCAGTTCGATCTTGG + Intergenic
1052125346 9:24767474-24767496 GTGGAAAAGCAGAGACTTCTTGG + Intergenic
1052240449 9:26265970-26265992 GTGGAAAGGAAGTACTTTCTTGG + Intergenic
1052254820 9:26443905-26443927 GTGTAAAAGCAGTAGCATCACGG - Intergenic
1052665594 9:31491286-31491308 CTAGAATAGCAGAACCATCTGGG + Intergenic
1055431674 9:76250249-76250271 GGGGAGCAGCAGTGCCATCTCGG - Intronic
1060057280 9:120425731-120425753 GTGGAAAGGAAGAAACATCTGGG - Intronic
1061570912 9:131476961-131476983 GTGGAGAAGCAGAACCATCTAGG - Intronic
1062251642 9:135599778-135599800 GTGAAAAAGCAGTACAATTAAGG + Intergenic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1186177811 X:6943764-6943786 TTGGAAATGCAGCACCATTTAGG - Intergenic
1188132574 X:26455295-26455317 GAACAAAAGCAGTACCTTCTGGG - Intergenic
1188363306 X:29283411-29283433 GGAGAAAAGCGATACCATCTGGG + Intronic
1189474970 X:41344893-41344915 TTGAAAAATCAGTAACATCTTGG + Intronic
1193511809 X:82411318-82411340 GTGCCTAAGCAGTACTATCTCGG - Intergenic
1195010740 X:100730766-100730788 GTAGAAAAGCACCACCAACTTGG - Intronic
1196968152 X:121080455-121080477 GTGGAAAAGCAGTACAATGTGGG - Intergenic
1199230406 X:145430724-145430746 CTGGAAAAGCAGTAAGATTTTGG + Intergenic
1199371244 X:147051637-147051659 GTGTACAAGCAGTACAATTTAGG + Intergenic
1200777399 Y:7181620-7181642 GTGGAAAATGGGTACCACCTGGG + Intergenic